modelgenesymbol	humangenesymbol	genetype	specie	ensembl	alias	geneid	disease	band	method	strainbackground	pmid	id	description	go_function	class
Maoa	MAOA	protein-coding	Mus musculus	ENSMUSG00000025037	1110061B18Rik	17161	Aggressive Behaviors	X A1.2|X 11.78 cM	Knockout	Tg(H2-IFN-β)8	7792602	1	Expeimentalparadigm: Resident-intruder test  /n  Model Generation: We generated mice transgenic for IFN-β by injecting an IFN-β minigene into one-cell embryos of C3H/HeJ (C3H) mice. The minigene was devised to evaluate the potential of the gene encoding IFN-β for antiviral gene therapy. We describe the transgenic line Tg(H2-IFN-β)8 (Tg8), which was initially characterized by the X-linked recessive abnormal behavior of mouse pups. By Southern (DNA) blot hybridization and polymerase chain reaction (PCR), a single minigene copy was found in Tg8 DNA (5). This transgene was transmitted by X-linked inheritance. By reverse transcriptase-mediated PCR (RT-PCR), IFN-β RNA was detected in the testis and spleen but not in the brain. Because this suggested that the abnormal behavior of Tg8 mice was not due to IFN-β, we examined the behavior of the F2 progeny of Tg8 females mated to knockout males lacking the IFN-β receptor (6). F2 and F3 pups having the IFN-β transgene but no IFN-β receptor displayed the same abnormal behavior as Tg8 pups and were used to rule out the possibility of IFN-β affecting the phenotypic features of Tg8 mice. By inverse PCR (7) done on Tg8 DNA with transgene primers, we obtained 2.0 kb of the two genomic regions flanking the transgene. We then isolated the junctions by inverse PCR done on C3H DNA with primers derived from the flanking regions, and it appeared that transgene integration had caused a genomic deletion of at least 1 kb. The 2-kb flanking sequences and 1-kb deleted sequences were not found in the GenBank and European Molecular Biology Laboratory databases but were mapped to a 3-million–base pair (bp) X-chromosome region containing several genes (8), including the genes encoding MAOA and MAOB. RT-PCR done on total RNA from Tg8 spleen or testes, with two primers derived from rat MAOA exons 1 and 8 (9), showed that the MAOA RNA of Tg8 mice, instead of occurring as a single species as did the MAOA RNA of C3H mice, consisted of at least four smaller species (Fig. 1A). PCR on Tg8 DNA indicated that exons 2 and 3 were missing. The deletion encompassing MAOA exons 2 and 3 was estimated by Southern blot analysis to span 17 kb.  /n  Rescue: -  /n  Model Summary: Deficiency in monoamine oxidase A (MAOA), an enzyme that degrades serotonin and norepinephrine, has recently been shown to be associated with aggressive behavior in men of a Dutch family. A line of transgenic mice was isolated in which transgene integration caused a deletion in the gene encoding MAOA, providing an animal model of MAOA deficiency. In pup brains, serotonin concentrations were increased up to ninefold, and serotonin-like immunoreactivity was present in catecholaminergic neurons. In pup and adult brains, norepinephrine concentrations were increased up to twofold, and cytoarchitectural changes were observed in the somatosensory cortex. Pup behavioral alterations, including trembling, difficulty in righting, and fearfulness were reversed by the serotonin synthesis inhibitor parachlorophenylalanine. Adults manifested a distinct behavioral syndrome, including enhanced aggression in males.	protein binding,primary amine oxidase activity,oxidoreductase activity,flavin adenine dinucleotide binding,serotonin binding,tryptamine:oxygen oxidoreductase (deaminating) activity,aminoacetone:oxygen oxidoreductase(deaminating) activity,aliphatic amine oxidase activity,phenethylamine:oxygen oxidoreductase (deaminating) activity,monoamine oxidase activity	Ani
Drd1	DRD1	protein-coding	Mus musculus	ENSMUSG00000021478	C030036C15Rik|Drd-1|Drd1a|Gpcr15	13488	Schizophrenia	13 B1|13 28.4 cM	Mutated	C57BL/6	7954836	2	Expeimentalparadigm: Locomotion test  /n  Model Generation: Chimeric mice were generated as described by Bradley (1987). In brief, ES cells amplified from the homologous recombinants were injected into blastocysts isolated from C5766 female mice. Then, the injected blastocysts were implanted back into the uteri of (C57B6 xDBA*)Fl females. The resulting male chimeric mice were bred repeatedly with C57B6 females, and germline transmission was identified initially by screening for agouti offspring. Mice heterozygous for the Dl mutation were confirmed by genomic Southern blot analyses of DNA isolated from their tails. Finally, mice homozygous for Dl mutation were produced by crossing heterozygous mutant mice and were identified by Southern blotting of tail DNA. All breeding was carried out under standard animal housing conditions in the Massachusetts Institute of Technology animal facility.  /n  Rescue: -  /n  Model Summary: To investigate the contribution of the dopamine D1 receptor to this modulation, we have used gene targeting technology to generate D1 receptor mutant mice. Histological analyses suggested that there are no major changes in general anatomy of the mutant mouse brains, but indicated that the expression of dynorphin is greatly reduced in the striatum and related regions of the basal ganglia. The mutant mice do not respond to the stimulant and suppressive effects of D1 receptor agonists and antagonists, respectively, and they exhibit locomotor hyperactivity. These results suggest that the D1 receptor regulates the neurochemical architecture of the striatum and is critical for the normal expression of motor activity.	dopamine neurotransmitter receptor activity, coupled via Gs,G-protein alpha-subunit binding,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,protein phosphatase binding,angiotensin receptor binding,D3 dopamine receptor binding,dopamine binding,protein-containing complex binding,ATPase binding,heterocyclic compound binding	Ani
Htr1b	HTR1B	protein-coding	Mus musculus	ENSMUSG00000049511	5-HT-1B	15551	Aggressive Behaviors	9 E1|9 44.61 cM	Knockout	C57BL/6;129/Svter	8091214	3	Expeimentalparadigm: Open field test//Resident-intruder test  /n  Model Generation: To study the function of the 5-HT1B receptor, we have generated by homologous recombination in embryonic stem (ES) cells homozygous mutant mice lacking both copies of the gene encoding the 5-HT1B receptor (6, 7). Four positive ES cell clones were obtained with both the JA and the JB targeting vectors (Fig. 1 and Table 1). Southern (DNA) blot analyses with Xba 1 digests and the E2A1 probe or the neo probe confirmed that accurate targeting occurred and that no additional integration took place. Cells from the positive clones JA7 and JB13 were microinjected into 3.5-day C57BL/6 mouse blastocysts. The two clones gave rise to highly chimeric mice, which were bred with C57BL/6 females to test for germline transmission of the mutated 5-HT1 B receptor gene. The positive chimeras were bred with females from the 129/Svter inbred strain to obtain heterozygotes on the 129/Sv-ter genetic background. Homozygous animals were generated by heterozygote crossings, and the expected 1:2:1 ratio of wild-type (WT), heterozygous, and homozygous mutant progeny was observed (Table 1 ).  /n  Rescue: -  /n  Model Summary: The neuromodulator serotonin (5-hydroxytryptamine, 5-HT) has been associated with mood disorders such as depression, anxiety, and impulsive violence. To define the contribution of 5-HT receptor subtypes to behavior, mutant mice lacking the 5-HT1B receptor were generated by homologous recombination. These mice did not exhibit any obvious developmental or behavioral defects. However, the hyperlocomotor effect of the 5-HT1A/1B agonist RU24969 was absent in mutant mice, indicating that this effect is mediated by 5-HT1B receptors. Moreover, when confronted with an intruder, mutant mice attacked the intruder faster and more intensely than did wild-type mice, suggesting the participation of 5-HT1B receptors in aggressive behavior.	G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,neurotransmitter receptor activity,serotonin binding,voltage-gated calcium channel activity involved in regulation of presynaptic cytosolic calcium levels,heterocyclic compound binding	Ani
Snap25	SNAP25	protein-coding	Mus musculus	ENSMUSG00000027273	Bdr|GENA70|SNAP-25|SUP|sp	20614	Attention-Deficit/Hyperactivity Disorder	2 F3|2 67.56 cM	Knockout	Coloboma	8622140	4	Expeimentalparadigm: Automated photocell activity cages  /n  Model Generation: Eight- to ten-week-oldCm/+ mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and subsequently bred at both The Scripps Research Institute and The Pennsylvania State University College of Medicine. The coloboma mutation originally identified on a C3H/HeH×101/H F1 male was backcrossed for 32 generations onto a C57BL/6By strain. The mutation has since been backcrossed to the C3H/HeSnJ strain for at least 10 generations at The Jackson Laboratory.  /n  Rescue: When a transgene encoding SNAP-25 was bred into the coloboma strain to complement the Snap deletion, the hyperactivity expressed by these mice was rescued, returning these corrected mice to normal levels of locomotor activity.  /n  Model Summary: The mouse mutant coloboma (Cml+) exhibits profound spontaneous locomotor hyperactivity resulting from a deletion mutation. This deletion encompasses several genes including Snap, which encodes SNAP-25, a nerve terminal protein involved in neurotransmitter release.	SNARE binding,voltage-gated potassium channel activity,SNAP receptor activity,protein binding,lipid binding,myosin binding,syntaxin-1 binding,protein domain specific binding,syntaxin binding,transmembrane transporter binding,protein N-terminus binding,calcium-dependent protein binding,molecular adaptor activity	Ani
Adora2a	ADORA2A	protein-coding	Mus musculus	ENSMUSG00000020178	A2AAR|A2aR|AA2AR|ARA2A	11540	Aggressive Behaviors	10|10 C1	Knockout	129/Sv	9262401	5	Expeimentalparadigm: Elevated plus maze test  /n  Model Generation: The A2aR gene was cloned from a 129/Sv mouse genomic library by using a dog cDNA probe2,3. Seven clones spanning the locus were obtained, and the two exons were mapped and sequenced. A PGK-Neo cassette was inserted between the Ncol and EcoRI restriction sites within the first exon. The cassette replaced the first 102 codons of the gene, encoding transmembrane segments 1 to 3, and was flanked by 4.5 kb of 5′ and 10.5 kb of 3′ mouse gene fragments. Homologous recombination was carried out in the R1 ES cell line (129/Sv × 129/Sv-CP derived)25. ES cells were electroporated (BioRad Gene Pulser; 240 V and 500μF) with 84 μg targeting construct DNA, and plated onto γ-irradiated STP OB500 feeder cells. G418(250 μg ml-1)-resistant colonies were collected after 11 days of selection, and recombinant clones were screened by Southern blotting after DraI digestion and hybridization with a 32P-labelled 2,800-bp EcoR1 fragment (Fig. 1). After mild trypsinization, clumps of ES cells were allowed to aggregate overnight in M16 medium with single CD1 eight-cell stage embryos after removal of the zona pellucida by treatment with acidic Tyrode's buffer26. Embryos were transferred into the uterus of pseudopregnant recipients (2.5 d.p.c.). Fetuses were recovered by caesarean section on day 20. Chimaeras were mated with CD1 mice and heterozygous mutants were bred for four generations with wild-type CD1 mice in order to dilute out the 129/Sv background. Heterozygotes were then bred together to generate wild-type homozygotes (A2aR), heterozygotes (A2aR+/++/-) and knockout (A2aR-/-) animals. Heterozygotes have not so far been studied extensively.  /n  Rescue: -  /n  Model Summary: Here we investigate the role of the A2a receptor by disrupting the gene in mice. We found that A2aR-knockout (A2aR-/-) mice were viable and bred normally. Their exploratory activity was reduced, whereas caffeine, which normally stimulates exploratory behaviour, became a depressant of exploratory activity. Knockout animals scored higher in anxiety tests, and male mice were much more aggressive towards intruders. The response of A2aR-/- mice to acute pain stimuli was slower. Blood pressure and heart rate were increased, as well as platelet aggregation.	G protein-coupled adenosine receptor activity,G protein-coupled receptor activity,lipid binding,enzyme binding,type 5 metabotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,alpha-actinin binding	Ani
Drd4	DRD4	protein-coding	Mus musculus	ENSMUSG00000025496	D4R|Drd-4	13491	Attention-Deficit/Hyperactivity Disorder	7 F5|7 86.6 cM	Knockout	NA	9323127	6	Expeimentalparadigm: Open field test//Rearing behavior//Rotarod  /n  Model Generation: A 129SvEv mouse genomic library (generously provided by P. Soriano) was screened with a human D4.4 receptor probe. Positive phages were mapped and partially sequenced. CsCl banded targeting vector (25 μg) was linearized (NotI) and electroporated into ~2 × 107 129/Ola Hsd E14TG2A embryonic stem cells (provided by R. Murray) and maintained under double selection (300 μg/ml G418, 2 μM gancyclovir) as previously described (Rubinstein et al. 1996). Total RNA was prepared from mouse tissue using the RNeasy Mini Kit (Qiagen) and used for first strand cDNA synthesis (Superscript II, GIBCO-BRL). An aliquot of this cDNA was then subjected to amplification by PCR (94°C, 1.5 min; 60°C, 2.0 min; 72°C, 2.5 min × 30) with primers C and A and Southern blotted and probed with a 32P-labeled fragment of the mouse D4 receptor cDNA.  /n  Rescue: -  /n  Model Summary: The human dopamine D4 receptor (D4R) has received considerable attention because of its high affinity for the atypical antipsychotic clozapine and the unusually polymorphic nature of its gene. To clarify the in vivo role of the D4R, we produced and analyzed mutant mice (D4R-/-) lacking this protein. Although less active in open field tests, D4R-/- mice outperformed wild-type mice on the rotarod and displayed locomotor supersensitivity to ethanol, cocaine, and methamphetamine. Biochemical analyses revealed that dopamine synthesis and its conversion to DOPAC were elevated in the dorsal striatum from D4R-/- mice.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,SH3 domain binding,neurotransmitter receptor activity,dopamine binding,identical protein binding,metal ion binding,epinephrine binding,norepinephrine binding,heterocyclic compound binding	Ani
Adra2c	ADRA2C	protein-coding	Mus musculus	ENSMUSG00000045318	Adra-2c|[a]2C|alpha2-C4|alpha2C	11553	Aggressive Behaviors	5 B2|5 18.09 cM	Knockout	C57BL/6J	9526020	7	Expeimentalparadigm: Startle experiment//Isolation–aggression tests  /n  Model Generation: The generation of both mutant strains has been described previously (Link et al., 1995; Sallinen et al., 1997). Briefly, the α2C-AR gene was inactivated in 129/Sv embryonic stem cells (Nagy et al., 1993), which were injected into C57BL/6J blastocysts, and the resulting chimeric mice were bred to F1 (C57BL/6J × DBA/2J) animals. These animals were back-crossed for several generations to C57BL/6J mice and then intercrossed, and the tested α2C-KO mice were offspring of closely related F11–12 pairs, which were combinations of mice with wild-type, heterozygous, or homozygous genotypes for the α2C-AR mutation. All tested α2C-KO mice were homozygous for the mutation. The germline transmission of the mutation was monitored from mouse tail biopsies by Southern (DNA) analysis.  /n  Rescue: -  /n  Model Summary: In this study, the mice with targeted inactivation of the gene encoding alpha2C-ARs (alpha2C-KO) had enhanced startle responses, diminished PPI, and shortened attack latency in the isolation-aggression test.	G protein-coupled receptor activity,adrenergic receptor activity,alpha2-adrenergic receptor activity,alpha-2A adrenergic receptor binding,protein homodimerization activity,protein heterodimerization activity,epinephrine binding	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6	9537323	8	Expeimentalparadigm: Noxious mechanical threshold test//Hot plate test//Stress induced analgesia test//Open field test//Resident–intruder assay//Tail pinch test//Forced swim test  /n  Model Generation: A genomic DNA clone containing exon 1 of the mouse NK1receptor gene was isolated by screening a λ2001 mouse 129 library with a rat NK-1 cDNA probe3. A cassette containing an internal ribosome entry site and the lacZ coding sequence11, together with a neomycin-resistance gene expressed from its own promoter, was inserted into the unique StuI site in exon 1. For negative selection, two copies of an HSV-tk gene were inserted in the 5′ polylinker11. The vector was linearized and electroporated into HM1 ES cells. G418- and GANC-resistant clones were selected and identified. Two targeted clones were injected into C57BL/6 blastocysts, and chimaeric males were mated with C57BL/6 females.  /n  Rescue: -  /n  Model Summary: Here we investigate the effect of disrupting the gene encoding the NK-1 receptor in mice. We found that the mutant mice were healthy and fertile, but the characteristic amplification ('wind up') and intensity coding of nociceptive reflexes was absent. Although substance P did not mediate the signalling of acute pain or hyperalgesia, it was essential for the full development of stress-induced analgesia and for an aggressive response to territorial challenge, demonstrating that the peptide plays an unexpected role in the adaptive response to stress.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Crhr1	CRHR1	protein-coding	Mus musculus	ENSMUSG00000018634	CRF1R|CRFR1|Crhr	12921	Anxiety Disorder	11 E1|11 67.77 cM	Knockout	129/Ola	9620773	9	Expeimentalparadigm: Open field test//Light-dark box test  /n  Model Generation: A 129/Sv/J-derived genomic cosmid library (sCos-1; ref. 23) was screened using a 5′-cDNA probe of 371 bp (corresponding to bp 176-547) and a 3′-cDNA probe of 263 bp (bp 693-956; ref. 3). A 35.8-kb cosmid clone was identified, encompassing the last 12 exons of the Crhr1 locus. A 5.4-kb SpeI/XhoI fragment (long arm) containing transmembrane domains I to IV, and a 2.9-kb HindIII/BamHI fragment (short arm) 3′ to the polyadenylation signal was cloned into pPNT (ref. 24) containing a neomycin and thymidine-kinase cassette. E14.1 ES cells were electroporated with the targeting vector, and mutant ES cells were identified by genotyping using HindIII digestion and Southern-blot analysis25. A 0.95-kb BamHI fragment (3′ external probe) detected a 5.4-kb wild-type and a 7.25-kb mutant fragment (Fig. 1a, b ). A 1.1-kb EcoRV/SpeI (5′ external probe) located upstream of the targeting vector was used to confirm the homologous recombination event in the 5′ region. The targeting frequency was 1.33%. Mutant ES cells were used to generate aggregation chimaeras. Germ-line transmission was determined by blot analysis after HindIII digestion (Fig. 1c). Chimaeras were bred with either 129/Ola or CD1 mouse strains to obtain F1 offspring. Preliminary experiments suggested that there is no effect of the genetic background on the mutant phenotype. The experiments were performed on F2 hybrids generated by F1 intercrosses.  /n  Rescue: -  /n  Model Summary: Corticotropin-releasing hormone (CRH) is a potent mediator of endocrine, autonomic, behavioural and immune responses to stress, and has been implicated in the stress-like and other aversive consequences of drug abuse, such as withdrawal from alcohol. Two CRH receptors, Crhr1 and Crhr2, have been identified in the mouse. Crhr1 is highly expressed in the anterior pituitary, neocortex, hippocampus, amygdala and cerebellum, and activation of this receptor stimulates adenylate cyclase. Here we show that in mice lacking Crhr1, the medulla of the adrenal gland is atrophied and stress-induced release of adrenocorticotropic hormone (ACTH) and corticosterone is reduced. The homozygous mutants exhibit increased exploratory activity and reduced anxiety-related behaviour under both basal conditions and following alcohol withdrawal. Our results demonstrate a key role of the Crhr1 receptor in mediating the stress response and anxiety-related behaviour.	G-protein alpha-subunit binding,transmembrane signaling receptor activity,G protein-coupled receptor activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,peptide binding,corticotropin-releasing hormone receptor activity,protein-containing complex binding,corticotropin-releasing hormone binding	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Anxiety Disorder	13 D1|13 56.92 cM	Targeted	129/Sv	9724773	10	Expeimentalparadigm: Open field test//Forced swim test//Rotarod  /n  Model Generation: The gene for the 5-HT1AR was cloned from a BALB/c mouse genomic library (30). Construction of the targeting vector (Fig. <U+200B>(Fig.11A), electroporation of the targeting vector into E14 embryonic stem (ES) cells, and selection of the targeted clones were carried out by standard procedures (31). Correctly targeted cell clones were identified by a nested PCR assay (32) that could amplify a fragment from the substituted allele but not a fragment from the wild-type allele or targeting vector. The PCR primers were located in the 3′ noncoding regions of the heterologous neomycin resistance gene (KO primers 1 and 2) and the endogenous receptor gene (wild-type primers 3 and 4). The first 20 cycles of PCR were performed with KO primer 1 (5′-GACCGCTATCAGGACATAGCG-3′) and wild-type primer 3 (5′-TCTTAGGTGTTGCTTCCAGGG-3′). KO primer 2 (5′-ACGGTATCGCCGCTCCCGATTC-3) and wild-type primer 4 (5′-CCCTGTAAGCCCTACACTCTT-3′) were used for the next 30 cycles. The wild-type allele was detected by a similar procedure except that KO primers 1 and 2 were replaced by wild-type primers 1 (5′-ATGGATATGTTCAGTCTTGGC-3′) and 2 (5′-CAGGGCAACAACACCACAACG-3′), both corresponding to the 5′ coding region of the receptor gene absent in the knockout allele. The wild-type primers could amplify a fragment only from the wild-type allele. Chimeras were generated by aggregation (33) from two ES cell lines (designated C9W and D8M). Two independent knockout (5-HT1AR-) mouse lines were established from these clones. Because the 129sv genetic background (the standard background for knockouts) is not particularly suitable for behavioral testing, chimeras were backcrossed to Swiss–Webster mice to obtain heterozygotes. These F1 animals were crossbred to produce homozygous F2 mutants. Control nonchimeric littermates were similarly bred to control for a disequilibrium of genes that are linked to the mutation (34). F2 progeny with two wild-type 129sv 5-HT1AR alleles were selected by single-strand length polymorphism. Single-strand length polymorphism analysis was based on the closest marker (D13MIT193, located 5.1 centimorgans from the 5-HT1AR locus) (35) that showed a difference between the two genotypes. D13MIT193-specific primers (Research Genetics, Huntsville, AL) were used in standard PCR reactions and separated on 4% agarose gels. Amplified bands were approximately 130 and 110 bp long in Swiss–Webster and 129sv mice, respectively.  /n  Rescue: -  /n  Model Summary: Brain serotonin (5-HT) has been implicated in a number of physiological processes and pathological conditions. These effects are mediated by at least 14 different 5-HT receptors. We have inactivated the gene encoding the 5-HT1A receptor in mice and found that receptor-deficient animals have an increased tendency to avoid a novel and fearful environment and to escape a stressful situation, behaviors consistent with an increased anxiety and stress response. Based on the role of the 5-HT1A receptor in the feedback regulation of the 5-HT system, we hypothesize that an increased serotonergic neurotransmission is responsible for the anxiety-like behavior of receptor-deficient animals. This view is consistent with earlier studies showing that pharmacological activation of the 5-HT system is anxiogenic in animal models and also in humans.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
Ube3a	UBE3A	protein-coding	Mus musculus	ENSMUSG00000025326	4732496B02|5830462N02Rik|A130086L21Rik|Hpve6a	22215	Autism Spectrum Disorder	7 B5|7 33.95 cM	Conditional Knockout	129/SvEv, C57BL/6	9808466	11	Expeimentalparadigm: Fear conditioning test  /n  Model Generation: A mouse Ube3a cDNA clone (GenBank accession number U82122) was used to screen a 129/SvEv genomic DNA library provided by Dr. Allan Bradley. The targeting vector was designed to delete a 3 kb fragment from Sac I to Xba I, which contains exon 2 (299 bp) of Ube3a. The plasmid (pL13) contained a neo-selectable marker; in addition, a loxP site and 5′ portion of an HPRT-selectable marker were included to facilitate the preparation of large chromosomal deletions downstream of Ube3a in future studies. Vector DNA (15 μg) was linearized in the plasmid backbone and electroporated into 1 × 10 AB2.2 ES cells as described previously (Bullard et al. 1996). G418-resistant clones were screened by Southern blotting using a 5′ flanking probe. The positive clones were expanded and confirmed by Southern blotting using various probes as depicted in Figure 1 prior to injection. Targeted clones were injected into C57BL/6J blastocysts by standard procedures. For PCR-based genotyping, the primer sites were as diagrammed in Figure 1A.  /n  Rescue: -  /n  Model Summary: The E6-AP ubiquitin ligase (human/mouse gene UBE3A/Ube3a) promotes the degradation of p53 in association with papilloma E6 protein, and maternal deficiency causes human Angelman syndrome (AS). Ube3a is imprinted with silencing of the paternal allele in hippocampus and cerebellum in mice. We found that the phenotype of mice with maternal deficiency (m-/p+) for Ube3a resembles human AS with motor dysfunction, inducible seizures, and a context-dependent learning deficit.	transcription coactivator activity,ubiquitin-protein transferase activity,protein binding,transferase activity,metal ion binding,ubiquitin protein ligase activity	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Anxiety Disorder	13 D1|13 56.92 cM	Knockout	129/Sv	9826725	12	Expeimentalparadigm: Open field test//Elevated plus maze//Swimming test  /n  Model Generation: The 5-HT1A gene was cloned from a 129/Sv mouse genomic library (Lambda EMBL3, Stratagene) by using the human 5-HT1A gene as a probe (6). A KpnI fragment containing the 5-HT1A gene was cloned in pGEM-13(+). The PGK-neo gene was inserted into an AscI site located after the third transmembrane domain of the 5-HT1A gene. W9.5 embryonic stem cells were electroporated (Bio-Rad Gene Pulser; 800 V and 3 μF) with 30 μg of the targeting construct. These embryonic stem cells were then plated onto mitomycin treated mouse embryonic fibroblasts for 1 week in the presence of G418 (150 μg per ml of active substance). The G418-resistant clones were screened by Southern blot with a BglII digest and a 32P-labeled outside probe (600-bp HindIII–KpnI fragment). Positive cells for the targeting event were injected into C57BL6/J blastocysts. These blastocysts were reimplanted in B6CBAF1/J foster mothers, which gave birth to chimeric mice. Chimeras were mated with 129/Sv females to generate heterozygous mutant (+/-) mice on a pure 129/Sv genetic background. The resulting heterozygous mice were bred and generated 25% homozygous mutant mice.  /n  Rescue: -  /n  Model Summary: To investigate the contribution of individual serotonin (5-hydroxytryptamine; 5-HT) receptors to mood control, we have used homologous recombination to generate mice lacking specific serotonergic receptor subtypes. In the present report, we demonstrate that mice without 5-HT1A receptors display decreased exploratory activity and increased fear of aversive environments (open or elevated spaces). 5-HT1A knockout mice also exhibited a decreased immobility in the forced swim test, an effect commonly associated with antidepressant treatment. Although 5-HT1A receptors are involved in controlling the activity of serotonergic neurons, 5-HT1A knockout mice had normal levels of 5-HT and 5-hydroxyindoleacetic acid, possibly because of an up-regulation of 5-HT1B autoreceptors. Heterozygote 5-HT1A mutants expressed approximately one-half of wild-type receptor density and displayed intermediate phenotypes in most behavioral tests. These results demonstrate that 5-HT1A receptors are involved in the modulation of exploratory and fear-related behaviors and suggest that reductions in 5-HT1A receptor density due to genetic defects or environmental stressors might result in heightened anxiety.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Anxiety Disorder	13 D1|13 56.92 cM	Knockout	C57BL/6J	9844013	13	Expeimentalparadigm: Home-cage activity//Rotorod//Open field test//Elevated zero maze//Novelty object recognition//Tail suspension test//8-OH-DPAT-induced hypothermia  /n  Model Generation: Male chimeras produced by injection of targeted ES cells into C57BL/6J blastocysts were bred with C57BL/6J females. Germ-line transmission of the targeted mutation was verified by Southern blot analysis of tail DNA. Heterozygotes were then mated with C57BL/6J mice, and the resulting heterozygous animals were crossed, producing homozygous mutant, heterozygous, and wild-type mice. Animals of this generation were used for the studies reported. Mice were group-housed 2–6 mice per cage with free access to food and water under a 12-hr light/dark cycle (lights on at 0600 hr). For behavioral and physiological experiments, investigators were blind to animal genotype.  /n  Rescue: -  /n  Model Summary: To evaluate the contribution of serotonin 5-HT1A receptors to the regulation of these processes, we have used gene-targeting technology to generate 5-HT1A receptor-mutant mice. These animals lack functional 5-HT1A receptors as indicated by receptor autoradiography and by resistance to the hypothermic effects of the 5-HT1A receptor agonist 8-hydroxy-2-(di-n-propylamino)tetralin (8-OH-DPAT). Homozygous mutants display a consistent pattern of responses indicative of elevated anxiety levels in open-field, elevated-zero maze, and novel-object assays. Moreover, they exhibit antidepressant-like responses in a tail-suspension assay.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
App	APP	protein-coding	Mus musculus	ENSMUSG00000022892	Abeta|Abpp|Adap|Ag|Cvap|E030013M08Rik|betaApp	11820	Aggressive Behaviors	16 C3.3|16 46.92 cM	Transgene	FVB/N	9858360	14	Expeimentalparadigm: Isolation-induced aggression test  /n  Model Generation: Test animals were FVB/N male mice, either nontransgenic or APP transgenic expressing wild-type APP (line APP/4) or the clinical London (line APP/Ld/2) or Swedish mutant (line APP/Sw/3) of APP.14 The cDNA coding for human wild type APP, for the Swedish (K670N, M671L) mutant and the London (V642I) mutant were cloned in a modified mouse thy-1 gene promoter construct as described.13,14  /n  Rescue: Apart from cognitive deficits, the APP transgenic mice were characterized by aggressive behaviour, which was pharmacologically alleviated with 8-OH-DPAT and buspirone, two serotonergic agonists.  /n  Model Summary: Transgenic mouse strains were generated that overexpress human APP or clinical mutants of APP. All transgenic mouse strains that over-express APP displayed essentially the same phenotype of disturbed behaviour, differential glutamatergic responses, deficits in maintenance of long-term potentiation and premature death, but formation of amyloid plaques was seen in the highest expressing APP/London transgenic mice only.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,G protein-coupled receptor binding,chromatin binding,serine-type endopeptidase inhibitor activity,signaling receptor binding,frizzled binding,insulin receptor binding,integrin binding,protein binding,heparin binding,peptidase activator activity,enzyme binding,peptidase inhibitor activity,signaling receptor activator activity,acetylcholine receptor binding,apolipoprotein binding,chemoattractant activity,identical protein binding,protein homodimerization activity,ion binding,heparan sulfate proteoglycan binding,metal ion binding,ephrin receptor binding,transition metal ion binding,protein heterodimerization activity,protein dimerization activity,low-density lipoprotein particle receptor binding,RAGE receptor binding,chaperone binding,PTB domain binding,growth factor receptor binding	Ani
Il6	IL6	protein-coding	Mus musculus	ENSMUSG00000025746	Il-6	16193	Aggressive Behaviors	5 B1|5 15.7 cM	Knockout	CBA;C57BL/6	9875345	15	Expeimentalparadigm: Behavioural observations  /n  Model Generation: In these transgenic mice, to abolish IL-6 function, the sequences coding for the amino-terminal half of the protein were eliminated. ES cell clones (129 type, from the ES cell line CCE, see Robertson et<U+2003>al. 1986) carrying the IL-6 mutation were injected into blastocysts of C57BL6 mice and transplanted into the uteri of F1 (CBA×C57BL6) foster mothers. Male chimeras were mated to MFI strain females, and agouti offspring (representing germline transmission of the ES genome) were screened for the presence of the targeted IL-6 locus by Southern blot analysis of EcoRI-digested tail DNA using the probe 5′. Female offspring heterozygous for the mutation were bred once with mice of the 129/SV/EV strain, the strain from which the CCE ES cells were derived. The resulting heterozygous offspring were bred together to generate mice homozygous (IL-6<U+2003>–/–) for the mutation (these procedures have been described in greater detail, see Poli et<U+2003>al. 1994 and Lattanzio et<U+2003>al. 1997). Wildtype littermates were used as controls.  /n  Rescue: -  /n  Model Summary: In this experiment aggressive and affiliative behaviour exhibited during agonistic encounters by transgenic male mice either not expressing (IL-6 -/-) or overexpressing (NSE-hIL-6) IL-6 in the central nervous system was investigated. All subjects were isolated for 24 days before the aggressive encounter and were 52 days old at the time of testing. Subjects were placed for 5 consecutive days in a neutral cage for 15 min with an opponent of the Balb/c strain that had been previously isolated for the same amount of time. The first and the last test sessions were videotaped to evaluate the first approach and the establishment of the social role, respectively. A number of behavioural categories were later scored. When compared with wild-type controls, IL-6 -/- mice showed a higher degree of aggressive behaviour as indicated by a higher frequency of Offensive Upright Posture, an effect more pronounced on the fifth encounter. On the contrary, NSE-hIL-6 subjects showed a tendency to be more involved in affiliative-type social interactions, displaying a higher frequency and duration of behaviours such as Anogenital, Nose or Body Sniff. IL-6 -/- mice showed a clear tendency to exhibit less affiliative interactions compared with their controls while dopamine levels were found to be modified in a number of brain regions in these mice.	signaling receptor binding,cytokine activity,interleukin-6 receptor binding,protein binding,growth factor activity	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	NA	9888856	16	Expeimentalparadigm: Open field test//Radial arm maze  /n  Model Generation: -  /n  Rescue: Administration of the SERT inhibitor, fluoxetine, markedly attenuated the activity of the DAT-KO mice (Fig. 3I), whereas it had no effect on wild-type animals (14).  /n  Model Summary: Mice lacking the gene encoding the plasma membrane dopamine transporter (DAT) have elevated dopaminergic tone and are hyperactive. This activity was exacerbated by exposure to a novel environment. Additionally, these mice were impaired in spatial cognitive function, and they showed a decrease in locomotion in response to psychostimulants. This paradoxical calming effect of psychostimulants depended on serotonergic neurotransmission. The parallels between the DAT knockout mice and individuals with ADHD suggest that common mechanisms may underlie some of their behaviors and responses to psychostimulants.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Alcohol Use Disorder	9 A5.3|9 26.72 cM	Knockout	C57BL/6J	10196569	17	Expeimentalparadigm: Two-bottle choice paradigm//Ethanol locomotor activity  /n  Model Generation: The original F2 hybrid strain (129/Sv × C57BL/6J) containing the mutated D2 receptor allele was generated in our laboratory as described previously (Kelly et al., 1997). To establish an incipient congenic B6 strain, D2 dopamine receptor (D2R)+/- mice were backcrossed to wild-type C57BL/6J for five generations. The sex of the +/- mice was alternated between male and female for each successive generation. After the fifth generation backcross, the colony was expanded by inbreeding pairs of nonsibling +/- male and female mice (all parents were N5, making all pups N5 equivalents), and each mouse was genotyped by Southern blot as described (Kelly et al., 1997). The 129/Sv strain mice that the D3 embryonic stem (ES) cells (Doetschman et al., 1985) were derived from are no longer commercially available. Therefore, to establish a substrain 129 line of mutant mice, the original male chimeras derived from the gene-targeted ES cells were bred to closely related wild-type 129/SvEvTac females (Simpson et al., 1997) to produce substrain 129+/- mice. The colony was then expanded as above. For simplicity these lines of mutant mice are referred to as congenic B6 and congenic 129 in this report. Wild-type C57BL/6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME), and 129/SvEvTac mice were obtained from Taconic (Germantown, NY).  /n  Rescue: -  /n  Model Summary: We studied the ethanol preference and sensitivity of D2-receptor-deficient mice to directly evaluate whether dopamine D2 receptors contribute to alcohol (ethanol) consumption. We report a marked aversion to ethanol in these mice, relative to the high preference and consumption exhibited by wild-type littermates. Sensitivity to ethanol-induced locomotor impairment was also reduced in these mutant mice, although they showed a normal locomotor depressant response to the dopamine D1 antagonist SCH-23390.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Thrb	THRB	protein-coding	Mus musculus	ENSMUSG00000021779	Nr1a2|T3R[b]|T3Rbeta|Thrb1|Thrb2|c-erbAbeta	21834	Attention-Deficit/Hyperactivity Disorder	14|14 A1	Knockout	CD1	10454355	18	Expeimentalparadigm: Open field test//Rotorod//Wire-hang test//Operant testing//Autoshaping//Simple reaction time//Go no-go task  /n  Model Generation: Mutant PV TRβ1 cDNA was constructed as described previously (Meier et al. 1992) and was subcloned into the HindIII site of the human β-actin construct (BAP.2; gift of S. Goff, Columbia University, New York, NY). The injection of the purified ClaI fragment and preparation of transgenic mice were done according to the procedures of Hogan and Lacy (1986). Founders on a CD-1 background were analyzed by HindIII restriction digestion of tail DNA to release the 1.4-kb transgene, followed by Southern analysis as described previously (Wong et al. 1997).  /n  Rescue: -  /n  Model Summary: These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,transcription coactivator binding,DNA binding,chromatin binding,double-stranded DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,zinc ion binding,enzyme binding,chromatin DNA binding,identical protein binding,sequence-specific DNA binding,metal ion binding,thyroid hormone binding,sequence-specific double-stranded DNA binding	Ani
Nos1	NOS1	protein-coding	Mus musculus	ENSMUSG00000029361	2310005C01Rik|N-NOS|NC-NOS|NO|NOS|NOS-I|Nos-1|bNOS|nNOS	18125	Aggressive Behaviors	5 F|5 57.29 cM	Knockout	C57BL/6J	10479702	19	Expeimentalparadigm: Aggressive test  /n  Model Generation: Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradi_x0002_ated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation. Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradiated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation.  /n  Rescue: -  /n  Model Summary: In the present study, female mice with targeted disruption of the neuronal nitric oxide synthase gene (nNOS-/-) displayed significant deficits in maternal aggression relative to wild-type (WT) mice in terms of percentage displaying aggression, the average number of attacks against a male intruder, and the total time spent attacking the male intruder. The nNOS-/- mice displayed normal pup retrieval behavior. Because the specific deficits in maternal aggression in the nNOS-/- mice suggested a possible role for NO in maternal aggression, we combined behavioral testing of WT mice with immunohistochemistry for citrulline, an indirect marker of NO synthesis, to examine indirectly NO synthesis during maternal aggression. A significant increase in the number of citrulline-positive cells was identified in the medial preoptic nucleus, the suprachiasmatic nucleus, and the subparaventricular zone regions of the hypothalamus in aggressive lactating females relative to control mice. In other regions of the brain, no changes in the number of citrulline-positive cells were observed across either groups or treatments. These results provide two indirect lines of evidence that NO release is associated with maternal aggression.	nitric-oxide synthase activity,protein binding,calmodulin binding,zinc ion binding,FMN binding,oxidoreductase activity,sodium channel regulator activity,enzyme binding,heme binding,identical protein binding,transmembrane transporter binding,cadmium ion binding,metal ion binding,calcium-dependent protein binding,flavin adenine dinucleotide binding,NADP binding,ATPase binding,phosphoprotein binding,NADPH binding,scaffold protein binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockdown	B6D2	10481908	20	Expeimentalparadigm: Motor activity  /n  Model Generation: Genomic clones spanning the Nr1 locus were isolated from a 129/SvEv λ bacteriophage library (Stratagene, La Jolla) using Nr1 cDNA exons 11–20 as a probe and used to generate the targeting construct, Nr1neo. An 8.0 kb DNA fragment extending from the EcoRI site of intron 10 to the SmaI site of intron 20 was inserted 5′ of the neo gene at the NotI site of the vector JNS2 (Dombrowicz et al. 1993). A 2.5 kb SmaI-BamHI fragment corresponding to intron 20–intron 21 was cloned into the XbaI and BamHI sites of JNS2 with a NheI linker (New England Biolabs, Beverly, MA). Nr1neo was linearized with PvuI, electroporated into E14Tg2a ES cells (Hooper et al. 1987), and transformed cells selected in the presence of G418 and ganciclovir using methods previously described (Mohn and Koller 1995). Targeted clones were identified by Southern analysis and injected into blastocysts to generate chimeras, which were bred to B6D2 animals to obtain Nr1neo+/- animals. These wild-type and heterozygous animals were intercrossed to obtain Nr1neo +/- offspring mice, which were in turn mated to establish a breeding colony. All wild-type mice and mice homozygous for the mutant Nr1 gene were obtained from the intercross of these heterozygous animals.  /n  Rescue: These behavioral alterations are similar to those observed in pharmacologically induced animal models of schizophrenia and can be ameliorated by treatment with haloperidol or clozapine, antipsychotic drugs that antagonize dopaminergic and serotonergic receptors.  /n  Model Summary: We report here the generation of mice expressing only 5% of normal levels of the essential NMDAR1 (NR1) subunit. Unlike NR1 null mice, these mice survive to adulthood and display behavioral abnormalities, including increased motor activity and stereotypy and deficits in social and sexual interactions.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Hcrt	HCRT	protein-coding	Mus musculus	ENSMUSG00000045471	PPOX	15171	Narcolepsy	11 D|11 63.6 cM	Knockout	C57Bl/6J;129/SvEv	10481909	21	Expeimentalparadigm: Dark cycle behavior  /n  Model Generation: The SM-1 mouse ES cell line was cultured on irradiated LIF-producing STO feeder layers as described. ES cells were electroporated with the linearized targeting vector and selected for double resistance to G418 and FIAU as described .Double-resistant ES cell clones were screened by PCR with a 5′<U+00A0>neo<U+00A0>primer, GTGCCCTGAATGAACTGCAGGACG and a 3′ primer external to the targeting vector, TGCTGATCTTTCCAGGGCAACCGA (see<U+00A0>Figure 1A). Three ES cell clones were found where correct targeting was confirmed by Southern blotting using flanking 3′ genomic, external to the targeting vector, and<U+00A0>nlacZ<U+00A0>probes (see<U+00A0>Figure 1B). Two of these ES cell clones were microinjected into blastocysts with production of germline transmitting chimeric mice  /n  Rescue: -  /n  Model Summary: We propose that orexin regulates sleep/wakefulness states, and that<U+00A0>orexin<U+00A0>knocKnockoutut mice are a model of human narcolepsy, a disorder characterized primarily by rapid eye movement (REM) sleep dysregulation.	neuropeptide hormone activity,type 1 orexin receptor binding,type 2 orexin receptor binding	Ani
Nos3	NOS3	protein-coding	Mus musculus	ENSMUSG00000028978	2310065A03Rik|Nos-3|eNOS|ecNOS	18127	Aggressive Behaviors	5 A3|5 11.32 cM	Knockout	C57BL/6	10493775	22	Expeimentalparadigm: Grouped aggression in neutral arena//Sensorimotor tests  /n  Model Generation: The eNOS 2/2 mice were derived from animals originally developed by Huang et al. (1995). Controls included littermates of the eNOS 2/2 mice as well as C57/B16 mice that were bred in the same colony. Behavioral measures for the two groups did not differ so that they were combined for statistical analyses.  /n  Rescue: -  /n  Model Summary: Male mice with targeted deletion of the gene encoding the neuronal isoform of nitric oxide synthase (nNOS(-/-)) display increased aggressive behavior compared with wild-type (WT) mice. Specific pharmacological inhibition of nNOS with 7-nitroindazole also augments aggressive behavior. We report here that male mice with targeted deletion of the gene encoding endothelial NOS (eNOS(-/-)) display dramatic reductions in aggression. The effects are selective, because an extensive battery of behavioral tests reveals no other deficits. In the resident-intruder model of aggression, resident eNOS(-/-) males show virtually no aggression. Latency for aggression onset is 25-30 times longer in eNOS(-/-) males compared with WT males in the rare instances of aggressive behaviors. Similarly, a striking lack of aggression is noted in tests of aggression among groups of four mice monitored in neutral cages. Although eNOS(-/-) mice are hypertensive ( approximately 14 mmHg blood pressure elevation), hypertension does not appear responsible for the diminished aggression. Reduction of hypertension with hydralazine does not change the prevalence of aggression in eNOS(-/-) mice. Extensive examination of brains from eNOS(-/-) male mice reveals no obvious neural damage from chronic hypertension. In situ hybridization in WT animals reveals eNOS mRNA in the brain associated exclusively with blood vessels and no neuronal localizations.	actin binding,actin monomer binding,nitric-oxide synthase activity,protein binding,calmodulin binding,beta-catenin binding,FMN binding,oxidoreductase activity,heme binding,tetrahydrobiopterin binding,arginine binding,cadherin binding,metal ion binding,flavin adenine dinucleotide binding,NADP binding,nitric-oxide synthase binding,Hsp90 protein binding,scaffold protein binding	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Aggressive Behaviors	2 E3|2 56.63 cM	Mutated	C57BL/6	10611369	23	Expeimentalparadigm: Resident-intruder test//Open field test  /n  Model Generation: BDNF+/- mice generated as described (18) were back-crossed for 10–12 generations to a C57BL/6 genetic background, a strategy resulting in great reduction of the genetic heterogeneity present in the original 129 Sv-C57BL/6 mixed background.  Two independent targeted ES cell BDNF recombinant clones injected into C57Bl/6 blastocysts generated chimeras that transmitted the mutated BDNF allele to the progeny exhibiting indistinguishable phenotypes. Breeding of two BDNF+/- mice gave rise to homozygous mutant mice at a frequency of 25%. Subsequently, the breeding of one BDNF+/- mouse and one NT-3+/- mouse resulted in 25% of the offspring heterozygous for both BDNF and NT-3. Two BDNF/NT-3 double heterozygous mice gave rise to BDNF/NT-3 double homozygous mutant mice. For embryonic staging, the day of plug appearance in the female was considered embryonic day 0.5 (E0.5). Generation of TrkC mutant mice was performed as described above. The recombination cassette was designed to ablate the first coding exon, resulting in absence of protein expression, and is described elsewhere (L. Tessarollo, P. Tsoulfas, M. J. Donovan, M. E. Palko, J. Blair-Flynn, B. L. Hempstead, and L. F. Parada, unpublished data).  /n  Rescue: The heightened aggressiveness can be ameliorated by the selective serotonin reuptake inhibitor fluoxetine.  /n  Model Summary: In the present study, we use heterozygous BDNF(+/-) mice that have a normal life span and show that these animals develop enhanced intermale aggressiveness and hyperphagia accompanied by significant weight gain in early adulthood; these behavioral abnormalities are known to correlate with 5-HT dysfunction. Forebrain 5-HT levels and fiber density in BDNF(+/-) mice are normal at an early age but undergo premature age-associated decrements. However, young adult BDNF(+/-) mice show a blunted c-fos induction by the specific serotonin releaser-uptake inhibitor dexfenfluramine and alterations in the expression of several 5-HT receptors in the cortex, hippocampus, and hypothalamus.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Bipolar Disorder	2 E3|2 56.63 cM	Knockdown	C57BL/6;129Sv	10716929	24	Expeimentalparadigm: Activity recording  /n  Model Generation: BDNF-deficient mice were generated and genotyped as previously described (Liebl et al., 1997). Two independent targeted ES cell BDNF recombinant clones injected into C57Bl/6 blastocysts generated chimeras that transmitted the mutated BDNF allele to the progeny exhibiting indistinguishable phenotypes. Breeding of two BDNF+/- mice gave rise to homozygous mutant mice at a frequency of 25%. Subsequently, the breeding of one BDNF+/- mouse and one NT-3+/- mouse resulted in 25% of the offspring heterozygous for both BDNF and NT-3. Two BDNF/NT-3 double heterozygous mice gave rise to BDNF/NT-3 double homozygous mutant mice. For embryonic staging, the day of plug appearance in the female was considered embryonic day 0.5 (E0.5). Generation of TrkC mutant mice was performed as described above. The recombination cassette was designed to ablate the first coding exon, resulting in absence of protein expression, and is described elsewhere (L. Tessarollo, P. Tsoulfas, M. J. Donovan, M. E. Palko, J. Blair-Flynn, B. L. Hempstead, and L. F. Parada, unpublished data).  /n  Rescue: -  /n  Model Summary: Ablation of this gene in mice leads to death shortly after birth, and abnormalities have been found in both the peripheral and central nervous systems. BDNF and its tyrosine kinase receptor, TrkB, are expressed in hypothalamic nuclei associated with satiety and locomotor activity. In heterozygous mice, BDNF gene expression is reduced and we find that all heterozygous mice exhibit abnormalities in eating behavior or locomotor activity. We also observe this phenotype in independently derived inbred and hybrid BDNF mutant strains. Infusion with BDNF or NT4/5 can transiently reverse the eating behavior and obesity. Thus, we identify a novel non-neurotrophic function for neurotrophins and indicate a role in behavior that is remarkably sensitive to alterations in BDNF activity.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	129/SvJ;C57BL/6	10719900	25	Expeimentalparadigm: Trace fear conditioning  /n  Model Generation: A mouse 129/SvJ cosmid library (Stratagene) was screened with a probe corresponding to the mouse NMDAR1 gene exon 19. A clone covering the first intron, transmembrane domain, and C-terminal region of the NMDAR1 gene as well as its 3′ downstream region (total ～45 kb) was isolated and mapped by restriction digestion. The replacement-type targeting vector (Figure 1a) was made by inserting the first loxP site into a 5 kb intron between exons 10 and 11. The second loxP site along with the pgk-neo gene was inserted into an Xba site 3 kb downstream of the last exon with the same orientation as that of the first loxP site. The two loxP sites flanked an ～12 kb genomic region spanning the entire transmembrane domain and C-terminal region. The targeting vector contained 16 kb of homologous DNA upstream (left arm) of the first loxP site and 6 kb of homologous DNA downstream (right arm) of the second loxP site/pkg-neo gene. The linearized targeting vector was electroporated into J1 cells derived from 129/terSv (Li et al. 1994) maintained on subconfluent embryonic fibroblasts. Neomycin-resistant ES cell colonies were picked and expanded. The ES cells harboring homologous recombination were determined by Southern blotting using a 5′ probe and a 3′ probe, which correspond to the gene regions depicted in Figure 1a. The targeted ES cells were injected into C57BL/6 blastocysts. These blastocysts were transferred into pseudopregnant mothers. Chimeric mice with more than 90% agouti were bred against C57BL/6. The F1 mice with germline transmission of the fNR1 gene were bred with the transgenic line T29–1. The F2 offspring heterozygous for both the fNR1 gene and the Cre transgene (Cre/+, fNR1/+) were mated with heterozygous fNR1 mice (+/+, fNR1/+) to obtain F3 mice carrying the Cre transgene as well as the homozygous fNR1 gene (Cre/+, fNR1/fNR1), that is, CA1-KO mice. The genotype distribution among the total F3 progeny (from the second mating) was 23:21:46:42:22:23 for wt (+/+, +/+), T29–1 transgenic (Cre/+, +/+), heterozygous Cre and fNR1 (Cre/+, fNR1/+), heterozygous fNR1 (+/+, fNR1/+), homozygous fNR1 (+/+, fNR1/fNR1), and CA1-KO (Cre/+, fNR1/fNR1), respectively. This distribution is close to the 1:1:2:2:1:1 Mendelian ratio expected for the segregation of two independent loci (with no embryonic lethality).  /n  Rescue: -  /n  Model Summary: Here, we have examined whether hippocampal NMDARs are also needed for temporal memory. We applied trace fear conditioning to knockout mice lacking NMDARs only in hippocampal CA1 pyramidal cells. This paradigm requires temporal processing because the conditional and unconditional stimuli are separated by 30 s (trace). We found that knockout mice failed to memorize this association but were indistinguishable from normal animals when the trace was removed. Thus, NMDARs in CA1 are crucial for the formation of memories that associate events across time.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Targeted	C57BL/6J	10818139	26	Expeimentalparadigm: Motor coordination//Analgesia testing//Locomotor activity//Light-dark box test//Morris water maze//Auditory startle and prepulse inhibition//Open field test//Acoustic startle reflex  /n  Model Generation: E14–129/Ola embryonic stem (ES) cells were cultured and transfected with NotI-linearized targeting vectors carrying the D481N or K483Q point mutation, respectively, as described previously (Wurst and Joyner, 1993). Correctly targeted ES cell clones were subsequently subjected to Cre recombination to excise the drug resistance gene flanked by loxP sites. ES cell clones were propagated to 2 × 107 cells and electroporated (Bio-Rad Gene Pulser, Bio-Rad, Glattbrugg, Switzerland) with 20 μg supercoiled pMC-Cre (Gu et al., 1993). After electroporation, 105 cells were plated on a 25 cm2 dish and selected 24 hr later with 2 μm ganciclovir for 3 d. Single resistant colonies were picked and screened by Southern blot analysis for site-specific recombination. Correctly targeted clones carrying either the D481N or K483Q point mutation in the Grin1 allele were used for injection into C57BL/6J host blastocysts. Chimeric males born after implantation of injected blastocysts into foster mothers were mated with C57BL/6 females, and offspring were analyzed for germline transmission of theGrin1D481NorGrin1K483Qmutation, respectively, by Southern blot analysis. HeterozygousGrin1D481N/+mice were intercrossed to obtain a homozygous Grin1D481Nline, whereas Grin1K483Q/+mice were maintained as heterozygotes because of their postnatal lethality as homozygotes. Wild-type littermates from these crosses, or offspring thereof, were used as control animals.  /n  Rescue: -  /n  Model Summary: Grin1(D481N) mice exhibited deficits in hippocampal theta burst-induced long-term potentiation (LTP) and spatial learning and also a reduction in sensitivity to NMDA-induced seizures relative to wild-type controls, consistent with a reduced activation of NMDA receptors. Mutant mice exhibited normal prepulse inhibition but showed increased startle reactivity. Preliminary analysis indicated that the mice exhibit a decreased natural aversion to an exposed environment.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Npas2	NPAS2	protein-coding	Mus musculus	ENSMUSG00000026077	MOP4|bHLHe9	18143	Autism Spectrum Disorder	1 B|1 17.98 cM	Targeted	129S6/SvEvTac	10864874	27	Expeimentalparadigm: Cued and contextual fear task//Morris water maze//Open field test//Light-dark box test//Elevated plus maze//Simple aversive conditioning tasks  /n  Model Generation: A targeted disruption of the NPAS2 allele was generated in 129S6/SvEvTac–derived embryonic stem cells (Fig. 1, A and B) such that the coding exon for the basic helix-loop-helix (bHLH) domain was replaced with a modified lacZ gene from Escherichia coli(7).  /n  Rescue: -  /n  Model Summary: Neuronal PAS domain protein 2 (NPAS2) is a basic helix-loop-helix (bHLH) PAS domain transcription factor expressed in multiple regions of the vertebrate brain. Targeted insertion of a beta-galactosidase reporter gene (lacZ) resulted in the production of an NPAS2-lacZ fusion protein and an altered form of NPAS2 lacking the bHLH domain. The neuroanatomical expression pattern of NPAS2-lacZ was temporally and spatially coincident with formation of the mature frontal association/limbic forebrain pathway. NPAS2-deficient mice were subjected to a series of behavioral tests and were found to exhibit deficits in the long-term memory arm of the cued and contextual fear task. Thus, NPAS2 may serve a dedicated regulatory role in the acquisition of specific types of memory.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,metal ion binding,protein dimerization activity,Hsp90 protein binding,sequence-specific double-stranded DNA binding	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Bipolar Disorder	5 C3.3|5 40.63 cM	Mutated	C57BL/6J	11050136	28	Expeimentalparadigm: Activity recording//Open field test//Sleep recording  /n  Model Generation: All animals used in this experiment were coisogenic C57BL/6J male mice between 3 and 5 months of age born and maintained in the Association for Assessment and Accreditation of Laboratory Animal Care accredited Center for Experimental Animal Resources at Northwestern University. Different groups of animals were used for the experiments conducted under entrained and free-running conditions. For the entrained experiments, six homozygous Clock mutant mice, nine heterozygous Clock mice, and six wild-type mice were recorded. Mice were entrained to a 12 hr light/dark (LD 12:12) cycle with lights on at 5:00 A.M. and lights off at 5:00 P.M. For the free-running experiments, six Clock homozygotes and six wild types were maintained in constant darkness (DD) after implant surgery. All Clock genotypes were determined by PCR amplification of genomic DNA extracted from tail tip biopsies as described previously (Herzog et al., 1998).  /n  Rescue: -  /n  Model Summary: We sought to determine whether this genetic disruption of circadian timing would affect sleep homeostasis. The Clock mutation affected a number of sleep parameters during entrainment to a 12 hr light/dark (LD 12:12) cycle, when animals were free-running in constant darkness (DD), and during recovery from 6 hr of sleep deprivation in LD 12:12. In particular, in LD 12:12, heterozygous and homozygous Clock mutants slept, respectively, approximately 1 and approximately 2 hr less than wild-type mice, and they had 25 and 51% smaller increases in rapid eye movement (REM) sleep during 24 hr recovery, respectively, than wild-type mice. The effects of the mutation on sleep are not readily attributable to differential entrainment to LD 12:12 because the baseline sleep differences between genotypes were also present when animals were free-running in DD.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Attention-Deficit/Hyperactivity Disorder	9 A5.3|9 26.72 cM	Mutated	C57BL/6J	11069937	29	Expeimentalparadigm: Open field test//Elevated zero maze//Bar test//Rotarod  /n  Model Generation: The mouse D2 gene containing exons 3–8 was cloned from a mouse 129/SV genomic DNA library. The targeting vector was constructed using a 15.5 kb mouse genomic D2 fragment in which exon 6 was replaced by a PGK-neo cassette (neo). Correctly targeted ES clones were identified by Southern blot analysis using probes A and B (see Fig. <U+200B>Fig.1)1) and microinjected into C57BL/6 blastocysts to produce chimeric mice. Chimeric mice were crossed with C57BL/6 mice (Taconic, Germantown, NY) to produce heterozygous mice. Heterozygous mice (D2L+/-; F1) were then intercrossed to produce homozygous mice (F2) on a hybrid background (129/terSv × C57BL/6).  /n  Rescue: Interestingly, haloperidol produced significantly less catalepsy and inhibition of locomotor activity in D2L-/- mice.  /n  Model Summary: D2L-/- mice (which still express functional D2S) displayed reduced levels of locomotion and rearing behavior.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6	11103882	30	Expeimentalparadigm: Spontaneous locomotion//Motor activity//Open field test//Forced swim test//Social behavior test//Resident-intruder test//Maternal behavior test  /n  Model Generation: Homozygous DAT-/- mice were obtained by genetic manipulation as described (Giros et al., 1996). These mice were then backcrossed for more than two years (12 generations) on a C57BL/6 background. DAT-/-, heterozygous DAT+/- and wild-type DAT littermates were obtained from the mating of DAT+/++/- mice.  /n  Rescue: Haloperidol and clozapine reversed the hyperactivity in DAT-/- mice, with a rightward shift of the dose-response curve compared with control animals, suggesting a dopamine-mediated effect.  /n  Model Summary: Mice lacking the dopamine transporter (DAT-/-) are characterized by high extracellular dopamine levels and spontaneous hyperlocomotion. We performed a detailed analysis of the behavioural phenotype of DAT-/- mice in order to identify other behavioural impairments associated with the hyperdopaminergic tone of these mutant mice. In particular, we investigated locomotor activity, exploration, and social and maternal behaviours, which are known to be regulated by dopamine. DAT-/- mice were easily aroused by novelty and always responded with hyperlocomotion, which interfered with habituation to the testing environment, exploratory behaviour in an open field and the coping response to forced swimming stress. Social behaviours such as interaction with an unknown congener or aggressiveness were not modified in DAT-/- mice compared with DAT+/- and DAT+/+ mice, although the maternal behaviour of mutant females was severely disturbed.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Esr1	ESR1	protein-coding	Mus musculus	ENSMUSG00000019768	ER|ER-alpha|ERa|ERalpha|ESR|Estr|Estra|Nr3a1	13982	Aggressive Behaviors	10 A1|10 2.03 cM	Knockout	C57BL/6J;129	11114183	31	Expeimentalparadigm: Sexual behavior tests//Male aggressive behavior test  /n  Model Generation: Gonadally intact male mice (12–45 weeks old) lacking genes for both ERα and ERβ (αβERKO; n = 8), ERα (αERKO; n = 2), or ERβ (βERKO; n = 9), and their WT (αβWT; n = 7) littermates from a mixed background of C57BL/6J and 129 were used. They were obtained from the breeding colony maintained at the National Institute of Environmental Health Sciences.  /n  Rescue: -  /n  Model Summary: Male mice with a knockout of the estrogen receptor (ER)-alpha gene, a ligand-activated transcription factor, showed reduced levels of intromissions and no ejaculations whereas simple mounting behavior was not affected. In contrast, all components of sexual behaviors were intact in male mice lacking the novel ER-beta gene. Here we measure the extent of phenotype in mice that lack both ER-alpha and ER-beta genes (alphabetaERKO). alphabetaERKO male mice did not show any components of sexual behaviors, including simple mounting behavior. Nor did they show ultrasonic vocalizations during behavioral tests with receptive female mice. On the other hand, reduced aggressive behaviors of alphabetaERKO mice mimicked those of single knockout mice of ER-alpha gene (alphaERKO). They showed reduced levels of lunge and bite aggression, but rarely showed offensive attacks.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,TFIIB-class transcription factor binding,transcription coregulator binding,transcription corepressor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,beta-catenin binding,transcription factor binding,zinc ion binding,lipid binding,TBP-class protein binding,enzyme binding,protein kinase binding,nuclear estrogen receptor activity,nuclear estrogen receptor binding,type 1 metabotropic glutamate receptor binding,estrogen response element binding,phosphatidylinositol 3-kinase regulatory subunit binding,hormone binding,identical protein binding,sequence-specific DNA binding,protein-containing complex binding,metal ion binding,ATPase binding,sequence-specific double-stranded DNA binding,promoter-specific chromatin binding	Ani
Esr2	ESR2	protein-coding	Mus musculus	ENSMUSG00000021055	ER[b]|ERbeta|Estrb	13983	Aggressive Behaviors	12 C3|12 33.52 cM	Knockout	C57BL/6J;129	11114183	32	Expeimentalparadigm: Sexual behavior tests//Male aggressive behavior test  /n  Model Generation: Gonadally intact male mice (12–45 weeks old) lacking genes for both ERα and ERβ (αβERKO; n = 8), ERα (αERKO; n = 2), or ERβ (βERKO; n = 9), and their WT (αβWT; n = 7) littermates from a mixed background of C57BL/6J and 129 were used. They were obtained from the breeding colony maintained at the National Institute of Environmental Health Sciences.  /n  Rescue: -  /n  Model Summary: Male mice with a knockout of the estrogen receptor (ER)-alpha gene, a ligand-activated transcription factor, showed reduced levels of intromissions and no ejaculations whereas simple mounting behavior was not affected. In contrast, all components of sexual behaviors were intact in male mice lacking the novel ER-beta gene. Here we measure the extent of phenotype in mice that lack both ER-alpha and ER-beta genes (alphabetaERKO). alphabetaERKO male mice did not show any components of sexual behaviors, including simple mounting behavior. Nor did they show ultrasonic vocalizations during behavioral tests with receptive female mice. On the other hand, reduced aggressive behaviors of alphabetaERKO mice mimicked those of single knockout mice of ER-alpha gene (alphaERKO). They showed reduced levels of lunge and bite aggression, but rarely showed offensive attacks.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,zinc ion binding,lipid binding,enzyme binding,nuclear estrogen receptor activity,estrogen response element binding,hormone binding,peroxisome proliferator activated receptor binding,sequence-specific DNA binding,metal ion binding,organic cyclic compound binding,estrogen binding,heterocyclic compound binding,estradiol binding,steroid hormone binding,promoter-specific chromatin binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	NA	11150348	33	Expeimentalparadigm: Startle response and prepulse inhibition<U+00A0>//Locomotion test  /n  Model Generation: The DAT mutant mice [cohort 1: 23 (+/+), 47 (+/-), and 9 (-/-) male and female mice; cohort 2: female, 20 (+/+), 22 (+/-), and 17 (-/-); male, 18 (+/+), 19 (+/-), and 18 (-/-)] were generated at University of California San Diego in an Association for Assessment and Accreditation of Laboratory Animal Care-approved animal facility using parental (+/-) mice from Duke University (Giros et al., 1996).  /n  Rescue: Both D1 and D2 receptor antagonists decreased the hyperactivity seen in the DAT (-/-) mice. These findings support the role of the D2, but not the D1, receptor in the modulation of PPI in mice. Furthermore, D1 receptor activation appears to be the critical substrate for the expression of preservative patterns of motor behavior, whereas both D1 and D2 receptors appear to regulate the amount of motor activity.  /n  Model Summary: We used dopamine transporter (DAT) (-/-) mice to examine the behavioral consequences of a chronically hyperdopaminergic state, challenging them with the preferential dopamine D2 receptor antagonist raclopride and D1 receptor antagonist SCH23390. At baseline, DAT (-/-) mice exhibited deficient sensorimotor gating as measured by prepulse inhibition (PPI) of the startle response, exhibited nonfocal preservative patterns of locomotion, and were hyperactive in a novel environment.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Nos1	NOS1	protein-coding	Mus musculus	ENSMUSG00000029361	2310005C01Rik|N-NOS|NC-NOS|NO|NOS|NOS-I|Nos-1|bNOS|nNOS	18125	Aggressive Behaviors	5 F|5 57.29 cM	Knockout	C57BL/6J	11158630	34	Expeimentalparadigm: Aggression test//Open field test//Motor coordination  /n  Model Generation: Adult (3- to 5-month-old) male nNOS-/- and WT C57BL/6J mice from a breeding colony established at The Johns Hopkins University by using animals previously produced by homologous recombination.(1) The mouse neuronal NOS gene was cloned from a ), genomic library using the rat cDNA clone (Bredt et al., 1991 b) as a probe. The targeting vector was derived from the pPNTvector, which contains the thymidine kinase gene and the neomycin resistance gene (Tybulewicz et al., 1991). Genomic fragments surrounding the first exon of the mouse neuronal NOS gene, which encodes amino acids 1-159, were cloned into the vector, with 5 kb of homology 5’ and 2 kb 3’ to the neomycin resistance insert. Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradi_x0002_ated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation. Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradiated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation.  /n  Rescue: -  /n  Model Summary: Recent studies suggest that central serotonergic neuronal circuits and particularly 5-HT(1A) and 5-HT(1B) receptors play a prominent role in the regulation of aggression. Accordingly, we investigated whether the aggressiveness caused by the lack of nNOS might be because of alterations in serotonergic function. We now demonstrate that the excessive aggressiveness and impulsiveness of nNOS knockout mice is caused by selective decrements in serotonin (5-HT) turnover and deficient 5-HT(1A) and 5-HT(1B) receptor function in brain regions regulating emotion. These results indicate an important role for NO in normal brain 5-HT function and may have significant implications for the treatment of psychiatric disorders characterized by aggressiveness and impulsivity.	nitric-oxide synthase activity,protein binding,calmodulin binding,zinc ion binding,FMN binding,oxidoreductase activity,sodium channel regulator activity,enzyme binding,heme binding,identical protein binding,transmembrane transporter binding,cadmium ion binding,metal ion binding,calcium-dependent protein binding,flavin adenine dinucleotide binding,NADP binding,ATPase binding,phosphoprotein binding,NADPH binding,scaffold protein binding	Ani
Nos1	NOS1	protein-coding	Mus musculus	ENSMUSG00000029361	2310005C01Rik|N-NOS|NC-NOS|NO|NOS|NOS-I|Nos-1|bNOS|nNOS	18125	Aggressive Behaviors	5 F|5 57.29 cM	Knockout	C57BL/6J	11158630	35	Expeimentalparadigm: Aggression Test//Open field test//Motor coordination  /n  Model Generation: Adult (3- to 5-month-old) male nNOS-/- and WT C57BL/6J mice from a breeding colony established at The Johns Hopkins University by using animals previously produced by homologous recombination (1) . Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradi_x0002_ated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation. Jl ES cells were grown as described (Li et al., 1992) on irradiated  embryonic fibroblast feeder cells in media containing 200 U/ml leukemia inhibitory factor. For electroporation, lo7 cells were mixed with targeting vector DNA at 150 pg/ml. A Bio-Rad GenePulser was used to electroporate the DNA into the cells with a setting of 960 pF capacitance, 250 mV. The cells were plated onto neomycin-resistant irradiated fibroblast feeder cells, and selection with 150 pglml G416 and 2 uM FIAU was started 46 hr later. Doubly resistant colonies were picked 7 days after electroporation and grown in 24-well plates. Half of the cells were frozen, and half were used for DNA isolation.  /n  Rescue: -  /n  Model Summary: Recent studies suggest that central serotonergic neuronal circuits and particularly 5-HT(1A) and 5-HT(1B) receptors play a prominent role in the regulation of aggression. Accordingly, we investigated whether the aggressiveness caused by the lack of nNOS might be because of alterations in serotonergic function. We now demonstrate that the excessive aggressiveness and impulsiveness of nNOS knockout mice is caused by selective decrements in serotonin (5-HT) turnover and deficient 5-HT(1A) and 5-HT(1B) receptor function in brain regions regulating emotion. These results indicate an important role for NO in normal brain 5-HT function and may have significant implications for the treatment of psychiatric disorders characterized by aggressiveness and impulsivity.	nitric-oxide synthase activity,protein binding,calmodulin binding,zinc ion binding,FMN binding,oxidoreductase activity,sodium channel regulator activity,enzyme binding,heme binding,identical protein binding,transmembrane transporter binding,cadmium ion binding,metal ion binding,calcium-dependent protein binding,flavin adenine dinucleotide binding,NADP binding,ATPase binding,phosphoprotein binding,NADPH binding,scaffold protein binding	Ani
Grin2a	GRIN2A	protein-coding	Mus musculus	ENSMUSG00000059003	GluN2A|GluRepsilon1|NMDAR2A|NR2A	14811	Schizophrenia	16 A1|16 5.28 cM	Mutated	C57BL/6	11160454	36	Expeimentalparadigm: Water-finding task  /n  Model Generation: Mutant mice lacking the GluRε1 subunit of NMDA receptors were provided by Sakimura et al. (1995). The homozygous GluRε1 mutant mice (-/-; 3-months-old) and the wild-type mice (+/+; 3-months-old) used in this study were obtained by crossing F13 heterozygous GluRε1 mutant mice (+/-) having a 99.99% pure C57BL/6 genetic background. The genotypes of mice were determined by tail biopsy and PCR, using primers E1P1, 5′-TCTGGGGCCTGGTCTTCAACA-ATTCTGTGC-3′ (the nucleotide residues 1766–1795 of GluRε1 cDNA), E1P2, 5′-CTTCTTGTCACTGAGGCCAGTCACTTGGTC-3′ (complementary to the residues 1921–1950), and NeoP1, 5′-GCCTGCTTGCCGAATATCATGGTGGAAAAT-3′.  /n  Rescue: GluRepsilon1 mutant mice exhibited an increased spontaneous locomotor activity in a novel environment and an impairment of latent learning in a water-finding task.  /n  Model Summary: GluRepsilon1 mutant mice exhibited an increased spontaneous locomotor activity in a novel environment and an impairment of latent learning in a water-finding task.	ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,extracellularly glutamate-gated ion channel activity,cation channel activity,calcium channel activity,protein binding,zinc ion binding,ligand-gated ion channel activity,glutamate binding,protein kinase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,metal ion binding,cell adhesion molecule binding,ATPase binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockdown	129Sv/J	11172062	37	Expeimentalparadigm: Basal activity monitoring//Open field test//Novelty object recognition test//Y maze  /n  Model Generation: A 7.5-kb HindIII fragment containing the first two exons of the DAT gene was excised from a phage DNA isolated from a mouse 129 Sv/J genomic library (5). “NotI” and “AscI” sites were introduced by PCR in the second exon right upstream of the translational start with the Kozak sequence reconstructed. A NotI–AscI cassette was inserted to generate the targeting construct (see Fig. <U+200B>Fig.11a). The cassette contained the tetracycline-dependent transactivator tTA (11) (from pUHD15–1, gift of Hermann Bujard, Center for Molecular Biology, Heidelberg, Germany), the neomycin-resistance gene (PGK-neo-pA), the tet-operators, and the human cytomegalovirus minimal promoter (tetO, from pUHD10–3, gift of Hermann Bujard). The insertion of an extra 4-kb DNA sequence (tTA-neo-tetO) resulted in a reduction in DAT expression levels. A defective transcription caused by extra sequences in the promoter region has been reported (15, 16). W9.5 embryonic stem cells were electroporated (Bio-Rad Gene Pulse; 800 V and 3 μF) with 30 μg of linearized targeting construct. G418-resistant clones were screened by Southern blot for homologous recombination with a 3′ external probe (see Fig. <U+200B>Fig.11a). Positive cells from one clone were injected into C57BL6/J blastocysts to generate chimeras. One of the chimeras was mated with 129 Sv/J females to generate heterozygous mutants on a 129 Sv/J genetic background (17, 18).  /n  Rescue: We show that both the indirect dopamine receptor agonist amphetamine and the direct agonists apomorphine and quinpirole inhibit locomotor activity in the DAT knockdown mice, leading to the hypothesis that a shift in the balance between dopamine auto and heteroreceptor function may contribute to the therapeutic effect of psychostimulants in attention deficit hyperactivity disorder.  /n  Model Summary: Unlike the DAT knockout mice, the DAT knockdown mice do not display a growth retardation phenotype. They have normal home cage activity but display hyperactivity and impaired response habituation in novel environments.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Cyp19a1	CYP19A1	protein-coding	Mus musculus	ENSMUSG00000032274	Ar|ArKO|Cyp19|Int-5|Int5|p450arom	13075	Aggressive Behaviors	9 A5.3|9 29.49 cM	Knockout	NA	11182758	38	Expeimentalparadigm: Resident-intruder test  /n  Model Generation: We generated CYP19 knockout (ArKO) mice by targeting disruption of the CYP19 gene.  /n  Rescue: The defect in the behaviour of ArKO males was reinstated when the mice received supplements of 17beta-oestradiol soon after birth.  /n  Model Summary: Aromatase P450 (CYP19) is an enzyme responsible for conversion of androgens to oestrogens. We generated CYP19 knockout (ArKO) mice by targeting disruption of the CYP19 gene and observed that the ArKO males exhibited a complete loss of aggressive behaviour against intruder mice when examined using a resident-intruder paradigm.	monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen,heme binding,metal ion binding,aromatase activity	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Intellectual Disability	X A7.3|X 37.63 cM	Transgene	C57BL/6	11242117	39	Expeimentalparadigm: SHIRPA//Open field test  /n  Model Generation: Correctly targeted ES cell clones for injection into blastocysts were passaged the day before injection and injected into blastocysts from naturally mated C57BL/6 females at 3.5 days post coitum. Injections were performed in M2 medium (Sigma) with 10–15 ES cells being injected into each blastocyst before transfer to pseudopregnant recipient females (6–12 blastocysts per recipient). Chimeric pups were identified by their agouti coat color and, on maturity, were mated with C57BL/6 mice. As Mecp2 is X-linked, all agouti F1 females were heterozygous for the floxed allele, and this was confirmed by Southern blot. We crossed heterozygous females with wild-type C57BL/6 males (F2 generation). Resulting hemizygous males were crossed to heterozygous females to generate homozygous females (F3) and the line was then maintained in the homo/hemizygous state. We obtained deleter mice22, which carry a ubiquitously expressed Cre transgene on the X chromosome. Male deleter mice were crossed with homozygous floxed females. All female pups were Mecp2+/- and hemizygous for cre. All male pups were hemizygous for the Mecp2lox allele. Mecp2+/- females were crossed with wild-type C57BL/6 males to give Mecp2+/- or Mecp2 females and Mecp2+/++/y or Mecp2-/y males. The three Mecp2 alleles were identified by Southern-blot analysis by digesting with BamHI and probing with the 1.2-kb NcoI-BamHI 3′ probe (Mecp2, 11 kb; Mecp2+lox, 8.2 kb; Mecp2-, 1.2 kb). Heterozygous nestin-Cre males23 were crossed with Mecp2lox/lox females to generate males that had Mecp2 deleted in neural and glial cells. Animals carrying the nestin-Cre transgene were identified by PCR on tail genomic DNA (forward primer CreF, 5′–GACCGTACACCAAAATTTGCCTG–3′; reverse primer CreR, 5′–TTACGTATATCCTGGCAGCGATC–3′; 5 min at 94 °C, 30 cycles of 30 s at 94 °C, 30 s at 64 °C, 45 s at 72 °C, followed by 5 min at 72 °C. The 465-bp product was visualized by running on a 1.5% TAE agarose gel. Various tissues were used to make genomic DNA, which was digested with BamHI, Southern blotted and probed with the NcoI-BamHI 3′ Mecp2 probe. The extent of deletion in each tissue was quantified using ImageQuant software (Molecular Dynamics), correcting for background and higher intensity signal from the smaller, deleted allele.  /n  Rescue: -  /n  Model Summary: Previous work with Mecp2-null embryonic stem cells indicated that MeCP2 is essential for mouse embryogenesis. Here we generate mice lacking Mecp2 using Cre-loxP technology. Both Mecp2-null mice and mice in which Mecp2 was deleted in brain showed severe neurological symptoms at approximately six weeks of age. Compensation for absence of MeCP2 in other tissues by MeCP1 (refs. 19,20) was not apparent in genetic or biochemical tests. After several months, heterozygous female mice also showed behavioral symptoms. The overlapping delay before symptom onset in humans and mice, despite their profoundly different rates of development, raises the possibility that stability of brain function, not brain development per se, is compromised by the absence of MeCP2.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Intellectual Disability	X A7.3|X 37.63 cM	Transgene	C57BL/6;BALB/c;129	11242118	40	Expeimentalparadigm: Nocturnal activity measurements  /n  Model Generation: Mice used here were of mixed genetic backgrounds (129, C57BL/6 and BALB/c). We crossed male mice carrying either a Nestin-Cre (refs. 20,21) or a CamK-Cre (refs. 21,27; line 93) transgene with females either heterozygous or homozygous for Mecp22lox to produce male (Mecp22lox/y;Cre) or female (Mecp22lox/+;Cre) conditional mutants. Nestin-Cre was found to be active in both the male and the female germ line. As Mecp22lox/y males carrying a Nestin-Cre transgene, although fertile, developed disease and died as young adults, we crossed Mecp22lox/+;Nestin-Cre females with wild-type males to produce the first generation of mice carrying the germline-recombined Mecp2-null allele (Mecp21lox allele). Subsequently, we used Mecp21lox/+ females, which were healthy for several months, for transmitting Mecp21lox. RNA and protein samples were prepared from tissues of mutant and control mice, and northern- and western-blot analyses were carried out as described21.  /n  Rescue: -  /n  Model Summary: Here we show that Mecp2-deficient mice exhibit phenotypes that resemble some of the symptoms of RTT patients. Mecp2-null mice were normal until 5 weeks of age, when they began to develop disease, leading to death between 6 and 12 weeks. Mutant brains showed substantial reduction in both weight and neuronal cell size, but no obvious structural defects or signs of neurodegeneration. Brain-specific deletion of Mecp2 at embryonic day (E) 12 resulted in a phenotype identical to that of the null mutation, indicating that the phenotype is caused by Mecp2 deficiency in the CNS rather than in peripheral tissues. Deletion of Mecp2 in postnatal CNS neurons led to a similar neuronal phenotype, although at a later age. Our results indicate that the role of Mecp2 is not restricted to the immature brain, but becomes critical in mature neurons. Mecp2 deficiency in these neurons is sufficient to cause neuronal dysfunction with symptomatic manifestation similar to Rett syndrome.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Transgene	C57BL6/SJL	11555628	41	Expeimentalparadigm: Motor coordination//Open field test//Elevated plus maze//Water maze task  /n  Model Generation: The EcoRI/XhoI fragment containing the sMT-Ia promoter was introduced at the EcoRI/XhoI site of the pCMVβ plasmid and was designated psMT. The full-length Dyrk1A cDNA (a gift from Dr W.Becker, Hamburg, Germany) was PCR amplified to introduce NotI sites at the 5′ and 3′ ends and was then cloned at the NotI site of the psMT-Ia plasmid. The complete transgene sequence was subsequently confirmed by DNA sequencing.  /n  Rescue: -  /n  Model Summary: We have generated transgenic mice (TgDyrk1A) overexpressing the full-length cDNA of Dyrk1A. TgDyrk1A mice exhibit delayed cranio-caudal maturation with functional consequences in neuromotor development. TgDyrk1A mice also show altered motor skill acquisition and hyperactivity, which is maintained to adulthood. In the Morris water maze, TgDyrk1A mice show a significant impairment in spatial learning and cognitive flexibility, indicative of hippocampal and prefrontal cortex dysfunction. In the more complex repeated reversal learning paradigm, this defect turned out to be specifically related to reference memory, whereas working memory was almost unimpaired. These alterations are comparable with those found in the partial trisomy chromosome 16 murine models of DS and suggest a causative role of DYRK1A in mental retardation and in motor anomalies of DS.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Chrm1	CHRM1	protein-coding	Mus musculus	ENSMUSG00000032773	Chrm-1|M1|M1R	12669	Attention-Deficit/Hyperactivity Disorder	19|19 A	Knockout	C57BL/6	11752469	42	Expeimentalparadigm: Locomotion test  /n  Model Generation: Genomic clones spanning the M1 locus were isolated from a C57BL/6 genomic phage library, mapped by restriction analysis, and used to create the targeting construct. Fifty micrograms of the targeting vector was linearized with SacII and introduced into C57BL/6 embryonic stem cells (a gift from Colin Stewart, National Cancer Institute, Frederick, MD) by electroporation (Bio-Rad Gene Pulser set at 800 V and 3 μF). G418 selection was applied 24 h after transfection, and G418-resistant colonies were isolated on days 5–8 of selection. Isolated colonies were screened for homologous recombination by Southern hybridization, and clones that were correctly recombined on both sides were injected into BALB/c blastocysts to generate chimeras. Resulting chimeras were bred to C57BL/6 mice to obtain pure C57BL/6 M1+/- mice. These mice were used to generate a breeding colony from which all M1+/+, +/-, and -/- mice were derived.  /n  Rescue: -  /n  Model Summary: In this study we have generated mice lacking the M1 muscarinic acetylcholine receptor and examined the effects of M1 deletion on dopaminergic transmission and locomotor behavior. We report that M1 deficiency leads to elevated dopaminergic transmission in the striatum and significantly increased locomotor activity. M1-deficient mice also have an increased response to the stimulatory effects of amphetamine. Our results provide direct evidence for regulation of dopaminergic transmission by the M1 receptor and are consistent with the idea that M1 dysfunction could be a contributing factor in psychiatric disorders in which altered dopaminergic transmission has been implicated.	G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,G protein-coupled acetylcholine receptor activity,neurotransmitter receptor activity	Ani
Hoxb8	HOXB8	protein-coding	Mus musculus	ENSMUSG00000056648	Hox-2.4	15416	Obsessive Compulsive Disorder	11 D|11 59.82 cM	Targeted	129Sv	11779477	43	Expeimentalparadigm: Locomotion test//Grooming  /n  Model Generation: An 11.2 kb DNA fragment that contained the Hoxb8 gene was isolated from a genomic λDNA library prepared from a mouse 129Sv ES cell line and used to construct the Hoxb8 targeting vector. Two different mutations were introduced into the Hoxb8 locus. First, a unique BamH1 site in the first exon was converted to a ClaI site via restriction enzyme cleavage, followed by a fill-in and ligation resulting in a 4 bp insertion that produces a premature translation stop codon in the Hoxb8 open reading frame. Second, a floxed pMC-1neor cassette was inserted into the second exon of Hoxb8 at an XmnI site within the homeodomain. A total of 8.2 kb of Hoxb8 genomic sequence surrounded the two mutations, and was inserted between the TK1 and TK2 genes to generate the Hoxb8 targeting vector. This vector was linearized and electroporated into R1 ES cells. Cells that had undergone homologous recombination at the Hoxb8 locus were enriched using positive-negative selection in medium containing G418 and FIAU (Mansour et al., 1988). Two of these ES cell lines were used to generate the chimeras that transmitted the Hoxb8 mutations to their progeny.  /n  Rescue: -  /n  Model Summary: Repertoires of grooming behaviors critical to survival are exhibited by most animal species, including humans. Genes that influence this complex behavior are unknown. We report that mice with disruptions of Hoxb8 show, with 100% penetrance, excessive grooming leading to hair removal and lesions. Additionally, these mice excessively groom normal cagemates. We have been unable to detect any skin or PNS abnormalities in Hoxb8 mutants.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific DNA binding,sequence-specific double-stranded DNA binding	Ani
Trp2	TRP-AGG2-6	tRNA	Mus musculus		Trp-2	104042	Aggressive Behaviors	-	Knockout	C57BL/6J	11823606	44	Expeimentalparadigm: Sexual behavior test//Resident–intruder test  /n  Model Generation: The exquisite specificity of TRP2 expression in the VNO provides a valuable experimental tool for genetically modifying VNO function (13, 19). We used gene targeting to construct a mouse line in which expression of the TRP2 protein is abolished. The construct strategy (20) was aimed at deleting functionally critical regions of the protein that include the transmembrane domains 4 and 5, the putative channel pore, and a sequence motif, Glu-Trp-Lys-Phe-Ala-Arg, shared among all TRP genes (13, 21,22). The linearized targeting construct was electroporated into 129/Sv embryonic stem cells. Clones carrying the targeted allele (20) were injected into C57Bl/6J blastocysts to produce male germ line chimeras that were in turn mated with C57Bl/6J females. The F1 progeny were mated to generate hetero- and homozygous animals, whose offspring were used for phenotypic analysis. We confirmed by Western blotting that a complete null allele had been generated (20).  /n  Rescue: -  /n  Model Summary: The mouse vomeronasal organ (VNO) is thought to mediate social behaviors and neuroendocrine changes elicited by pheromonal cues. The molecular mechanisms underlying the sensory response to pheromones and the behavioral repertoire induced through the VNO are not fully characterized. Using the tools of mouse genetics and multielectrode recording, we demonstrate that the sensory activation of VNO neurons requires TRP2, a putative ion channel of the transient receptor potential family that is expressed exclusively in these neurons. Moreover, we show that male mice deficient in TRP2 expression fail to display male-male aggression, and they initiate sexual and courtship behaviors toward both males and females. Our study suggests that, in the mouse, sensory activation of the VNO is essential for sex discrimination of conspecifics and thus ensures gender-specific behavior.	molecular_function	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Aggressive Behaviors	11 B5|11 46.18 cM	Knockout	C57BL/6J	11981596	45	Expeimentalparadigm: Resident–intruder test//Home cage test  /n  Model Generation: 5-HT transporter knockout (5-HTT KO) mice were generated as previously described (Bengel et al. 1998). For the present studies, mice were the product of heterozygous matings and backcrossed onto a C57BL/6J genetic background for eight generations.  /n  Rescue: -  /n  Model Summary: Isolated male 5-HTT KO mice were compared to +/+ control mice using the resident-intruder test for aggression over two encounters. Locomotor activity was measured in the home cage over a 24-h period. 5-HT(1A/1B) receptor function was assessed via the pharmacological effects of the 5-HT(1A/1B) receptor agonist, RU24969, on locomotion. 5-HTT -/- mice were slower to attack the intruder and attacked with less frequency than +/+ littermates, but showed equivalent social investigation. 5-HTT +/- mice were as quick to attack, but made fewer overall attacks, as compared to +/+ controls. Aggression increased with repeated exposure to an intruder in 5-HTT +/- and +/+ mice, but not in 5-HTT -/- mice. 5-HTT -/- mice showed a normal circadian pattern of home cage activity, but less activity overall, as compared to 5-HTT +/- and +/+ mice. RU24969 (5 mg/kg) produced hyperlocomotor effects in 5-HT +/- and +/+, but not 5-HTT -/- mice.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Nrg1	NRG1	protein-coding	Mus musculus	ENSMUSG00000062991	6030402G23Rik|ARIA|D230005F13Rik|GGF|GGFII|HRG|HRGalpha|Hgl|NDF|Pro-NRG1|SMDF	211323	Schizophrenia	8|8 A3	Knockout	C57BL/6	12145742	46	Expeimentalparadigm: Open field test//Eight-arm radial arm maze//Prepulse inhibition test  /n  Model Generation: NRG1 transmembrane-domain–knockout mice were generated using a targeting vector in which most of exon 11, which encodes the transmembrane domain, and some of the immediate downstream intron were replaced with a neomycin resistance gene cassette, preceded by an oligonucleotide carrying stop codons in each reading frame and a polyadenylation sequence. The targeting vector was electroporated into J1 embryonic stem (ES) cells (129/terSv), and founding chimeras were outcrossed to C57Bl/6 mice to establish the line. Heterozygous mice were healthy and fertile, although homozygous embryos died of cardiac defects around E10.5–E11.5. These mice will be described more fully elsewhere (R. P. Harvey, D. Lai, and M. Zhou, unpublished data). ErbB4 hypomorphic mice heterozygous for a null allele of the gene were generated by replacement of the coding region of exon 2 with a reporter gene (Gassmann et al. 1995). Heterozygous null NRG1 and ErbB4 mice were bred at Charles River Laboratories by crossing to a C57Bl/6 background. Six weeks prior to behavioral testing, male mice and litter-mate control mice for each line were shipped to the testing laboratory at PsychoGenics, where they were housed in groups of three to five related mice per cage.  /n  Rescue: -  /n  Model Summary: NRG1 is expressed at central nervous system synapses and has a clear role in the expression and activation of neurotransmitter receptors, including glutamate receptors. Mutant mice heterozygous for either NRG1 or its receptor, ErbB4, show a behavioral phenotype that overlaps with mouse models for schizophrenia.	transcription coregulator activity,signaling receptor binding,ErbB-2 class receptor binding,integrin binding,protein binding,growth factor activity,protein tyrosine kinase activator activity,receptor tyrosine kinase binding,ErbB-3 class receptor binding,chemorepellent activity,receptor ligand activity	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Mutated	C57BL/6J	12151550	47	Expeimentalparadigm: Nest building//24 hour locomotor activity//Locomotor activity//Prepulse inhibition//Water maze  /n  Model Generation: Grin1D481N/D481N andGrin1K483Q/+ mice were generated as described previously (Kew et al., 2000).Grin1D481N/D481N were mated withGrin1K483Q/+, resulting in offspring carrying one of the mutations on each allele (Grin1D481N/K483Q) or the D481N mutation on just one allele (Grin1D481N/+). Mice were genotyped by PCR on genomic tail DNA by using the primer described previously (Kew et al., 2000) and an additional primer specific for the K483Q mutation (5′-CCG CTC CTG TGT GCC AAA CTG-3′).Grin1D481N/K483Q can be distinguished fromGrin1D481N/+ by an additional amplicon of ~200 bp size. Grin1D481N/K483Q were fed with wet food starting at approximately day 15 because they were smaller and weaker than heterozygous littermates and had difficulties in reaching normal food pellets and water supplied on top of the cage. C57BL/6J × 129/Ola F1 hybrids were used as wild-type controls.  /n  Rescue: -  /n  Model Summary: NMDA receptor hypofunction has been implicated in the pathophysiology of schizophrenia. Grin1(D481N/K483Q) mice exhibited a marked NMDA receptor hypofunction revealed by deficits in hippocampal long-term potentiation, which were rescued by the glycine site agonist d-serine, which also facilitated NMDA synaptic currents in mutant, but not in wild-type, mice. Analysis of striatal monoamine levels revealed an apparent dopaminergic and serotonergic hyperfunction. Behaviorally, Grin1(D481N/K483Q) mice were insensitive to acute dizocilpine pretreatment and exhibited increased startle response but normal prepulse inhibition. Most strikingly, mutant mice exhibited a sustained, nonhabituating hyperactivity and increased stereotyped behavior that were resistant to suppression by antipsychotics and the benzodiazepine site agonist Zolpidem. They also displayed a disruption of nest building behavior and were unable to perform a cued learning paradigm in the Morris water maze.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Neurodevelopmental Disorders	X A7.3|X 37.63 cM	Mutated	Zebra Finch	12160743	48	Expeimentalparadigm: Vertical pole test//Suspended wire test//Grip strength analysis//Rotarod//Dowel test//Open field test//Tube test//Resident-intruder test//Fear conditioning test//Morris water maze  /n  Model Generation: The genomic sequences for the targeting vector were derived from a 129S5/SvEvBrd genomic library clone containing 18 kilobases (kb) of the<U+00A0>Mecp2<U+00A0>gene from intron 2 through the 3′ untranslated region (UTR) of exon 4. The 5′ region of homology in the targeting vector consisted of a 4.3 kb<U+00A0>Mecp2<U+00A0>fragment spanning from within intron 2 to codon 308 within exon 4.<U+00A0>Three of these clones were injected into C57BL/6J blastocysts that were then implanted into pseudopregnant mothers. Five male chimeric mice were generated and bred to both C57BL/6J and 129/SvEv females to generate heterozygous females of mixed and pure background, respectively. Heterozygous females were then crossed to C57BL/6J or 129/SvEv males to generate wild-type males and females, heterozygous females, and hemizygous males, which were used for the subsequent analyses.  /n  Rescue: -  /n  Model Summary: These mice appeared normal and exhibited normal motor function for about 6 weeks, but then developed a progressive neurological disease that includes many features of RTT: tremors, motor impairments, hypoactivity, increased anxiety-related behavior, seizures, kyphosis, and stereotypic forelimb motions.<U+00A0>	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Aggressive Behaviors	10|10 D2	Knockout	NA	12242242	49	Expeimentalparadigm: Sucrose preference//Elevated plus maze//Open field test//Stress-induced hyperthermia//Fear conditioning//Porsolt swim test//Resident-intruder test  /n  Model Generation: Tph2 mutant mice were generated and characterized as reported previously (Gutknecht et al. 2008, 2009, 2012). Genomic contigs of Tph2 encompassing exon 5 and flanking sequence were obtained by screening of a 129/Ola mouse Cosmid library (library number 121, RZPD, Berlin, Germany). Positive clones were further characterized by restriction mapping and Southern blot analysis. For the gene targeting construct, a ~4.4 kb XhoI-XhoI fragment located upstream of exon 5 was selected as the 5′flank, while a ~3.4 kb XhoI-XhoI fragment containing exon 5 was projected to induce the targeted deletion (Fig. 1a). The elimination of Tph2 exon 5, which codes for an amino acid sequence at the start of the catalytic domain and ends with a partial codon, was predicted to create a shift in the reading frame resulting in a truncated non-functional Tph2 protein. A LoxP site was inserted between these two fragments by cloning into pKSLox (modified pKS bluescript including one LoxP site). A ~2.0 kb XhoI-XmnI fragment, serving as 3′flank, was cloned into pKSLNL (modified pKS bluescript including a neomycine-resistance (NEO) cassette flanked by two LoxP sites) downstream of the NEO cassette. Then, the NotI-ApaI fragment comprising 5′flank-LoxP-deletion was excised from the pKSLox vector and inserted 5′ of the NEO cassette of 3′flank-containing pKSLNL. After verification by restriction analysis and sequencing, the targeting construct was linearized with NotI and electroporated into 129 R1 embryonic stem (ES) cells which were subjected to G418 selection. Targeted homologous recombination was confirmed by PCR and Southern blot analysis. The NEO cassette was removed by transient expression of Cre recombinase in the recombinant ES cells resulting in a Tph2 allele with exon 5 flanked by LoxP sites. After verification of NEO cassette excision by PCR, Southern blot and sequencing, an ES clone was injected into C57BL/6 blastocysts and implanted into pseudopregnant mice. A chimeric male displaying germ-line transmission was then used to propagate the floxed Tph2 allele on a C57BL/6 background for several generations. Tph2 +/- were obtained by breeding Tph2 +/flox mice with Nestin-Cre transgenics (Tronche et al. 1999) maintained on a C57BL/6 background. Several intercrossing of Tph2 +/flox mice with Tph2 +/flox/cre eventually resulted in Tph2 inactivation in the germline with a transmittable Tph2 null allele in Cre transgene-devoid Tph2 -/- mice, equivalent to constitutive knockout.  /n  Rescue: -  /n  Model Summary: Locomotor activity and anxiety- and depression-like behavior as well as conditioned fear responses were differentially affected by Tph2 genotype, sex, and CMS. Tph2 null mutants (Tph2(-/-)) displayed increased general metabolism, marginally reduced anxiety- and depression-like behavior but strikingly increased conditioned fear responses. Behavioral modifications were associated with sex-specific hypothalamic-pituitary-adrenocortical (HPA) system alterations as indicated by plasma corticosterone and fecal corticosterone metabolite concentrations. Tph2(-/-) males displayed increased impulsivity and high aggressiveness. Tph2(-/-) females displayed greater emotional reactivity to aversive conditions as reflected by changes in behaviors at baseline including increased freezing and decreased locomotion in novel environments. However, both Tph2(-/-) male and female mice were resilient to CMS-induced hyperlocomotion, while CMS intensified conditioned fear responses in a GxE-dependent manner.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Adra2c	ADRA2C	protein-coding	Mus musculus	ENSMUSG00000045318	Adra-2c|[a]2C|alpha2-C4|alpha2C	11553	Attention-Deficit/Hyperactivity Disorder	5 B2|5 18.09 cM	Knockout	C57BL/6J	12351753	50	Expeimentalparadigm: T-maze//Delayed alternation and spatial discrimination tasks  /n  Model Generation: The present study performed analyses in mice with a point mutation (D79N) of the α2A-AR subtype (MacMillan et al., 1996), which has been shown to effect a functional knock-out of the receptor (Lakhlani et al., 1997). The α2A-AR mutant mice (C57BL/6D79NTG strain) were created by the laboratory of Dr. Lee Limbird (Vanderbilt University, Nashville, TN) and supplied by Dr. Brian Kobilka (Stanford University, Stanford, CA).  /n  Rescue: -  /n  Model Summary: Mice were adapted to handling on a T maze and trained on either a spatial delayed alternation task that is sensitive to prefrontal cortical damage or a spatial discrimination control task with similar motor and motivational demands but no dependence on prefrontal cortex. The effects of guanfacine on performance of the delayed alternation task were assessed in additional groups of wild-type versus alpha2A-AR mutant mice. We observed that functional loss of the alpha2A-AR subtype, unlike knock-out of the alpha2C-AR subtype, weakened performance of the prefrontal cortical task without affecting learning and resulted in loss of the beneficial response to guanfacine.	G protein-coupled receptor activity,adrenergic receptor activity,alpha2-adrenergic receptor activity,alpha-2A adrenergic receptor binding,protein homodimerization activity,protein heterodimerization activity,epinephrine binding	Ani
Avpr1b	AVPR1B	protein-coding	Mus musculus	ENSMUSG00000026432	AVPR3|V3/V1b|VIBR|VPR3	26361	Aggressive Behaviors	1|1 E4	Knockout	C57BL/6;129/SvJ	12399951	51	Expeimentalparadigm: Aggression test//Social recognition test//Basile rotor-rod and hanging wire cage//Vision test//Hidden-cookie test//Sex behavior test//Elevated plus maze//Open field test//Morris water maze  /n  Model Generation: A 1FIX II mouse 129/SvJ genomic library (Stratagene, La Jolla, CA, USA) was screened with a 32P-labelled PvuII fragment of a rat V1bR cDNA. Two independent clones were identified and the largest (~16.6 kb; GENBANK Accession Nos AF152533 and AF152534) was used to construct the targeting vector. A 1.2-kb PvuII fragment 5′ to the coding region for transmembrane regions I–VI was inserted in the targeting vector pPNT at the XhoI site. The 1.7-kb PstI/SacI piece containing the 3′ end of the exon (TMVI) and most of the following introns were inserted at the HincII site of pPNT (this destroyed the thymidine kinase selection). The targeting construct thus eliminated the V1bR coding region from the initiating methionine just prior to TMVI. The construct was linearized with NotI and electroporated into embryonic stem cells for selection as described previously.22 Two embryonic stem cell clones were identified by PCR and confirmed by Southern analysis. Chimeric mice were generated from one of them and germ line transmission was observed. Genotyping was performed by PCR. The growth curves and longevity of the mice were not significantly different (Figure 1, Table 2)  /n  Rescue: -  /n  Model Summary: Here we report that mice without the V1bR exhibit markedly reduced aggression and modestly impaired social recognition. By contrast, they perform normally in all the other behaviors that we have examined, such as sexual behavior, suggesting that reduced aggression and social memory are not simply the result of a global deficit in sensorimotor function or motivation.	G protein-coupled receptor activity,vasopressin receptor activity,peptide binding	Ani
Fev	FEV	protein-coding	Mus musculus	ENSMUSG00000055197	Pet-1|Pet1|Pex1|mPet-1	260298	Aggressive Behaviors	1|1 C4	Knockout	C57Bl/6J;129	12546819	52	Expeimentalparadigm: Rotorod//Open field test//Elevated plus maze//Resident-intruder test  /n  Model Generation: Mouse Pet-1 genomic clones were obtained by screening a bacteriophage lambda library constructed with 129Sv DNA (Stratagene). Three overlapping clones were identified and the locus was partially sequenced. Comparison with the rat Pet-1 cDNA sequence (Fyodorov et al. 1998) was used to deduce the intron-exon structure. Sequences upstream and downstream of the coding region were cloned into a targeting construct designed to remove the entire Pet-1 protein coding sequence by homologous recombination using standard selection cassettes. Several rounds of electroporation and G418 selection were performed on R1 ES cells. A total of 459 colonies were isolated and screened by Southern blot analysis using an EcoRI restriction digest and a 5′ external probe (Figure 1A). Eleven positive clones were identified and rescreened using a HindIII digestion and 3′ external probe (Figures 1A and 1B). The 5′ probe hybridized to an 11.1 kb fragment in wild-type DNA and an additional 6.4 kb fragment in targeted DNA (data not shown). The 3′ probe hybridized to an 11.6 kb fragment in wild-type DNA and an additional 14.9 kb fragment in targeted DNA (Figure 1B). Two clones, 369 and 371, were chosen for blastocyst injection. All resulting chimeras displayed germline transmission and were bred to mice of both 129Sv and C57BL/6 backgrounds. The F1 mice from the C57BL/6 mating were interbred to produce Pet-1 null mice on a mixed C57BL/6 and 129 background. These mice and their offspring were used for all analyses in this study. Genotyping of progeny was by Southern blot or by PCR analysis of tail DNA. The genotyping primers used were 5′-CGC ACT TGG GGG GTC ATT ATC AC-3′, 5′-CGG TGG ATG TGG AAT GTG TGC G-3′, and 5′-GCC TGA TGT TCA AGG AAG ACC TCG G-3′. PCR conditions were 35 cycles of 94°C for 50 s, 62°C for 30 s, and 72°C for 40 s. The PCR assay generated a 209 bp fragment for the wild-type allele and a 361 bp fragment for the Pet-1 null allele.  /n  Rescue: -  /n  Model Summary: The Pet-1 ETS factor is a precise marker of developing and adult 5-HT neurons and is expressed shortly before 5-HT appears in the hindbrain. Here we show that in mice lacking Pet-1, the majority of 5-HT neurons fail to differentiate. Remaining ones show deficient expression of genes required for 5-HT synthesis, uptake, and storage. Significantly, defective development of the 5-HT system is followed by heightened anxiety-like and aggressive behavior in adults.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,double-stranded DNA binding,DNA-binding transcription factor activity,sequence-specific DNA binding,sequence-specific double-stranded DNA binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockdown	129/Sv;C57BL/6	12586455	53	Expeimentalparadigm: Prepulse inhibition//Locomotion test  /n  Model Generation: The DAT KD cohort (Zhuang et al 2001) used in the initial phenotypic characterization was sent to our laboratory from Columbia University (New York, NY; n = 12 male WT and DAT KD). All subsequent mice were derived from breedings at the vivarium at the University of California, San Diego. The DAT KD mice were generated using embryonic stem cells from the 129SvJ strain and were inserted in C57BL/6J blastocyst cells; one of the chimeras was mated with 129SvJ females to generate heterozygous mutants on a 129SvJ genetic background (for details, see Zhuang et al 2001).  /n  Rescue: The clinically effective antimania drug valproate significantly attenuated the hyperactivity and perseverative locomotor behavior in the DAT KD mice and had no effect in control mice.  /n  Model Summary: The DAT KD mice appear to provide a model of some aspects of manic behavior. With limited models of bipolar disorder, the DAT KD mice might provide a vehicle to screen for new psychiatric therapies to treat mania and its related symptoms.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Pgr	PGR	protein-coding	Mus musculus	ENSMUSG00000031870	9930019P03Rik|NR3C3|PR|PR-A|PR-B	18667	Aggressive Behaviors	9|9 A1	Knockout	NA	12601162	54	Expeimentalparadigm: Intermale aggression test//Parental behavior test  /n  Model Generation: Silastic implants filled with progesterone in sesame oil were implanted. Progesterone was suspended in sesame oil (Sigma) at a concentration of 25 mg/ml. This concentration has been shown to deliver a physiological dose of progesterone in mice for at least 28 days (39). Silastic medical-grade tubing was cut into 1-cm segments and filled with either vehicle or hormone. The ends of the implant were sealed with Silastic medical adhesive (Silicone Type A, Dow Corning). Control capsules contained sesame oil vehicle. Capsules were allowed to cure overnight before implantation. Progesterone capsules were implanted at 7 weeks of age and the mice were tested 14 days after implantation. RU486 pellets were purchased from Innovative Research of America (Sarasota, FL). The pellets released 0.5 mg/day and were implanted s.c. at 7 weeks of age. Control pellets contained inert components. Males were tested for behavior 14 days after implantation. Tests were performed by an observer blind to treatment group.  /n  Rescue: -  /n  Model Summary: We have found that male progesterone receptor knockout (PRKO) mice exhibit no infanticidal behavior and little aggression toward young. Male PRKO mice also display significantly enhanced parental behaviors. In wild-type mice, blockade of PR induces a behavioral phenotype similar to that of the PRKO males, whereas progesterone exacerbates aggressive tendencies toward infants. Aggressive behaviors directed toward adult males, by contrast, are unaffected by progesterone, PR antagonism, or PR gene deletion. Previously thought to be of diminished importance in male animals, PRs play a critical and specific role in modulating infant-directed behaviors in male mice.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,signaling receptor binding,steroid binding,protein binding,zinc ion binding,lipid binding,enzyme binding,hormone binding,identical protein binding,sequence-specific DNA binding,metal ion binding,ATPase binding	Ani
Pitx3	PITX3	protein-coding	Mus musculus	ENSMUSG00000025229	Ptx3|ak|aphakia	18742	Attention-Deficit/Hyperactivity Disorder	19 C3|19 38.75 cM	Mutated	C57BL/6J	12702666	55	Expeimentalparadigm: Locomotion test  /n  Model Generation: The ak mice originate from The Jackson Laboratories. The autosomal recessive ak mutation arose spontaneously in the 129/Sv-Slj strain (Varnum and Stevens, 1968) and was subsequently crossed into the C57BL/6 background (Semina et al.,2000). The mice used in this study were maintained in the C57BL/6 background and provided to us by Dr Jeff Murray, University of Iowa.  /n  Rescue: -  /n  Model Summary: Mesencephalic dopaminergic (MesDA) neurons play crucial roles in motor and behavioral processes; their loss in Parkinson's disease (PD) results in striatal dopamine (DA) deficiency and hypokinetic movement disorder. The Pitx3 homeobox gene is expressed in the MesDA system. We now show that only a subset of MesDA neurons express Pitx3 and that in Pitx3-deficient aphakia mice, this subset is progressively lost by apoptosis during fetal (substantia nigra, SN) and postnatal (ventral tegmental area) development, resulting in very low striatal DA and akinesia.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific double-stranded DNA binding	Ani
Chrnb2	CHRNB2	protein-coding	Mus musculus	ENSMUSG00000027950	Acrb-2|Acrb2|C030030P04Rik|[b]2-nAchR	11444	Attention-Deficit/Hyperactivity Disorder	3 F1|3 39.19 cM	Knockout	C57BL/6J;ICR	12736354	56	Expeimentalparadigm: PA learning//Shock reactivity test  /n  Model Generation: The cDNA encoding the β2 subunit was generated by reverse transcription (RT)-PCR from mouse brain mRNA (5′, TTT AAG CTT- GCG CGG CTT CAG CAC CAC GGA CAG CGC; 3′, TTT ACT AGT- TCC ACC CAA TAC TAC TGA ACC) and subcloned into pTet-splice (Invitrogen, Gaithersburg, MD). The plasmid was sequenced, and the band containing the Tet-β2 construct and SV40 3′ untranslated region was excised, purified by gel electrophoresis, and microinjected into B6SJL oocytes (Yale University Transgenic Facility). Founder mice carrying the transgene were crossed with Line A NSE-tTA mice on the ICR background (Chen et al., 1998; Kelz et al., 1999) and β2 ko mice on the C57BL/6J background (Picciotto et al., 1995). C57BL/6J mice were obtained from The Jackson Laboratory (Bar Harbor, ME).  /n  Rescue: -  /n  Model Summary: Prenatal nicotine exposure has been linked to attention deficit hyperactivity disorder and cognitive impairment, but the sites of action for these effects of nicotine are still under investigation. High-affinity nicotinic acetylcholine receptors (nAChRs) contain the beta2 subunit and modulate passive avoidance (PA) learning in mice. Using an inducible, tetracycline-regulated transgenic system, we generated lines of mice with expression of high-affinity nicotinic receptors restored in specific neuronal populations. One line of mice shows functional beta2 subunit-containing nAChRs localized exclusively in corticothalamic efferents. Functional, presynaptic nAChRs are present in the thalamus of these mice as detected by nicotine-elicited rubidium efflux assays from synaptosomes. Knock-out mice lacking high-affinity nAChRs show elevated baseline PA learning, whereas normal baseline PA behavior is restored in mice with corticothalamic expression of these nAChRs. In contrast, nicotine can enhance PA learning in adult wild-type animals but not in corticothalamic-expressing transgenic mice.	transmembrane signaling receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,protein binding,acetylcholine receptor activity,acetylcholine-gated cation-selective channel activity,neurotransmitter receptor activity,acetylcholine binding,protein-containing complex binding,quaternary ammonium group binding,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Htr2c	HTR2C	protein-coding	Mus musculus	ENSMUSG00000041380	5-HT-1C|5-HT-2C|5-HT1C|5-HT2C|5-HT2cR|5-HTR2C|5HT1c|Htr1c|SR1	15560	Obsessive Compulsive Disorder	X F2|X 68.46 cM	Knockout	C57BL/6J	12782219	57	Expeimentalparadigm: Clay chewing//Screen chewing//Head-dipping habituation  /n  Model Generation: Mice with a targeted gene disruption of the 5-HT2C receptor (KO) and wildtype (WT) mice for these studies (a gift from Drs. L.H. Tecott and D. Julius) were derived from the founder colony as described by Tecott et al. [26]. Separate groups of male mice (C57BL/6J background; backcross: seven to nine generations) were used for each experiment. Mice lacking 5-HT2c receptors (5-HT2CR ) were generated by introducing a nonsense mutation into exon 5 of the cognate gene, thereby placing a stop codon within the fifth putative transmembrane segment of the receptor and eliminating the carboxyterminal half of the protein (Fig. 1<U+00AB>). When this mutation was introduced into the corresponding position of the rat 5-HT2CR complementary DNA, the resultant cRNA failed to express functional receptors in Xenopus oocytes (not shown). The 5- HT2CR gene is X-linked910, and targeted J 1 and D3 male (XY) embryonic stem cells therefore showed disruption of a single allele (Fig. 1b ).  /n  Rescue: -  /n  Model Summary: We hypothesized that 5-HT(2C) receptor knockout (KO) mice may display compulsive-like behavior. This paper describes characterization of several distinct, highly organized behaviors in mice lacking functional 5-HT(2C) receptors, which supports a compulsive-like syndrome.Compulsive-like behavior was assessed in male 5-HT(2C) receptor KO and wildtype (WT) mice. Chewing of non-nutritive clay, chewing patterns on plastic-mesh screens, and the frequency of head dipping were measured. 5-HT(2C) receptor KO mice chewed more clay, produced a distinct pattern of "neat" chewing of plastic screens and exhibited reduced habituation of head dipping activity compared to WT mice. We conclude that the 5-HT(2C) receptor null mutant mouse provides a promising model of compulsive behavior and a means to further explore the role of 5-HT in OCD.	Gq/11-coupled serotonin receptor activity,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,neurotransmitter receptor activity,identical protein binding,serotonin binding,1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding	Ani
Chrnb2	CHRNB2	protein-coding	Mus musculus	ENSMUSG00000027950	Acrb-2|Acrb2|C030030P04Rik|[b]2-nAchR	11444	Attention-Deficit/Hyperactivity Disorder	3 F1|3 39.19 cM	Knockout	C57BL/6	12876201	58	Expeimentalparadigm: Spatial learning//Exploratory behavior and navigation//Symbolic quantification of trajectories//Social-interaction test  /n  Model Generation: Thirty-six C57BL/6 and β2 mutant mice were used.  /n  Rescue: -  /n  Model Summary: To explore the contribution of nicotinic receptors to complex cognitive functions, we developed an automated method to investigate sequential locomotor behavior in the mouse and an analysis of social behavior. We show that, in the beta2-/- mutant, the high-order spatiotemporal organization of locomotor behavior, together with conflict resolution and social interaction, is selectively dissociated from low-level, more automatic motor behaviors. Such deficits in executive functions resemble the rigid and asocial behavior found in some psychopathological disorders such as autism and attention deficit hyperactivity disorder.	transmembrane signaling receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,protein binding,acetylcholine receptor activity,acetylcholine-gated cation-selective channel activity,neurotransmitter receptor activity,acetylcholine binding,protein-containing complex binding,quaternary ammonium group binding,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Anxiety Disorder	11 B5|11 46.18 cM	Knockout	C57BL/6J	12968128	59	Expeimentalparadigm: Elevated plus maze//Light-dark box test//Emergence test//Open field test  /n  Model Generation: Serotonin transporter (5-HTT) null mutant mice were generated as previously described (Bengel et al, 1998). Briefly, 3′ and 5′ DNA fragments encompassing exon 2 of the htt and with an overall length of 7.5<U+2009>kb were inserted into the pPNT-neo replacement targeting vector, containing a neo and TK cassette under the control of the PGK promoter. A 1.1<U+2009>kb BamHI/HindIII fragment was replaced by the 1.8<U+2009>kb PGK neomycin-polyA expression cassette. In all, 129 R1 embryonic stem cells were cultured, transfected, and subjected to double selection. DNA was digested with Asp718 and hybridized with a 3′ probe that recognized a htt sequence external to the construct. In addition, recombinant embryonic stem cell clones were identified by Southern blot analysis, with the use of a 5′ HindIII/BamHI probe to confirm accurate gene targeting. Embryonic stem cell clones were microinjected in C57BL/6J blastocysts to obtain chimeric progeny. Chimeric males were mated to C57BL/6J female mice and pups genotyped by Southern blot analysis of tail biopsies to confirm germline transmission. For behavioral experiments, the 5-HTT mutation was backcrossed into a C57BL/6J genetic background for eight generations. 5-HTT mutant mice and +/+ littermate controls were derived from 5-HTT +/- × 5-HTT +/- matings, and are viable, and reproduce  /n  Rescue: -  /n  Model Summary: To further evaluate the role of the 5-HTT in anxiety, we employed a mouse model in which the 5-HTT gene (htt) was constitutively inactivated. 5-HTT -/- mice were characterized for anxiety-related behaviors using a battery of tests (elevated plus maze, light<-->dark exploration test, emergence test, and open field test). Male and female 5-HTT -/- mice showed robust phenotypic abnormalities as compared to +/+ littermates, suggestive of increased anxiety-like behavior and inhibited exploratory locomotion. The selective 5-HT(1A) receptor antagonist, WAY 100635 (0.05-0.3 mg/kg), produced a significant anxiolytic-like effect in the elevated plus maze in 5-HTT -/- mice, but not +/+ controls. The present findings demonstrate abnormal behavioral phenotypes in 5-HTT null mutant mice in tests for anxiety-like and exploratory behavior, and suggest a role for the 5-HT(1A) receptor in mediating these abnormalities.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Crhr1	CRHR1	protein-coding	Mus musculus	ENSMUSG00000018634	CRF1R|CRFR1|Crhr	12921	Anxiety Disorder	11 E1|11 67.77 cM	Conditional Knockout	129/Sv;C57BL/6	12973355	60	Expeimentalparadigm: Light-dark box test//Elevated plus maze//Open field test  /n  Model Generation: A previously identified 35.8-kb cosmid clone was used to construct a targeting vector8. As a 5′-homology arm, a 3.1-kb XhoI/HindIII loxP fragment containing exons 9–13 of the Crhr1 gene was inserted in front of the loxP site of pKSloxPNT (ref. 42). This homology arm was extended by a 5.4-kb SpeI/XhoI fragment encompassing exons 5–8, which was inserted between the thymidine-kinase cassette and the first loxP site. In addition, 3′ to the second loxP site, a 6.85-kb HindIII/BglII fragment from PGT-3/PT-1 (ref. 43) was introduced. This fragment contained the engrailed 2 splice-acceptor site with some exon sequence fused in-frame to a β-galactosidase with its own polyadenylation signal and a PGK-neomycin cassette, which was followed by the 3′-homology arm encompassing the 2.9–kb HindIII/BamHI fragment located downstream of exon 13 and of the polyadenylation site. TBV2 (129/SvP) ES cells were electroporated with the targeting vector, and mutant ES cells were identified by genomic Southern blot as described previously8. Mutant ES cells were used to generate chimeric mice by blastocyst injection. Chimeras were bred with C57BL/6 mice to obtain F1 offspring, and germ-line transmission of the mutant allele was determined by Southern blot analysis using the 3′ external probe after HindIII digestion (data not shown). For the conditional inactivation of Crhr1 in the limbic system, we used transgenic mice carrying the gene encoding Cre recombinase under the control of the Camk2a-cre promoter20. The deletion pattern and efficiency of Camk2a-cre was evaluated using Z/AP reporter mice24. To generate Crhr1loxP/loxPCamk2a-cre and Crhr1loxP/loxP control mice, we crossed mice harboring a Crhr1loxP allele with Camk2a-cre mice. Mice used for this study were kept on a mixed 129/Sv × C57BL/6 background. Genotyping was performed by Southern blot analysis of XbaI-digested tail DNA using an internal Crhr1 probe and a Cre recombinase–specific probe.  /n  Rescue: -  /n  Model Summary: To differentiate the CNS pathways involving CRH and CRH receptor 1 (Crhr1) that modulate behavior from those that regulate neuroendocrine function, we generated a conditional knockout mouse line (Crhr1(loxP/loxP)Camk2a-cre) in which Crhr1 function is inactivated postnatally in anterior forebrain and limbic brain structures, but not in the pituitary. This leaves the hypothalamic-pituitary-adrenocortical (HPA) system intact. Crhr1(loxP/loxP)Camk2a-cre mutants showed reduced anxiety, and the basal activity of their HPA system was normal. In contrast to Crhr1 null mutants, conditional mutants were hypersensitive to stress corticotropin and corticosterone levels remained significantly elevated after stress. Our data clearly show that limbic Crhr1 modulates anxiety-related behavior and that this effect is independent of HPA system function. Furthermore, we provide evidence for a new role of limbic Crhr1 in neuroendocrine adaptation to stress.	G-protein alpha-subunit binding,transmembrane signaling receptor activity,G protein-coupled receptor activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,peptide binding,corticotropin-releasing hormone receptor activity,protein-containing complex binding,corticotropin-releasing hormone binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	NA	14603268	61	Expeimentalparadigm: Acoustic startle//Locomotion test  /n  Model Generation: For all experiments, WT and KO DAT mice were bred at the San Diego Veteran's Administration Medical Center in an Association for Assessment and Accreditation of Laboratory Animal Care-approved animal facility, which met all state and federal requirements for animal care, using parental mice received from Duke University (Giros et al, 1996).  /n  Rescue: Treatment with M100907 (0.3-1.0 mg/kg, but not 0.1 mg/kg) reversed locomotor deficits in DAT KO mice.  /n  Model Summary: Mice that display elevated synaptic levels of dopamine due to a genetically engineered deletion of the dopamine transporter (DAT) model behavioral deficits that simulate the above conditions. As novel treatment strategies for these disorders have focused on the serotonin (5-HT) 2A receptor, we determined the capacity of the highly selective 5-HT(2A) receptor antagonist M100907 to reverse behavioral deficits in DAT knockout (KO) mice. Prior to drug treatment, DAT KO mice exhibited increased levels of locomotor activity and highly linearized movement in a novel environment, as well as reduced prepulse inhibition (PPI) of acoustic startle, compared to wild-type littermates.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Anxiety Disorder	11 B5|11 46.18 cM	Mutated	C57BL/6J	14653308	62	Expeimentalparadigm: Light-dark box test//Elevated plus maze//5-HT1A receptor agonist-induced hypothermia  /n  Model Generation: Serotonin transporter (5-HTT) null mutant mice were originally generated using 129P1/ReJ (129P1) embryonic stem cells microinjected into C57BL/6J (B6) blastocysts (Bengel et al. 1998). One cohort of mice was backcrossed onto a B6 genetic background for 12–15 generations (B6 congenic). The 129SvEvTac 129S6 strain was used to backcross another cohort of mutant mice for 13 generations (129S6 congenic). To minimize potential genotype-related variation in parental behavior and early life experience (e.g., Bale et al. 2002), all subjects were generated from heterozygous 5-HTT +/-×5-HTT+/- matings. Post-weaning, littermates were reared together and housed together in same-sex groups, in a temperature and humidity controlled vivarium, under a 12-h light/dark cycle (lights on at 06.00). Mice from the B6 congenic and 129S6 congenic cohorts were housed side-by-side in the same holding room. B6 congenic mice used in the present experiments were 13 female and 10 male 5-HTT -/- mice, 11 female and 15 male 5-HTT +/- mice and 11 female and 11 male +/+ controls. 129S6 congenic mice were 11 female and 12 male 5-HTT -/- mice, 14 female and 12 male 5-HTT +/- mice and 14 female and 13 male +/+ controls.  /n  Rescue: -  /n  Model Summary: Anxiety-like behaviors were assessed in 5-HTT null mutants with the mutation placed on either a B6 congenic or a 129S6 congenic background. Replicating previous findings, B6 congenic 5-HTT null mutants exhibited increased anxiety-like behavior and reduced exploratory locomotion on the light <--> dark exploration and elevated plus-maze tests. In contrast, 129S6 congenic 5-HTT null mutant mice showed no phenotypic abnormalities on either test. 5-HTT null mutants on the 129S6 background showed reduced 5-HT(1A) receptor binding (as measured by quantitative autoradiography) and reduced 5-HT(1A) receptor function (as measured by 8-OH-DPAT-induced hypothermia). These data confirm that the 5-HTT null mutation produced alterations in brain 5-HT function in mice on the 129S6 background, thereby discounting the possibility that the absence of an abnormal anxiety-like phenotype in these mice was due to a suppression of the mutation by 129 modifier genes. Anxiety-like behaviors in the light <--> dark exploration and elevated plus-maze tests were significantly higher in 129S6 congenic +/+ mice as compared to B6 congenic +/+ mice.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Drd4	DRD4	protein-coding	Mus musculus	ENSMUSG00000025496	D4R|Drd-4	13491	Attention-Deficit/Hyperactivity Disorder	7 F5|7 86.6 cM	Mutated	CF-1	14699433	63	Expeimentalparadigm: Open field test//Elevated plus maze test//Rotarod//Ataxia test  /n  Model Generation: All mice tested were male sibling cohorts of CF-1 outbred mice maintained by crossing nonrelated individuals. Male Drd4-/- and their wild-type siblings were obtained by mating Drd4+/- parents backcrossed for 6–10 generations to CF-1 mice. For details concerning the generation of Drd4-/- mice, see Rubinstein et al.  /n  Rescue: -  /n  Model Summary: Here, we generated a mouse model with high face value to screen candidate genes for the clinical disorder by neonatal disruption of central dopaminergic pathways with 6-hydroxydopamine (6-OHDA). The lesioned mice exhibited hyperactivity that waned after puberty, paradoxical hypolocomotor responses to amphetamine and methylphenidate, poor behavioral inhibition in approach/avoidance conflict tests and deficits in continuously performed motor coordination tasks. To determine whether the D4R plays a role in these behavioral phenotypes, we performed 6-OHDA lesions in neonatal mice lacking D4Rs (Drd4-/-).	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,SH3 domain binding,neurotransmitter receptor activity,dopamine binding,identical protein binding,metal ion binding,epinephrine binding,norepinephrine binding,heterocyclic compound binding	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Transgene	C57BL/6JXSJL	14751778	64	Expeimentalparadigm: SHIRPA//Paw print test//Rotarod//Treadmill//Grip strength test//Swimming test  /n  Model Generation: The EcoRI/XhoI fragment containing the sMT-Ia promoter was introduced at the EcoRI/XhoI site of the pCMVβ plasmid and was designated psMT. The full-length Dyrk1A cDNA (a gift from Dr W.Becker, Hamburg, Germany) was PCR amplified to introduce NotI sites at the 5′ and 4′ ends and was then cloned at the NotI site of the psMT-Ia plasmid. The complete transgene sequence was subsequently confirmed by DNA sequencing. The production of mice transgenic for Dyrk1a (TgDyrk1a) has previously been described (Altafaj et al., 2001). The transgene was inserted into C57BL/6JXSJL (Charles River, Barcelona, Spain) embryos and the stock is maintained by intercrossing wild-type and transgenic mice derived from the original founder.  /n  Rescue: -  /n  Model Summary: Here we investigate the motor profile of transgenic mice overexpressing Dyrk1a, Tg(Dyrk1a)1Cff (hereafter TgDyrk1a), a candidate gene hypothesized to cause some of the neurological defects associated with DS. We have previously shown DYRK1A expression in the cerebellum and functionally related structures, most brainstem motor nuclei and spinal cord, supporting a role for Dyrk1a in controlling motor function. Here we demonstrate that TgDyrk1a mice present DYRK1A overexpression in these areas along with specific motor dysfunction. The main finding that emerged was impairment of motor learning and alteration of the organization of locomotor behavior, which agrees with reported clinical observations in subjects with DS.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Ar	AR	protein-coding	Mus musculus	ENSMUSG00000046532	Tfm	11835	Aggressive Behaviors	X C3|X 42.82 cM	Knockout	C57BL/6J	14960012	65	Expeimentalparadigm: Social exposure//Resident-intruder aggression tests  /n  Model Generation: Production of the mice used in these experiments has previously been described in detail (Scordalakes et al. 2002). In brief, females carrying the Tfm mutation (C57BL/6J-Aw–J-Ta+/+ARTfm purchased from Jackson Laboratory, Bar Harbor, ME, USA) were mated to males that were heterozygous for the ERα (+/–) gene. These mice have been backcrossed into the C57BL/6J background for at least 10 generations. From that cross, we obtained females that were both Tfm carriers and heterozygous for the ERα gene disruption. These females were mated with heterozygous ERαKO males. This cross produces offspring of the following genotypes: WT males (ERα+/+ AR<U+2003>+) and females (ERα+/+ AR+/+), ERαKO males (ERα-/–; AR<U+2003>+) and females, Tfm males (ERα+/+ AR-), Tfm/ERαKO (referred to as DKO) males (ERα-/–; AR-), ERα heterozygous males and females, Tfm carrier females, Tfm carrier/ERα heterozygous females, Tfm carrier/ERαKO females and Tfm/ERα heterozygous males.  /n  Rescue: -  /n  Model Summary: In the following study, we asked which steroid receptors regulate aggression and arginine vasopressin (AVP) immunoreactivity (-ir) in several limbic regions. Using spontaneous mutant and knockout mice, we generated a novel cross of mice whose offspring lacked estrogen receptor alpha (ER alpha), androgen receptor (AR) or both ER alpha and AR. The wild-type (WT) males and females were compared with ER alpha knockout (ER alphaKO) male, mutated AR (Tfm) male and ER alphaKO/Tfm (double knockout; DKO) male littermates. Animals were gonadectomized and treated with 17beta-estradiol (E2) prior to resident-intruder aggression tests. WT and Tfm males showed aggression whereas WT females, ER alphaKO and DKO males did not.	transcription cis-regulatory region binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,RNA polymerase II general transcription initiation factor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear receptor activity,signaling receptor binding,steroid binding,androgen binding,protein binding,beta-catenin binding,zinc ion binding,lipid binding,enzyme binding,protein domain specific binding,ribonucleotide binding,sequence-specific DNA binding,metal ion binding,nuclear androgen receptor binding,ATPase binding,molecular adaptor activity,RNA polymerase II-specific DNA-binding transcription factor binding,POU domain binding	Ani
Esr1	ESR1	protein-coding	Mus musculus	ENSMUSG00000019768	ER|ER-alpha|ERa|ERalpha|ESR|Estr|Estra|Nr3a1	13982	Aggressive Behaviors	10 A1|10 2.03 cM	Knockout	C57BL/6J	14960012	66	Expeimentalparadigm: Resident-intruder test  /n  Model Generation: Production of the mice used in these experiments has previously been described in detail (Scordalakes et al. 2002). In brief, females carrying the Tfm mutation (C57BL/6J-Aw–J-Ta+/+ARTfm purchased from Jackson Laboratory, Bar Harbor, ME, USA) were mated to males that were heterozygous for the ERα (+/–) gene. These mice have been backcrossed into the C57BL/6J background for at least 10 generations. From that cross, we obtained females that were both Tfm carriers and heterozygous for the ERα gene disruption. These females were mated with heterozygous ERαKO males. This cross produces offspring of the following genotypes: WT males (ERα+/+ AR<U+2003>+) and females (ERα+/+ AR+/+), ERαKO males (ERα-/–; AR<U+2003>+) and females, Tfm males (ERα+/+ AR-), Tfm/ERαKO (referred to as DKO) males (ERα-/–; AR-), ERα heterozygous males and females, Tfm carrier females, Tfm carrier/ERα heterozygous females, Tfm carrier/ERαKO females and Tfm/ERα heterozygous males.  /n  Rescue: -  /n  Model Summary: In the following study, we asked which steroid receptors regulate aggression and arginine vasopressin (AVP) immunoreactivity (-ir) in several limbic regions. Using spontaneous mutant and knockout mice, we generated a novel cross of mice whose offspring lacked estrogen receptor alpha (ER alpha), androgen receptor (AR) or both ER alpha and AR. The wild-type (WT) males and females were compared with ER alpha knockout (ER alphaKO) male, mutated AR (Tfm) male and ER alphaKO/Tfm (double knockout; DKO) male littermates. Animals were gonadectomized and treated with 17beta-estradiol (E2) prior to resident-intruder aggression tests. WT and Tfm males showed aggression whereas WT females, ER alphaKO and DKO males did not. In the lateral septum, WT and Tfm male brains had significantly denser AVP-ir as compared with WT females and DKO males. ER alphaKO male brains were intermediate in the amount of AVP-ir present. In the medial amygdala, brains from all genotypes had equivalent AVP-ir, except DKO males, which had significantly less AVP-ir. Overall, the expression of aggressive behavior coincided with AVP-ir in WT, Tfm and DKO males. However, in ER alphaKO males and WT females, the amount of AVP-ir was not associated with resident-intruder aggression.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,TFIIB-class transcription factor binding,transcription coregulator binding,transcription corepressor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,beta-catenin binding,transcription factor binding,zinc ion binding,lipid binding,TBP-class protein binding,enzyme binding,protein kinase binding,nuclear estrogen receptor activity,nuclear estrogen receptor binding,type 1 metabotropic glutamate receptor binding,estrogen response element binding,phosphatidylinositol 3-kinase regulatory subunit binding,hormone binding,identical protein binding,sequence-specific DNA binding,protein-containing complex binding,metal ion binding,ATPase binding,sequence-specific double-stranded DNA binding,promoter-specific chromatin binding	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Transgene	FVB/Cr	15198122	67	Expeimentalparadigm: Passive avoidance learning//Open field test  /n  Model Generation: Genetically modified mice of the inbred FVB/Cr strain were created by means of a microinjection of DNA at a concentration of 1 ng μl-1 into FVB zygotes. This concentration of DNA results in approximately 1 to 5 copies of YAC DNA being injected into the fertilized egg. Specifically, 8 YAC lines consisting of 4 pairs carrying the same human DNA fragment at 2 different points in their genome were generated: 285E6#55, 285E6#50; 141G6#4, 141G6#28; 230E8#84, 230E8#67; and 152F7#57 (line A), 152F7#12 (line B) (Fig. 1). Only the first of each pair of twin lines was used with the exception of lines that showed phenotypic alterations, in which case both lines were used in order to control for possible artifacts due to the insertion of the DNA (6, 7).  /n  Rescue: -  /n  Model Summary: In the present study we used a transgenic mouse in vivo library consisting of 4 yeast artificial chromosome (YAC) transgenic mouse lines, each bearing a different fragment of the Down syndrome critical region 1 (DCR-1), implicated in brain abnormalities characterizing this pathology. The 152F7 fragment, in addition to genes also located on the other DCR-1 fragments, bears the DYRK1A gene, encoding for a serine-threonine kinase. The neurobehavioral analysis of these mouse lines showed that DYRK1A overexpressing 152F7 mice but not the other lines display learning impairment and hyperactivity during development.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	C57BL/6;129/SvEv	15265649	68	Expeimentalparadigm: Rotarod//Social affiliation test//Resident-intruder test//Chocolate chip olfactory test//Acoustic startle and prepulse inhibition  /n  Model Generation: The NR1-deficient mice were created initially on a mixed genetic background consisting of alleles derived from 129/SvEv, C57BL/6, and DBA/2 [39]. It is clear that modifier alleles present in various inbred mouse lines can dramatically alter the impact of primary genetic lesions. Therefore, it is important to obtain populations of mice that differ genetically only at the NR1 locus. A strategy was devised to generate NR1 hypomorphs and genetically identical wild type populations. C57BL/6 heterozygous animals were intercrossed with 129 EV/SV heterozygous animals. All of the F1 offspring of these litters will be genetically identical at all loci except at the NR1 gene. Analysis of these litters showed that mice homozygous for the mutation were present at the expected frequency and, furthermore, that these NR1 hypomorphic mice were very close in size to the wild type littermates. The NR1 mutation was maintained on the C57BL/6 and 129/SvEv genetic backgrounds by breeding heterozygous animals to commercially available stock (Jackson Laboratories). Resulting heterozygous offspring from these crosses were used to maintain the lines and to provide heterozygous breeders for the generation of the F1 hybrid homozygous mice (-/-) and their control populations (+/+).  /n  Rescue: -  /n  Model Summary: The present study tested the hypothesis that these NR1 hypomorphic mice would exhibit deficits in sensorimotor and conspecific interactions, analogous to deficits observed in schizophrenic patients. F1 hybrid mice homozygous for the NR1 hypomorphic mutation (NR1 -/-) were generated by crossing heterozygous mice (NR1 +/-) from C57BL/6 and 129 Sv/Ev backgrounds. To assess sensorimotor gating, mice were tested in the paradigm of prepulse inhibition of acoustic startle. The NR1 hypomorphic mice exhibited increased acoustic startle responses and also showed deficits in prepulse inhibition. Startle responses were differentially altered by predator odor exposure in the male NR1 -/- mice, in comparison to control mice. In a test of social affiliation, the wild type mice spent significantly more time investigating a novel mouse in comparison to the NR1 -/- mice. In a resident-intruder test, marked deficits were found in sex-specific aggressive behavior between the wild type and mutant mice. These data support the contention that the NR1 hypomorphic mice exhibit alterations in sensorimotor gating and typical conspecific interactions, reminiscent of behavioral disturbances associated with schizophrenia.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Gsk3b	GSK3B	protein-coding	Mus musculus	ENSMUSG00000022812	7330414F15Rik|8430431H08Rik|GSK-3|GSK-3beta|GSK3	56637	Bipolar Disorder	16|16 B3	Knockout	C57BL/6	15282284	69	Expeimentalparadigm: Forced swim test//Hole board exploratory behavior//Elevated zero maze  /n  Model Generation: Gsk-3β knock-out mice were maintained in the C57/B6 background as described previously (Hoeflich et al., 2000). To investigate the role of GSK-3 in mammalian development, we disrupted the GSK-3β gene in murine 129J embryonic stem (ES) cells using a targeting vector in which the exon encoding the ATP-binding loop was deleted (Fig. 1a). Chimaeric mice derived from two independent heterozygous ES clones were back-crossed to C57BL/6J mice, and heterozygous mice were crossed to generate homozygous mutant offspring. The null mutation of GSK-3β was confirmed by tail DNA genotyping and Southern (Fig. 1b) and western blot ( Fig. 1c) analyses of embryonic fibroblasts derived from mice on day 12.5 of gestation (E12.5). Although GSK-3β male and female mice were healthy and fertile, they did not give rise to live GSK-3β progeny.+/-  /n  Rescue: -  /n  Model Summary: We describe behaviors in mice that are robustly affected by chronic lithium. Remarkably, these lithium-sensitive behaviors are also observed in mice lacking one copy of the gene encoding glycogen synthase kinase-3beta (Gsk-3beta), a well established direct target of lithium.	nucleotide binding,protease binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,integrin binding,protein binding,ATP binding,beta-catenin binding,kinase activity,transferase activity,protein kinase binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding,dynactin binding,ionotropic glutamate receptor binding,tau protein binding,tau-protein kinase activity,NF-kappaB binding,RNA polymerase II-specific DNA-binding transcription factor binding,dynein complex binding,protein serine kinase activity,protein serine/threonine kinase binding	Ani
Gria1	GRIA1	protein-coding	Mus musculus	ENSMUSG00000020524	2900051M01Rik|Glr-1|Glr1|GluA1|GluR-A|GluRA|Glur-1|Glur1|HIPA1|gluR-K1	14799	Aggressive Behaviors	11 B1.3|11 34.51 cM	Knockout	C57BL/6J	15344919	70	Expeimentalparadigm: Resident-intruder test//Resident-intruder test//Agonistic behavior in male mice with sexual experience//Interline agonistic behavior on neutral territory//Agonistic behavior within the group//Sexual behavior//Maternal agonistic behavior//Observational behavioral test//Anxiety behavior  /n  Model Generation: The GluR-A–/– and GluR-AR/R mice were constructed as described (Vekovischeva et al. 2001; Zamanillo et al. 1999) using the embryonic stem cell line R1 (Nagy et al. 1993), that derived from F1 embryos of males from 129S1/Sv-pTyrKitl++Sl–J/+ substrain crossed to females from 129<U+2003>× 1/SvJ substrain. The RI cells did not receive the KitlSl–J mutation (Laura Trepanier, Jackson Laboratories, Bar Harbor, ME). The mutant mice were backrossed for more than five times in C57BL/6J strain in Germany. For our experiments heterozygous breeding pairs were produced with C57BL/6J mice by a balanced breeding schedule to maintain genetic components equally from males and females of both homozygous mutants and wild-types and transferred to Finland. The experimental mice (mutants and littermates) were produced by heterozygous mating, and raised by heterozygous mothers to exclude possible emotional influence of mutant parents on pups' development (Winslow et al. 2000).  /n  Rescue: -  /n  Model Summary: We studied the involvement of AMPA receptors in social interaction and anxiety and found that in several paradigms of agonistic behavior na<U+00EF>ve male mice deficient for the GluR-A subunit- containing AMPA receptors are less aggressive than wild-type littermates. GluR-A deficient mice and wild-type littermates exhibited similar basic behavior and reflexes as monitored by observational Irwin's test, but they tended to be less anxious in elevated plus-maze and light-dark tests. Maternal aggression or male-female encounters were not affected which suggests that male hormones are involved in the expression of suppressed aggressiveness. However, testosterone levels and brain monoamines can be excluded and found to be similar between GluR-A deficient and wild-type littermates. The reduced AMPA receptor levels caused by the lack of the GluR-A subunit, and measured by a 30% reduction in hippocampal [3H]-S-AMPA binding, seem to be the reason for suppressed male aggressiveness. When we analyzed mice with reduced number of functional AMPA receptors mediated by the genomic introduced GluR-A(Q582R) channel mutation, we observed again male-specific suppressed aggression, providing additional evidence for GluR-A subunit-containing AMPA receptor involvement in aggression.	amyloid-beta binding,G-protein alpha-subunit binding,ionotropic glutamate receptor activity,AMPA glutamate receptor activity,ion channel activity,protein binding,protein C-terminus binding,adenylate cyclase binding,ligand-gated ion channel activity,immunoglobulin binding,protein kinase binding,protein domain specific binding,PDZ domain binding,small GTPase binding,myosin V binding,G-protein beta-subunit binding,beta-2 adrenergic receptor binding,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,identical protein binding,protein kinase A binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Npas1	NPAS1	protein-coding	Mus musculus	ENSMUSG00000001988	MOP5|bHLHe11	18142	Schizophrenia	7 A2|7 9.14 cM	Knockout	C57BL/6J	15347806	71	Expeimentalparadigm: Social recognition//Open field test//Hanging wire//Open field//Rotarod//Ataxia//Prepulse inhibition//Cued and contextual fear//Shock threshold  /n  Model Generation: Behavioral and regulatory abnormalities in mice deficient in the NPAS1 and NPAS3 transcription factors. NPAS1+/–:NPAS3+/– females (F1) mated to NPAS1+/–: NPAS3+/– males (F1) produced 129/SvEv:C57BL/6J mixed strain litters.  /n  Rescue: -  /n  Model Summary: Laboratory mice bearing inactivating mutations in the genes encoding the NPAS1 and NPAS3 transcription factors have been shown to exhibit a spectrum of behavioral and neurochemical abnormalities. Behavioral abnormalities included diminished startle response, as measured by prepulse inhibition, and impaired social recognition. NPAS1/NPAS3-deficient mice also exhibited stereotypic darting behavior at weaning and increased locomotor activity.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,protein binding,protein heterodimerization activity,protein dimerization activity	Ani
Npas3	NPAS3	protein-coding	Mus musculus	ENSMUSG00000021010	4930423H22Rik|bHLHe12	27386	Schizophrenia	12|12 C1	Knockout	C57BL/6J	15347806	72	Expeimentalparadigm: Social recognition//Open field test//Hanging wire//Open field//Rotarod//Ataxia//Prepulse inhibition//Cued and contextual fear//Shock threshold  /n  Model Generation: Behavioral and regulatory abnormalities in mice deficient in the NPAS1 and NPAS3 transcription factors. NPAS1+/–:NPAS3+/– females (F1) mated to NPAS1+/–: NPAS3+/– males (F1) produced 129/SvEv:C57BL/6J mixed strain litters.  /n  Rescue: -  /n  Model Summary: Laboratory mice bearing inactivating mutations in the genes encoding the NPAS1 and NPAS3 transcription factors have been shown to exhibit a spectrum of behavioral and neurochemical abnormalities. Behavioral abnormalities included diminished startle response, as measured by prepulse inhibition, and impaired social recognition. NPAS1/NPAS3-deficient mice also exhibited stereotypic darting behavior at weaning and increased locomotor activity.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,protein binding,protein heterodimerization activity,protein dimerization activity	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Neurodevelopmental Disorders	X A7.3|X 37.63 cM	Overexpression	NA	15351775	73	Expeimentalparadigm: Light-dark box test//Open field test//Dowel crossings//Rotarod//Fear conditioning test  /n  Model Generation: PAC671D9 DNA was digested with<U+00A0>NotI. The ～99<U+2005>kb insert was separated from vector on a pulse-field gel. The fragment was cut out and the gel was digested with GELase enzyme (Epicentre) and purified on a Centricon 100 column (Millipore Corporation). The DNA was then washed off the column with microinjection buffer (10<U+2005>mM<U+00A0>Tris pH 8.0; 0.1<U+2005>mM<U+00A0>EDTA), and was injected into FVB single cell zygotes at concentrations of 0.4 and 0.8<U+2005>ng/μl using standard procedures.  /n  Rescue: -  /n  Model Summary: Surprisingly, these mice displayed enhanced motor and contextual learning and enhanced synaptic plasticity in the hippocampus. After 20<U+2005>weeks of age, however, these mice developed seizures, became hypoactive and ～30% of them died by 1<U+2005>year of age.Furthermore, these results support the possibility that duplications or gain-of-function mutations in MECP2 might underlie some cases of X-linked delayed-onset neurobehavioral disorders.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Obsessive Compulsive Disorder	13 C1|13 40.1 cM	Knockdown	129 Sv/J	15710042	74	Expeimentalparadigm: Grooming  /n  Model Generation: DAT-KD<U+00A0>mutant mice (n = 12 male) and wild-type control mice (n = 12 male) were generated at the University of Chicago by breeding heterozygous mutants on a 129 Sv/J genetic background.DAT knockdown was achieved by insertion of the tetracycline regulatable system into the 5' untranslated region in the second exon of the DAT gene (Slc6a3).  /n  Rescue: -  /n  Model Summary: Elucidation of the basis for sequential super-stereotypy of instinctive behavior in DAT knockdown mutant mice may offer insights into neural mechanisms of overly-rigid sequences of action or thought in human patients with disorders such as Tourette's or OCD.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6	15814105	75	Expeimentalparadigm: Light-dark box test  /n  Model Generation: Experiments were carried out on male NK1-/- (‘knock-out’) and NK1+/+ (wildtype) mice, weighing 25–31 g (i.e. about 6–7 weeks of age). Mice were derived from a 129/Sv × C57BL/6 genetic background (De Felipe et al., 1998) that had been crossed with an outbred MF1 strain (Harlan OLAC, Bicester, UK).  /n  Rescue: -  /n  Model Summary: In behavioural screens, mice lacking functional NK1 receptors (NK1-/-) resemble wildtypes (NK1+/+) that have been given an antianxiety/antidepressant drug. Most, if not all, antidepressants increase noradrenergic transmission in the brain. Here, we have used in vivo microdialysis to compare the concentrations of extracellular noradrenaline ('efflux') in the cerebral cortex of anaesthetised NK1-/- and NK1+/+ mice. The effects of systemic administration of the antidepressant, desipramine, with and without local infusion of the alpha(2)-adrenoceptor antagonist, RX821002, were also evaluated. Finally, we compared the effects of desipramine on behaviour of NK1+/+ and NK1-/- mice in an activity chamber and in a light/dark exploration box. Basal noradrenaline efflux was increased 2 to 4-fold in NK1-/- mice compared with NK1+/+ mice but there was no difference in the effects of desipramine.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Crhr2	CRHR2	protein-coding	Mus musculus	ENSMUSG00000003476	CRF-R2|CRFR2alpha|CRFR2beta|Crfr2	12922	Aggressive Behaviors	6 B3|6 27.33 cM	Knockout	C57BL/6	15836912	76	Expeimentalparadigm: Maternal aggression and pup retrieval testing//Elevated plus maze//Intermale aggression testing  /n  Model Generation: Mice were constructed as previously reported [4]. Briefly, the gene locus was identified in a 129 genomic library and the deficiency was targeted into C57BL/6 blastocysts. Chimera males were then outcrossed to C57BL/6 females. Heterozygote CRFR2 (±) mice (a kind gift of Dr. Wylie Vale, Salk Institute) were bred to produce WT and knockout KO mice used in this study.  /n  Rescue: -  /n  Model Summary: Recent work indicates that mice deficient in CRF receptor 2 (CRFR2) display increased anxiety-like behaviors, have a hypersensitive stress response, and overproduce CRF. In this study, we examined both maternal and intermale aggression in wild-type (WT) and CRFR2-deficient mice. CRFR2-mutant mice exhibited significant deficits in maternal aggression on postpartum Day 4 relative to WT mice in terms of percentage displaying aggression, mean number of attacks, and mean time in aggressive encounters. However, time sniffing male intruder, pup retrieval, number of pups, and performance on the elevated plus maze were similar between genotypes. In contrast, intermale aggression did not differ between genotype in any measure on any of three consecutive test days. For neither form of aggression did sites of attacks on the intruder differ between genotype.	transmembrane signaling receptor activity,G protein-coupled receptor activity,hormone activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,corticotropin-releasing hormone receptor activity	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Panic Disorder	13 D1|13 56.92 cM	Knockout	129/Sv;C57BL/6J;CBA/J	15920501	77	Expeimentalparadigm: Light–dark box test//Novel object recognition//Vogel lick-suppression test//Fear conditioning  /n  Model Generation: Adult male 5-HT1AR KO and age-matched WT mice were generated as described previously (Gross et al, 2002). To create a mouse in which 5-HT1AR expression can be directed to specific tissues in a temporally controlled manner, we designed an inducible knockout allele in which transcription of the receptor is blocked by a stop cassette inserted into the 5′ leader sequence of the gene and in which tetO binding sites are introduced upstream of the receptor coding sequence. The tetO binding sites allow the receptor messenger RNA in these otherwise knockout mice to be induced in the presence of the bacterial transcription factor, tTA. Forebrain-specific expression of the 5-HT1A receptor is achieved by crossing these mice with a transgenic mouse expressing tTA under control of the α-calcium-calmodulin-dependent protein kinase II (αCaMKII) promoter9 (Fig. 1a).  /n  Rescue: -  /n  Model Summary: Serotonin 1A receptor knockout (5-HT1AR KO) mice exhibit increased behavioral inhibition in conflict tests. To gain further insight into their anxiety-related phenotype, we subjected these mice to additional behavioral tests. First, we considered whether behavioral inhibition in these knockout mice is a consequence of reduced exploratory motivation. The knockout mice engage in normal exploration during a light-dark test and normal exploration of a novel object in a familiar environment, suggesting that the anxiety-related phenotype is not due to reduced exploratory drive. Second, we tested whether these mice exhibit increased behavioral inhibition in response to any aversive cues, or whether this response depends on cue modality. Knockout mice respond normally to discrete aversive cues in the Vogel lick-suppression test, arguing that their phenotype is restricted to conflict tests based on complex or spatial aversive cues. Third, to probe the processing of spatial aversive cues, we assessed fear conditioning to contextual cues. After contextual fear conditioning, knockout and wild-type (WT) mice express freezing responses when exposed to the training environment. However, when placed in an ambiguous environment containing both conditioned and novel cues, the freezing response of knockout mice does not significantly decrease as it does in WT mice, suggesting that the knockout fear response is biased toward threatening cues.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
Dbh	DBH	protein-coding	Mus musculus	ENSMUSG00000000889	-	13166	Aggressive Behaviors	2 A3|2 19.29 cM	Knockout	C57BL/6J;129/SvEv	15922045	78	Expeimentalparadigm: Elevated plus maze//Light-dark test//Open field test//Social recognition//Social discrimination//Resident–intruder test  /n  Model Generation: Dbh -/- mice, maintained on a mixed 129/SvEv and C57Bl6/J background, were developed and generated as previously described [19], [20]. Dbh +/- mice have normal catecholamine levels and are indistinguishable from WT littermates for all previously tested phenotypes [7], [21], [23].  /n  Rescue: -  /n  Model Summary: The neurotransmitter noradrenaline (NA) has been implicated in some of these disorders, as well as in several aspects of social behavior in humans and animals. We tested dopamine beta-hydroxylase knockout (Dbh -/-) mice that lack NA in various social behavior paradigms. Dbh -/- mice have relatively normal performance in the elevated plus maze, light/dark box, and open field test - three measures of anxiety - and a social recognition test. In contrast, Dbh -/- mice displayed a specific deficit in a social discrimination task and had a nearly complete absence of resident-intruder aggression.	catalytic activity,monooxygenase activity,dopamine beta-monooxygenase activity,copper ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen,L-ascorbic acid binding,metal ion binding	Ani
Oxt	OXT	protein-coding	Mus musculus	ENSMUSG00000027301	OT|Oxy	18429	Aggressive Behaviors	2 F1|2 63.24 cM	Knockout	129/Sv;Black Swiss	15924555	79	Expeimentalparadigm: Feeding challenge//Semi-natural environment  /n  Model Generation: A total of 18 female OTKO and 18 of their WT littermates were used for this study which was carried out across three experiments (six OTKO and six WT mice for each experiment), across all four seasons and over a 24-month time period. Knockout mice (originally of a mixed 129/Sv<U+2003>×<U+2003>Black Swiss outbred strain) were generated through the deletion of the entire OT-neurophysin 1 coding region and demonstrated appropriate expression of the adjacent vasopressin (VP) gene (Gross et al. 1998). Mice were maintained in a breeding colony at The Rockefeller University, the original breeding stock having been obtained from Washington University School of Medicine (provided by Dr L. J. Muglia, Washington University). We established matings between male and female heterozygotes to obtain the mice used in these experiments, with genotype being confirmed by polymerase chain reaction (PCR) amplification of tail DNA. In general, we followed previously established procedures of our laboratory (Ogawa et al. 1996) for maintaining our colonies. The controls were WT littermates.  /n  Rescue: -  /n  Model Summary: An important component of the current experiments was to assay OT-knockout (OTKO) and wild-type (WT) littermate control mice living under controlled stressful conditions designed to mimic more closely the environment for which the mouse genome evolved. Furthermore, our experimental group was comprised of an all-female population, in contrast to previous studies which have focused on all-male populations. Our data indicated that aggressive behaviors initiated by OTKO during a food deprivation feeding challenge were considerably more intense and diverse than aggressive behaviors initiated by WT. From the measures of continuous social interaction in the intruder paradigm, it emerged that OTKO mice were more offensively aggressive (attacking rumps and tails) than WT. In a test of parental behaviors, OTKO mice were 100% infanticidal while WT were 16% infanticidal and 50% maternal. Finally, 'alpha females' (always OTKO) were identified in each experiment. They were the most aggressive, the first to feed and the most dominant at nesting behaviors. Semi-natural environments are excellent testing environments for elucidating behavioral differences between transgenic mice and their WT littermates which may not be ordinarily discernible.	hormone activity,neuropeptide hormone activity,neurohypophyseal hormone activity,oxytocin receptor binding	Ani
gskt	GSK3B	protein-coding	Drosophila melanogaster		BEST:GH16447|BcDNA:AT21229|CG11338|CG31003|CT4237|Dm Gskt|Dmel\CG31003|GSK-3b|GSK3b|Gsk3b|Gskt|NEST:bs22e06|NGSK|mjl	318552	Bipolar Disorder	100C2-100C2|3-102 cM	Overexpression	pdfGAL4:UASsgg	15956996	80	Expeimentalparadigm: Locomotion test  /n  Model Generation: We generated the pdfGAL4:UASsgg animals by crossing the pdfGAL4 carrying animals (Park et al, 2000) with UASsgg flies (obtained from Bloomington Stock Center) and choosing progeny that carried both constructs.  /n  Rescue: We show that lithium partially rescues the shortening of circadian period when the GSK-3beta gene is overexpressed only in specific circadian pacemaker neurons, thus implicating GSK-3beta as a component in lithium's effect on the circadian oscillator.  /n  Model Summary: We have expanded the study of signaling mechanisms of lithium and valproate by using Drosophila circadian locomotor activity as a robust behavioral assay that is amenable to genetic manipulations. We demonstrate that lithium affects the circadian system of Drosophila similarly to what has been reported in the mammalian studies. We show that lithium and valproate share effects on the circadian locomotor activity of Drosophila: they lengthen the period of circadian rhythms and increase arrhythmicity. Valproate exerts these effects in a weaker fashion than does lithium. We also tested the circadian alterations in multiple mutant lines of Drosophila bearing defects in the GSK-3beta gene and other clock genes in response to lithium administration.	protein serine/threonine kinase activity,ATP binding	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Bipolar Disorder	5 C3.3|5 40.63 cM	Mutated	NA	15967985	81	Expeimentalparadigm: Locomotiontion test//Response to novelty//24 hour activity//Locomotor responses to cocaine//Conditioned place preference  /n  Model Generation: Homozygous Clock mutant mice (Clock/Clock) and their wild-type (+/+) littermates were used in all experiments.  /n  Rescue: -  /n  Model Summary: Here we establish a role for the Clock gene in regulating the brain's reward circuit. Mice lacking a functional Clock gene display an increase in cocaine reward and in the excitability of dopamine neurons in the midbrain ventral tegmental area, a key brain reward region. These phenotypes are associated with increased expression and phosphorylation of tyrosine hydroxylase (the rate-limiting enzyme in dopamine synthesis), as well as changes in several genes known to regulate dopamine activity in the ventral tegmental area. These findings demonstrate the involvement of a circadian-associated gene, Clock, in regulating dopamine function and cocaine reward.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
Thrb	THRB	protein-coding	Mus musculus	ENSMUSG00000021779	Nr1a2|T3R[b]|T3Rbeta|Thrb1|Thrb2|c-erbAbeta	21834	Attention-Deficit/Hyperactivity Disorder	14|14 A1	Knockin	C57BL/6J	15983791	82	Expeimentalparadigm: Locomotion test//Response acquisition//Vigilance task  /n  Model Generation: TRβPV knock-in (KI) mice (Kaneshige et al. 2000) and wild-type littermate controls were maintained on a 129× Black Swiss background. A TRβ mouse genomic clone was isolated from an ES-129 P1 Library (Genome Systems, St. Louis) by using primers specific for the TRβ gene. The clones were microinjected into C57BL/6J blastocysts to produce chimeras, which were crossed with NIH Black Swiss mice to establish germ-line transmission (18). Mice harboring the targeted PV mutation and the NeoR gene are designated as TRβPVNeoR mice (Fig. <U+200B>(Fig.11C).  /n  Rescue: -  /n  Model Summary: The TRbetaPV KI mice are hyperactive and have learning deficits on a vigilance task. Doses of MPH that impair the vigilance performance of wild-type mice do not affect the performance of the TRbetaPV KI mice.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,transcription coactivator binding,DNA binding,chromatin binding,double-stranded DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,zinc ion binding,enzyme binding,chromatin DNA binding,identical protein binding,sequence-specific DNA binding,metal ion binding,thyroid hormone binding,sequence-specific double-stranded DNA binding	Ani
Bcl2	BCL2	protein-coding	Mus musculus	ENSMUSG00000057329	Bcl-2|C430015F12Rik|D630044D05Rik|D830018M01Rik	12043	Bipolar Disorder	1 E2.1|1 49.76 cM	Mutated	129S1/SvImJ-Bcl2tm1Mpin/J	16095731	83	Expeimentalparadigm: Open field test//Elevated plus maze//Emergence test//Black-white box test//Forced swim test  /n  Model Generation: Male Bcl-2 heterozygote mice and colony littermates Wild Type controls (Strain Name: 129S1/SvImJ-Bcl2tm1Mpin/J) originally developed by Dr. S.J. Korsmeyer [64] were purchased from Jackson Laboratories (Jackson Laboratories, ME). We chose not to use null mutants because they were reported to have retarded growth, a variety of peripheral disorders and they die at young age [64] and accordingly are not appropriate for behavioral studies whereas clear pathologies were not reported for the heterozygote animals [41], [64]. Breeding was not performed in our lab and the source of all mice was Jackson Labs and all details are available at their web site at www.jax.org.  /n  Rescue: -  /n  Model Summary: We have, therefore, explored the significance of Bcl-2 in the association between mitochondrial function and affective disorders testing Bcl-2 heterozygote mice in models of affective and anxiety disorders. Mutant mice have reduced mitochondrial Bcl-2 levels, and although they have no gross behavioral abnormalities, they demonstrate a significant increase of anxiety-like behaviors. Bcl-2 heterozygote mice spent less time in the center of an open field, spent less time outside an enclosure in the "emergence test", were less likely to explore the transparent part of a black/white box or the open arms of an elevated plus maze compared with WT controls. Mutant mice did not differ from WT in measures of locomotion or in the forced swim test for depression-like behavior suggesting a specific effect on anxiety-like behaviors. Our study, therefore demonstrates that Bcl-2 may be a key factor in anxiety disorders and that its effects may possibly originate from its role in the mitochondria.	protease binding,protein binding,transcription factor binding,channel activity,channel inhibitor activity,protein phosphatase binding,ubiquitin protein ligase binding,identical protein binding,protein homodimerization activity,protein-containing complex binding,protein heterodimerization activity,BH domain binding,BH3 domain binding,protein phosphatase 2A binding,molecular adaptor activity,DNA-binding transcription factor binding	Ani
Cnr1	CNR1	protein-coding	Mus musculus	ENSMUSG00000044288	CB-R|CB1|CB1A|CB1B|CB1R	12801	Alcohol Use Disorder	4 A5|4 16.28 cM	Knockout	CD1	16140402	84	Expeimentalparadigm: Conditioned place preference//Ethanol self-administration//Two-bottle choice paradigm  /n  Model Generation: Adult male (N<U+00A0>=<U+00A0>29) CB1 transgenic mice (CD1 strain, obtained from C. Ledent in Universite libre de Bruxells, Belgium) [31] were individually housed in a 12/12<U+00A0>h reverse light/dark cycle, as well as a temperature and humidity controlled room.  Briefly, using the 129/Sv mouse genome library, the CB1 gene was cloned and the single coding exon was mapped and sequenced.<U+00A0>  /n  Rescue: -  /n  Model Summary: Ethanol self-administration and ethanol conditioned place preference are reduced in mice lacking cannabinoid CB1 receptors	G protein-coupled receptor activity,cannabinoid receptor activity,identical protein binding	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Transchromosomic	Tc(Hsa21)1TybEmcf;C57BL/6Jx129S8	16179473	85	Expeimentalparadigm: Novel object recognition test//T-maze//Open field test  /n  Model Generation: We took the approach of reproducing the human-mouse transchromosomic cell lines on a female background, through further rounds of XMMCT into the female MPI VI ES cell line (16). We analyzed the resultant transchromosomic ES cell lines for human DNA content, using fluorescence in situ hybridization (FISH) to detect Hsa21 and reverse FISH to detect other human chromosomes (12). To generate transchromosomic chimeras, ES cells were injected into host blastocysts and the resulting chimeras were mated to mice from the C57BL/6J strain. Germline transmission was achieved from one female chimera, carrying the 91-1 transchromosomic ES cell line. This chimera had only one litter of two pups, a male (Tc1-01) and a female (Tc1-02). These progeny both retained a freely segregating Hsa21 with the same Hsa21 profile as the parental ES cell line, 91-1 (Fig. 1A and fig. S1B). This transchromosomic mouse strain was designated Tc(Hsa21)1TybEmcf, hereafter referred to as Tc1 (18). In an attempt to establish the Tc1 strain on a number of genetic backgrounds, mouse Tc1-01 was mated either to mice that were an F1 hybrid between C57BL/6J and 129S8 mice [F1(C57BL/6Jx129S8)] or to inbred BALB/c, C3H/He, and C57BL/6J mice.  /n  Rescue: -  /n  Model Summary: Aneuploidies are common chromosomal defects that result in growth and developmental deficits and high levels of lethality in humans. To gain insight into the biology of aneuploidies, we manipulated mouse embryonic stem cells and generated a trans-species aneuploid mouse line that stably transmits a freely segregating, almost complete human chromosome 21 (Hsa21). This "transchromosomic" mouse line, Tc1, is a model of trisomy 21, which manifests as Down syndrome (DS) in humans, and has phenotypic alterations in behavior, synaptic plasticity, cerebellar neuronal number, heart development, and mandible size that relate to human DS. Transchromosomic mouse lines such as Tc1 may represent useful genetic tools for dissecting other human aneuploidies.	NA	Ani
Slc1a1	SLC1A1	protein-coding	Mus musculus	ENSMUSG00000024935	D130048G10Rik|EAAC1|EAAC2|EAAT3|MEAAC1	20510	Obsessive Compulsive Disorder	19|19 C1	Knockout	CD-1	16311588	86	Expeimentalparadigm: Open field test//Morris water maze  /n  Model Generation: A λgt10 rat brain cDNA library (Storck et al., 1992) was screened with a 642 bp PCR fragment that had been obtained using the 5′ pool primer AATCTGGTAGAAGCCTGCTTTAAACAG and the 3′ pool primer ACCATAACATGGATGGGACCGCCC. A full-length 2048 bp rat EAAC-1 cDNA clone was isolated. After radiolabeling, this rat EAAC–1 cDNA was used to screen a Balb/c mouse genomic library (Clontech ML1040j) (Sambrook et al., 1989). Three overlapping genomic clones were isolated and the eaac-1 organization was established by restriction mapping. Eight of the exons were sequenced. The EAAC-1 targeting vector pEAAC-1KO contained a 7 kb XbaI restriction fragment of clone M3 with exon 1 flanked by 4 kb of genomic DNA on the 5′ side and 3 kb on the 3′ side. It was inserted into the XbaI restriction site of pBluescript SKII+. Exon 1 was disrupted by insertion of a pgk neomycin resistance gene cassette (neo) into an NarI restriction site in sense orientation. A thymidine kinase expression box was inserted into the unique NotI site of the pBluescript SKII+ 5′ of the genomic fragment. Mouse ES cells (R1 genotype, kindly provided by Dr A.Nagy, University of Toronto) were grown to 90% confluency on feeder layers of mitomycin C-treated G418-resistant mouse embryonic fibroblasts (Robertson, 1987).  Blastocysts of C57BL/6 and CD1 females were injected with 10–25 cells of targeted clones, and groups of 5–14 blastocysts were transferred into pseudopregnant CD1 females as described (Bradley et al., 1984; Hogan et al., 1986). Chimeric male offspring were mated to C57BL/6 or CD1 females, according to the origin of the blastocysts. We monitored germline transmission of the injected ES cells by the inheritance of agouti coat color. Heterozygous and homozygous offspring were identified by Southern blotting, as described for ES cells, as well as PCR analysis of tail DNA. The positions of the two oligonucleotide primers were chosen to yield a 250 bp PCR fragment with the wild type and a 1.2 kb fragment with exon 1 disrupted by the neo cassette, for the mutant template.  /n  Rescue: These changes were reversed by treating the EAAC1(-/-) mice with N-acetylcysteine, a membrane-permeable cysteine precursor.  /n  Model Summary: Neurons also express a glutamate transporter, termed excitatory amino acid carrier-1 (EAAC1), but the physiological function of this transporter remains uncertain. Here we report that genetically EAAC1-null (Slc1a1(-/-)) mice have reduced neuronal glutathione levels and, with aging, develop brain atrophy and behavioral changes.	anion channel activity,L-glutamate transmembrane transporter activity,high-affinity L-glutamate transmembrane transporter activity,protein binding,chloride transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,L-aspartate transmembrane transporter activity,symporter activity,glutamate:sodium symporter activity,glutamate binding,cysteine transmembrane transporter activity,identical protein binding,metal ion binding,D-aspartate transmembrane transporter activity	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Transgene	C57BL/6NCrjBgi	16455265	87	Expeimentalparadigm: Morris water maze  /n  Model Generation: Standard microinjection procedures were used for transgenic mice production (Macrogen, Seoul, Korea). Briefly, fertilized mouse eggs were flushed from the oviducts of superovulated C57BL/6NCrjBgi mice, and male pronuclei were injected with 777J19 BAC DNA (2 ng/μl) that had been linearized with the PI SceI enzyme at its cognate restriction site located in the pBACe3.6 vector. The injected eggs were reimplanted in the oviducts of pseudo-pregnant ICR recipient females. At 3 weeks of age, the animals were tested for the presence of the transgene by PCR analysis of their genomic DNA using the following three primer pairs: 1. T7 (5′-TAATACGACTCACTATAGGG) and 777J19 T7 (5′-ATAATTTCATAAATTTTCCCAG) for the T7 side. 2. SP6 (5′-ATTTAGGTGACACTATAG) and 777J19 SP6 (5′-TTAAACTGGTCCAGGTCTGG) for the SP6 side. 3. internal-F (5′-GGAGCAGTTACTTTACTTAAATC) and internal-R (5′-CACAACACAAAACAATACAACTG) for the internal sequence. PCR conditions were as follows: initial incubation, 94°C for 5 min (one time); cycle conditions, 94°C for 30 s, annealing temperature for 30 s, and 72°C for 30 s (35 cycles); one final elongation for 1 min at 72°C (one time). The annealing temperatures were 52°C for the T7 and SP6 side and 57°C for the internal sequence.  /n  Rescue: -  /n  Model Summary: To study DS mental retardation, we have generated transgenic mice that contain only one copy of the complete human DYRK1A gene in a bacterial artificial chromosome. The transgenic mice showed significant impairment in hippocampal-dependent memory tasks in a Morris water maze. Interestingly, we observed shifts in both long-term potentiation and long-term depression, which suggests a role for DYRK1A in bidirectional synaptic plasticity. These mice represent the most clinically relevant DYRK1A mouse model to date and provide us a valuable tool for the in vivo study of mechanisms that underlie the learning and memory deficit in DS.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Schizophrenia	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	16476668	88	Expeimentalparadigm: Open field test//Startle response and prepulse inhibition//Elevated plus maze//Radial arm maze//T-maze//Odor discrimination//Morris water maze  /n  Model Generation: The human D2 receptor open reading frame was cloned into the pMM400 plasmid (Mayford et al., 1996) modified to carry the human growth hormone poly adenylation sequence instead of the described SV40 poly A. The NotI fragment was isolated and used to generate transgenic mice by injection into pronuclei of one-cell C57Bl/6-CBA(J) F2 oocytes, which were transferred the next day via the oviduct into pseudopregnant foster females. Transgenic founder animals were identified by Southern blots using a probe specific for the tetO promoter sequence. Progeny of founder animals were crossed with mice expressing the tTA transgene under the control of the CamKIIα promoter (Mayford et al., 1996; line B). Offspring were genotyped by independent Southern blots for tTA and tetO. For regulating tetO-driven gene expression, mice were fed doxycycline-supplemented chow (40 mg/kg, Mutual Pharmaceutical).  /n  Rescue: -  /n  Model Summary: To determine directly the behavioral and physiological consequences of increased D2R function in the striatum, we generated mice with reversibly increased levels of D2Rs restricted to the striatum. D2 transgenic mice exhibit selective cognitive impairments in working memory tasks and behavioral flexibility without more general cognitive deficits. The deficit in the working memory task persists even after the transgene has been switched off, indicating that it results not from continued overexpression of D2Rs but from excess expression during development. To determine the effects that may mediate the observed cognitive deficits, we analyzed the prefrontal cortex, the brain structure mainly associated with working memory. We found that D2R overexpression in the striatum impacts dopamine levels, rates of dopamine turnover, and activation of D1 receptors in the prefrontal cortex, measures that are critical for working memory.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Tsn	TSN	protein-coding	Mus musculus	ENSMUSG00000026374	2610034C24Rik|C3PO|TB-RBP	22099	Attention-Deficit/Hyperactivity Disorder	1|1 E2.3	Knockout	C57BL/6J	16495445	89	Expeimentalparadigm: Water maze//Cued and contextual fear conditioning//Elevated zero maze//Light-dark test//Open field test//Acoustic startle response and prepulse inhibition  /n  Model Generation: The generation of translin KO mice and their genotyping by PCR amplification of tail DNA was described previously (Chennathukuzhi et al., 2003). TB-RBP-null mice were generated from embryonic stem (ES) cells corresponding to OST 63223 (Omnibank Sequence Tag; Lexicon Genetics, Houston, Tex.) targeted by gene trapping. The gene trap vector contained a 5′ retroviral long terminal repeat (LTR), a splice acceptor, βgeo (fusion of β-galactosidase and neomycin phosphotransferase genes), a Bruton tyrosine kinase gene, and a 3′ LTR. Retroviral infection, selection, and screening of ES cells were carried out as described previously (61, 62). ES cells corresponding to OST 63223, containing the first three exons of the TB-RBP gene upstream of βgeo, as detected by 5′ rapid amplification of cDNA ends analysis, were selected for blastocyst injection into C57BL/6 mice to produce chimeric mice.  /n  Rescue: -  /n  Model Summary: Here, we report that translin knock-out mice also exhibit sex-specific differences in tests of learning and memory, locomotor activity, anxiety-related behavior, and sensorimotor gating, as well as handling-induced seizures and alterations in monoamine neurotransmitter levels in several forebrain regions. Our results in mice indicate that mutations in translin may contribute to fragile X-like syndromes, mental retardation, attention deficit hyperactivity disorder, epilepsy, and autism spectrum disorders in humans.	DNA binding,single-stranded DNA binding,RNA binding,mRNA binding,nuclease activity,endonuclease activity,protein binding,hydrolase activity,identical protein binding,sequence-specific DNA binding,protein-containing complex binding	Ani
Sry	SRY	protein-coding	Mus musculus	ENSMUSG00000069036	Tdf|Tdy	21674	Aggressive Behaviors	Y|Ypter	Knockout	C57BL/6J	16495461	90	Expeimentalparadigm: Social behavior tests//Parental behavior tests  /n  Model Generation: Mice were produced at the University of Virginia School of Medicine Animal Facility in Jordan Hall. The transgenic core cross has been described previously (De Vries et al., 2002). Briefly, the cross uses males carrying a 129/SvEv-Gpi1c Y chromosome (Simpson et al., 1997) with an 11 kb deletion removing the testis-determining gene Sry (Gubbay et al., 1992). The Sry deletion is complemented by the insertion of a fully penetrant Sry transgene [derived from the transgenic line C57BL/6Ei-YARK/JTgN(Sry-129)2Ei] located on an autosome (Mahadevaiah et al., 1993, 1998). These “XY-Sry” mice possess testes and are fully fertile. The Y-chromosome and the Sry transgene segregate independently, thus, four types of offspring are produced by mating XY-Sry males to XX females: XX females, XY- females, XY-Sry males, and XXSry males. Male and female are defined here according to the gonadal phenotype, males possess testes and females ovaries. Mice were genotyped at weaning by PCR for the YMT2/B-related Ssty subfamily family present on the Y long arm, which detects the Y- chromosome (Turner et al., 2000). For the present study, the Y- chromosome and Sry transgene were crossed onto the C57BL/6J background by breeding XY-Sry males from each generation with normal C57BL/6J XX females (The Jackson Laboratory, Bar Harbor, ME). When tested, all offspring were at least in the sixth generation of these backcrosses.  /n  Rescue: -  /n  Model Summary: To directly test the hypothesis that social behaviors are influenced by differences in sex chromosome complement other than Sry, we used a transgenic mouse model in which gonadal sex and sex chromosome complement are uncoupled. We find that latency to exhibit aggression and one form of parental behavior, pup retrieval, can be influenced by both gonadal sex and sex chromosome complement. For both behaviors, females but not males with XX sex chromosomes differ from XY. We also measured vasopressin immunoreactivity in the lateral septum, which was higher in gonadal males than females, but also differed according to sex chromosome complement. These results imply that a gene(s) on the sex chromosomes (other than Sry) affects sex differences in brain and behavior. Identifying the specific X and/or Y genes involved will increase our understanding of normal and abnormal aggression and parental behavior, including behavioral abnormalities associated with mental illness.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,calmodulin binding,DNA binding, bending,enzyme binding,sequence-specific DNA binding,DNA-binding transcription factor binding	Ani
Thrb	THRB	protein-coding	Mus musculus	ENSMUSG00000021779	Nr1a2|T3R[b]|T3Rbeta|Thrb1|Thrb2|c-erbAbeta	21834	Attention-Deficit/Hyperactivity Disorder	14|14 A1	Knockin	C57BL/6	16594981	91	Expeimentalparadigm: Locomotion test//Sustained attention//Delay discounting task  /n  Model Generation: Transgenic mice bearing the human PV mutant TR-β gene were created using the αGSU promoter, as previously described (Zhu et al. 1999). This promoter limits expression of the transgene to the pituitary. Multiple lines were created and the two lines characterized showed identical phenotypes (Zhu et al. 1999). Mice were backcrossed 12 generations or more to a C57BL6/NIH inbred background and housed by gender in tub cages in groups of 3–5.  /n  Rescue: -  /n  Model Summary: We have found that a transgenic mouse bearing a human mutant thyroid receptor (TRbeta1) expresses all of the defining symptoms of ADHD--inattention, hyperactivity, and impulsivity--as well as a 'paradoxical' response to methylphenidate (MPH). As with ADHD, the behavioral phenotypes expressed by the TRbeta transgenic mice are dynamic and sensitive to changes in environmental conditions, stress, and reinforcement. TRbeta transgenic mice are euthyroid except for a brief period during postnatal development, but the behavioral phenotypes, elevated dopamine turnover, and paradoxical response to MPH persist into adulthood. Thus, like the vast majority of children with ADHD, the TRbeta transgenic mice exhibit the symptoms of ADHD in the complete absence of thyroid abnormalities. This suggests that even transient perturbations in developmental thyroid homeostasis can have long-lasting behavioral and cognitive consequences, including producing the full spectrum of symptoms of ADHD.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,transcription coactivator binding,DNA binding,chromatin binding,double-stranded DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,zinc ion binding,enzyme binding,chromatin DNA binding,identical protein binding,sequence-specific DNA binding,metal ion binding,thyroid hormone binding,sequence-specific double-stranded DNA binding	Ani
Crhr1	CRHR1	protein-coding	Mus musculus	ENSMUSG00000018634	CRF1R|CRFR1|Crhr	12921	Aggressive Behaviors	11 E1|11 67.77 cM	Knockout	C57BL/6	16621057	92	Expeimentalparadigm: Intermale aggression testing//Elevated plus maze  /n  Model Generation: CRFR1-deficient male mice in an inbred C57BL/6 background [35] were produced by crossings of heterozygote CRFR1 (+/-) mice (The Jackson Laboratory, Bar Harbor, ME). Mutant males were then crossed with females (outbred hsd:ICR strain) selectively bred to exhibit high levels of maternal aggression. Heterozygote CRFR1 (+/-) mice (with mixed inbred and outbred backgrounds) were then bred to produce WT and knockout KO male mice used in this study.  /n  Rescue: -  /n  Model Summary: CRF receptor 1 (CRFR1) is the primary receptor for CRF and in this study, we examined in detail isolation-induced intermale aggression in CRFR1 deficient mice. All mice contained a mixed 50:50 inbred/outbred background to improve aggressive performance. Mice were isolated for 4 weeks prior to 2 consecutive days of aggression testing using the resident-intruder paradigm. Mice were also tested for anxiety on the elevated plus maze. Relative to littermate wild-type (WT) controls, CRFR1-mutant mice exhibited normal levels of intermale aggression over the 2 test days in terms of percentage showing aggression, number of attacks, time aggressive, and latency to first attack. In terms of sites of attacks on intruders, CRFR1-deficient mice attacked the ventral portion of the mid-section (including belly) significantly less frequently than WT males on test day 1, but these differences did not reach significance on test day 2. No other differences in sites of attacks were observed. Tail rattling also did not differ between groups. Importantly, KO males showed decreased anxiety relative to WT mice (consistent with previous reports) as evidenced by spending significantly more time on the open arms and significantly less time on the closed arms of the elevated plus maze. Plus maze performance did not correlate with any measure of levels of aggression, suggesting a dissociation between altered levels of anxiety and aggressive performance.	G-protein alpha-subunit binding,transmembrane signaling receptor activity,G protein-coupled receptor activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,peptide binding,corticotropin-releasing hormone receptor activity,protein-containing complex binding,corticotropin-releasing hormone binding	Ani
Esr1	ESR1	protein-coding	Mus musculus	ENSMUSG00000019768	ER|ER-alpha|ERa|ERalpha|ESR|Estr|Estra|Nr3a1	13982	Aggressive Behaviors	10 A1|10 2.03 cM	Knockout	C57Bl/6J;129	16623843	93	Expeimentalparadigm: Aggressive behaviour tests//Sexual behaviour tests  /n  Model Generation: One hundred and forty-five male βERKO mice and their WT littermates were used. They were obtained from the breeding colony maintained at the Rockefeller University by mating heterozygous mice. Original breeding pairs (mixed background of C57BL/6J and 129) were obtained from the National Institute of Environmental Health Sciences. Genotyping of tail DNA was accomplished by using PCR with primers from intron<U+2003>2 (5′-GTGATGAGCTGAGGTGGTGCTT-3′), the 3′ end of the Neo (5′-GCAGCCTCTG TTCCACATACA-3′) and exon<U+2003>3 (5′-CATCCTTCACAGGACCAGACAC-3′); a 1435-bp band (intron2 and exon<U+2003>3 primers) is amplified for homozygous wild-type (+/+) mice, a 1479-bp band (intron2 and Neo primers) for homozygous mutant mice, and both bands for heterozygous (+/–) mice.  /n  Rescue: -  /n  Model Summary: In the present study, the roles of ER-beta activation in the regulation of aggressive and sexual behaviour were investigated in gonadectomized ER-beta knockout (betaERKO) and wild-type (WT) male mice treated with various doses of estrogen. Overall, estradiol benzoate (EB) treatment induced higher levels of aggression in betaERKO mice than in WT mice. In WT mice, the levels of aggression induced by EB were highest in the lowest-dose (2.5 microg/day) group and gradually decreased in higher-dosage groups. On the other hand, equally high levels of aggressive behaviour were induced by all three doses of EB in betaERKO mice. A marked genotype difference in dose responses is inferred, such that the ER-alpha-mediated facilitatory action of estrogen is more pronounced at lower and physiological doses and the ER-beta-mediated inhibitory action is only unveiled at higher doses of estrogen. In contrast to aggression, the levels of sexual behaviour induced by EB were not different between betaERKO and WT at either dose of EB (2.5 and 12.5 microg/day) examined.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,TFIIB-class transcription factor binding,transcription coregulator binding,transcription corepressor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,beta-catenin binding,transcription factor binding,zinc ion binding,lipid binding,TBP-class protein binding,enzyme binding,protein kinase binding,nuclear estrogen receptor activity,nuclear estrogen receptor binding,type 1 metabotropic glutamate receptor binding,estrogen response element binding,phosphatidylinositol 3-kinase regulatory subunit binding,hormone binding,identical protein binding,sequence-specific DNA binding,protein-containing complex binding,metal ion binding,ATPase binding,sequence-specific double-stranded DNA binding,promoter-specific chromatin binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	C57BL/6J	16638606	94	Expeimentalparadigm: Acoustic startle  /n  Model Generation: NR1+/+ (N = 70) and NR1-/- (N = 55) mice were generated from heterozygous breeder pairs, as previously described (Mohn et al., 1999, Duncan et al., 2004). Briefly, subjects were male and female F1 hybrid mice, generated by the intercross of NR1 129/Ola+/- female mice with NR1 C57BL/6+/- males. The 129+/- are co-isogenic for the NR1 mutation. The C57BL/6 +/- mice were generated by twelve generations of backcrossing to C57BL/6J (The Jackson Laboratories, Bar Harbor, Maine).  /n  Rescue: -  /n  Model Summary: The results showed that mice with reduced NMDA receptor function demonstrated consistent deficits in prepulse inhibition (PPI), as well as higher startle response amplitudes. In comparison to normal controls, the NR1-/- mice were more sensitive to the disruptive effects of amphetamine on PPI, but not to the drug effects on startle magnitude without a prepulse stimulus. Wild-type mice only showed decreased PPI at the highest dose of amphetamine tested (10 mg/kg) and demonstrated small increases in PPI at lower amphetamine doses (2 and 6 mg/kg). The NR1-/- mice did not show enhanced PPI in response to amphetamine at low doses, with reductions in PPI apparent at doses of 4-10 mg/kg.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Pten	PTEN	protein-coding	Mus musculus	ENSMUSG00000013663	2310035O07Rik|A130070J02Rik|B430203M17Rik|MMAC1|PTENbeta|TEP1	19211	Autism Spectrum Disorder	19 C1|19 28.14 cM	Conditional Knockout	C57BL/6	16675393	95	Expeimentalparadigm: Social interaction and memory//Nest building test//Olfactory//Novelty object recognition test//Caged social interaction test//Social preference test//Open field test//Elevated plus maze//Dark-light box test//Locomotor activity//Rotarod//Fear conditioning test//Startle reflex//Prepulse inhibition//Vertical pole//Dowel test//Morris water maze//Sexual behavior  /n  Model Generation: PtenloxP mice were a gift from Tak Mak (University of Toronto), and Rosa26R mice were from Jackson Lab (Bar Harbor, ME). Tominimize transgenic variation due to genetic background, we maintained Nse-cre; Rosa26R or PtenloxP mice in C57/BL6 inbred background for at least three generations. For BrdU chasing, we injected subsets of 2-week-old cre; Rosa26R mice with BrdU as described (Fraser et al., 2004) and sacrificed them 1 day or 4 weeks after the injection. Mutant mice (cre; PtenloxP/loxP) were born from breeding between PtenloxP/loxP mouse and cre; PtenloxP/+ mouse or between cre; PtenloxP/+ mice.  /n  Rescue: -  /n  Model Summary: PTEN mutations in individuals with autism spectrum disorders (ASD) have also been reported, although a causal link between PTEN and ASD remains unclear. In the present study, we deleted Pten in limited differentiated neuronal populations in the cerebral cortex and hippocampus of mice. Resulting mutant mice showed abnormal social interaction and exaggerated responses to sensory stimuli. We observed macrocephaly and neuronal hypertrophy, including hypertrophic and ectopic dendrites and axonal tracts with increased synapses. This abnormal morphology was associated with activation of the Akt/mTor/S6k pathway and inactivation of Gsk3beta.	phosphatidylinositol-3-phosphate phosphatase activity,phosphoprotein phosphatase activity,protein serine/threonine phosphatase activity,protein tyrosine phosphatase activity,platelet-derived growth factor receptor binding,protein binding,anaphase-promoting complex binding,phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity,hydrolase activity,phosphatase activity,myosin phosphatase activity,enzyme binding,protein kinase binding,PDZ domain binding,ionotropic glutamate receptor binding,identical protein binding,inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity,phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity,molecular function inhibitor activity,ubiquitin-specific protease binding,protein tyrosine kinase binding	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Intellectual Disability	X A7.1|X 34.83 cM	Knockout	C57BL/6	16675531	96	Expeimentalparadigm: Open field test//Light–dark test//Acoustic startle reflex//Pre pulse inhibition//Open field test//Rotarod//Pavlovian conditioned fear//Hot plate test  /n  Model Generation: Subjects were derived from a two-step breeding process. First, crosses between Fmr1 KO ( Fmr1-/y ) mice ( 36 ) and Fxr2 KO ( Fxr2-/- ) mice ( 37 ), both on C57BL/6 genetic backgrounds, were used to generate Fmr1+/-Fxr2+/- females and Fxr2+/- males. These mice were bred to obtain 52 male littermates representing all of the genotypes analyzed in this study (16 Fmr1-/y , 12 Fxr2-/- , 10 Fmr1-/yFxr2-/- and 14 Fmr1+/yFxr2 wild-type control mice).  /n  Rescue: -  /n  Model Summary: Results show that Fmr1/Fxr2 double KO mice have exaggerated behavioral phenotypes in open-field activity, prepulse inhibition of acoustic startle response and contextual fear conditioning when compared with Fmr1 KO mice, Fxr2 KO mice or wild-type littermates. Our findings suggest that Fmr1 and Fxr2 genes contribute in a cooperative manner to pathways controlling locomotor activity, sensorimotor gating and cognitive processes.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Fxr2	FXR2	protein-coding	Mus musculus	ENSMUSG00000018765	Fxr2h	23879	Intellectual Disability	11 B3|11 42.86 cM	Knockout	C57BL/6	16675531	97	Expeimentalparadigm: Open field test//Light–dark test//Acoustic startle reflex//Pre pulse inhibition//Open field test//Rotarod//Pavlovian conditioned fear//Hot plate test  /n  Model Generation: Subjects were derived from a two-step breeding process. First, crosses between Fmr1 KO ( Fmr1-/y ) mice ( 36 ) and Fxr2 KO ( Fxr2-/- ) mice ( 37 ), both on C57BL/6 genetic backgrounds, were used to generate Fmr1+/-Fxr2+/- females and Fxr2+/- males. These mice were bred to obtain 52 male littermates representing all of the genotypes analyzed in this study (16 Fmr1-/y , 12 Fxr2-/- , 10 Fmr1-/yFxr2-/- and 14 Fmr1+/yFxr2 wild-type control mice).  /n  Rescue: -  /n  Model Summary: Results show that Fmr1/Fxr2 double KO mice have exaggerated behavioral phenotypes in open-field activity, prepulse inhibition of acoustic startle response and contextual fear conditioning when compared with Fmr1 KO mice, Fxr2 KO mice or wild-type littermates. Our findings suggest that Fmr1 and Fxr2 genes contribute in a cooperative manner to pathways controlling locomotor activity, sensorimotor gating and cognitive processes.	nucleic acid binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,identical protein binding,protein homodimerization activity,translation regulator activity,protein heterodimerization activity	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Aggressive Behaviors	2 E3|2 56.63 cM	Conditional Knockout	NA	16844311	98	Expeimentalparadigm: Locomotion test//Resident–intruder test//Tail suspension test//Porsolt forced swim test//Elevated plus maze  /n  Model Generation: BDNF2L/2LCk-Cre mutants were generated as previously described (Rios et al., 2001). BDNF2L/1LNes-cre mutant mice were generated by crossing BDNF2L/2L mice with a line of mice carrying the nestin-cre recombinase transgene (Bates et al 1999, Trumpp et al 1999). For the generation of floxed BDNF mice, a targeting construct was designed in which exon 5, the single coding exon in the BDNF gene, was flanked by lox P sites (Fig. 1a). A cytomegalovirus-hygromycin-thymidine kinase selection cassette flanked by lox P sites was also introduced downstream of exon 5. This targeting construct was introduced into J1 embryonic stem (ES) cells by electroporation, and selected homologous integrant clones were transiently transfected with a cre recombinase-containing vector to remove the selection cassette and generate Bdnf 2lox/ ES cell clones. These were used for the generation of Bdnf 2lox allele carrier mice. Bdnf 2lox/2lox and Bdnf 2lox/ mice were crossed to mice expressing the cre recombinase under the direction of cam kinase-cre promoter. All the animals used in these studies were of mixed background, and all studies were conducted in accord with the principles outlined in “Guidelines for Care and Use of Experimental Animals.”  /n  Rescue: -  /n  Model Summary: To further our understanding of the role of BDNF in the modulation of mood and to distinguish its prenatal and postnatal functions, we investigated and contrasted behavioral changes elicited by its depletion from fetal or postnatal brains of mice. Two corresponding lines of BDNF conditional knockout mice were subjected to a battery of behavioral tests assessing locomotor, depressive, aggressive and anxiety-related behaviors. We found that both lines of mutants were dramatically hyperactive during the light and dark cycles and hyperaggressive. They also exhibited a depression-like phenotype in the tail suspension test but not in the forced swim test. Interestingly, depletion of BDNF from the fetal brain had more pronounced effects on aggressive and depressive-like behaviors and led to deficits in 5-HT(2A) receptor content in the medial frontal cortex, highlighting the importance of this neurotrophin during development.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Intellectual Disability	X A7.1|X 34.83 cM	Knockout	C57BL/6J	16923151	99	Expeimentalparadigm: Leverpress escape//Avoidance task  /n  Model Generation: Subjects were N12 C57/BL6J male Fmr1 KO or WT mice (littermates) derived from a colony at Baylor College of Medicine (Spencer et al., 2005).  /n  Rescue: -  /n  Model Summary: We conducted a study to assess the performance of Fmr1 KO and wildtype (WT) animals in a leverpress escape/avoidance paradigm. Fmr1 KO and WT littermates were studied in four daily 1-h sessions. The Fmr1 KO mice performed fewer avoidance and total responses than WT mice. The KO animals were not simply deficient in avoidance, but a within-factor ANOVA revealed that they did not acquire the leverpress response to any appreciable degree. Observation during the sessions indicated that the Fmr1 KO animals clearly responded to the shock, eliminating an obvious sensory explanation for the deficit. The fact that other studies have found that the KO mice displayed increased exploratory and locomotor activity compared with WT controls argues against a motoric deficit.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Gsk3b	GSK3B	protein-coding	Mus musculus	ENSMUSG00000022812	7330414F15Rik|8430431H08Rik|GSK-3|GSK-3beta|GSK3	56637	Manic Episodes	16|16 B3	Overexpression	FVB/NTac	16943560	100	Expeimentalparadigm: Open field test//Acoustic startle response//Forced swim test  /n  Model Generation: cDNA coding for human GSK-3β(S9A) (Refs. 40 and 41;<U+00A0>gift of J. Woodgett) was ligated in the adapted mouse thy1 gene (42, 43) and was microinjected into 0.5-day-old FVB/N prenuclear mouse embryos.<U+00A0>Transgenic founders were identified by Southern blotting and genotype of transgenic offspring, bred into the FVB/N genetic background, was performed on tail biopsy DNA by polymerase chain reaction.<U+00A0>The htau40 transgenic mice have been described elsewhere (42).Three founder strains, i.e. htau40-1, htau40-2, and htau40-5, which transmitted the transgene in a stable Mendelian fashion, were used to generate double transgenic mice by cross-breeding with GSK-3β(S9A) animals.<U+00A0>  /n  Rescue: -  /n  Model Summary: Transgenic mice overexpressing glycogen synthase kinase 3beta: a putative model of hyperactivity and mania	nucleotide binding,protease binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,integrin binding,protein binding,ATP binding,beta-catenin binding,kinase activity,transferase activity,protein kinase binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding,dynactin binding,ionotropic glutamate receptor binding,tau protein binding,tau-protein kinase activity,NF-kappaB binding,RNA polymerase II-specific DNA-binding transcription factor binding,dynein complex binding,protein serine kinase activity,protein serine/threonine kinase binding	Ani
Ntrk3	NTRK3	protein-coding	Mus musculus	ENSMUSG00000059146	Ntrk3_tv3|TrkC	18213	Anxiety Disorder	7 D2|7 44.01 cM	Overexpression	B6/SJL-F1J	16963267	101	Expeimentalparadigm: Locomotion test//Open field test//Elevated plus maze//Zero-maze//Light–dark box test//Mouse defense test battery  /n  Model Generation: The NTRK3 cDNA was introduced into the EcoRI site of a fragment of the rabbit β-globin gene that includes the last two exons, the last intron and an SV40 enhancer in the pBluescript plasmid. A 1.3 kb fragment of the human PDGFB chain promoter (Resnick et al., 1993) was cloned in the XbaI–HindIII of the plasmid. The β chain promoter drives efficient and specific expression in the brain (Sashara et al., 1991) contains a shear stress response element (Resnick et al., 1993) and has been subjected to deletion analysis in endothelium (Khachigian et al., 1994). The complete expression cassette was designated PDGFB-NTRK3 and was verified by sequencing with specific primers in an automated sequencer (Applied Biosystems 377). The PDGFB/NTRK3 chimeric gene used to obtain transgenic mice is shown in Fig. 1a. Transgenic mice were generated by standard pronucleus microinjection of the 6.4 kb fragment from the PDGFB-NTRK3 construct on a hybrid B6/SJL-F1J genetic background. The presence of the transgene was tested in DNA from tail biopsies by digestion with EcoRI and Southern blot analysis by using the complete NTRK3 cDNA as a probe. Three transgenic lines were obtained and were maintained by backcrossing to a B6/SJL-F1J background in heterozygosity. Genotyping was performed routinely by PCR analysis using the primer pairs: NTRK3 hum/mou-F 5′-cTGTTTGACGAAGTGAGTCCC-3′ and NTRK3 hum/mou-R 5′-TCCAGTGACGAGGGCGTG-3′. Hybrid founders were backcrossed extensively in order to attenuate littermate’s genetic differences. All experiments were performed in mice from the F16–F20 generations. In all cases, transgenic mice were directly compared with non-transgenic littermates.  /n  Rescue: Furthermore, treatment of TgNTRK3 mice with diazepam significantly attenuated the anxiety-like behaviors in the plus maze.  /n  Model Summary: Accumulating evidence has suggested that neurotrophins participate in the pathophysiology of mood disorders. We have developed transgenic mice overexpressing the full-length neurotrophin-3 receptor TrkC (TgNTRK3) in the central nervous system. TgNTRK3 mice show increased anxiety-like behavior and enhancement of panic reaction in the mouse defense test battery, along with an increase in the number and density of catecholaminergic (tyrosine hydroxylase positive) neurons in locus coeruleus and substantia nigra.	nucleotide binding,p53 binding,protein kinase activity,protein tyrosine kinase activity,transmembrane receptor protein tyrosine kinase activity,GPI-linked ephrin receptor activity,neurotrophin receptor activity,protein binding,ATP binding,kinase activity,transferase activity,neurotrophin binding	Ani
Snap25	SNAP25	protein-coding	Mus musculus	ENSMUSG00000027273	Bdr|GENA70|SNAP-25|SUP|sp	20614	Attention-Deficit/Hyperactivity Disorder	2 F3|2 67.56 cM	Mutated	Coloboma	17064920	102	Expeimentalparadigm: Locomotion test//Two-bottle preference test//Latent inhibition//DSP-4 challenge  /n  Model Generation: Coloboma (Cm/+) mice and control (+/+) C3H/HeSnJ littermates (Jackson Laboratories, Bar Harbor, Maine) were bred and housed in group cages at Johns Hopkins University vivarium (lights on at 7:00 and off at 21:00).  /n  Rescue: -  /n  Model Summary: Attention deficit hyperactivity disorder (ADHD) is characterized by hyperactivity, inattention, and impulsivity. The coloboma mouse model of ADHD exhibits profound hyperactivity. To determine whether coloboma mice exhibit other signs of ADHD, we assessed latent inhibition as a test of attention, and impulsivity in a delayed reinforcement paradigm.	SNARE binding,voltage-gated potassium channel activity,SNAP receptor activity,protein binding,lipid binding,myosin binding,syntaxin-1 binding,protein domain specific binding,syntaxin binding,transmembrane transporter binding,protein N-terminus binding,calcium-dependent protein binding,molecular adaptor activity	Ani
Avpr1a	AVPR1A	protein-coding	Mus musculus	ENSMUSG00000020123	AVPR|Avpr1|V1a|V1aR	54140	Aggressive Behaviors	10|10 D2	Knockout	129/SvJ;C57BL/6J	17083331	103	Expeimentalparadigm: Basile rotarod and hanging wire cage tests//Vision test//Circadian activity//Open field test//Elevated plus maze//Forced swim test//Sexual behavior//Hidden-cookie test//Habituation-dishabituation//olfactory discrimination task//Training for the operant task//Odor stimuli//Detection and discrimination//Social recognition//Inter-male aggression//Resident-intruder test//Neutral-cage test//Maternal aggression  /n  Model Generation: The generation of the Avpr1a-/- line has been previously described (Hu et al. 2003). Briefly, a 1.5-kb fragment of the 129/SvJ mouse Avpr1a gene was replaced with a neomycin-resistance gene using homologous recombination. The deleted fragment began 31-bp downstream of the translational start site and ended 244-bp downstream of exon 1. Founders were produced from chimeric males (from the R1 embryonic stem cell line derived from a cross of a female 129X1/SvJ and male 129S1/Sv-+p+Tyr-cKitlSl-J/+ (Nagy et al. 1993) and simply designated 129) mated with C57BL/6J females. The subjects of these experiments were an approximately equal mix of the C57BL/6J and 129 backgrounds. Non-sibling heterozygous mating pairs have continued to be set up to maintain the line. All experimental animals used for the studies described in this paper were littermates of crosses using heterozygous mice.  /n  Rescue: -  /n  Model Summary: To investigate the role of Avpr1a in behaviors in mice more extensively, we generated a line of mice lacking a functional Avpr1a (knockout, Avpr1a(-/-)). We first performed a baseline phenotypic screen of the Avpr1a knockouts followed by a more detailed analysis of their circadian rhythms and olfactory function. When free-running in constant darkness, the Avpr1a(-/-) mice have a longer circadian tau than the wild types. There are also subtle olfactory deficits in Avpr1a(-/-) mice as measured in an olfactory habituation/dishabituation test and in the discrimination of female urine from male urine using an operant testing paradigm. An extensive body of research has shown that manipulation of the Avpr1a alters behavior, including aggression and social recognition. Therefore, we expected profound behavioral deficits in mice lacking the Avpr1a gene. Contrary to our expectations, social aggression, anxiety-like behavior and social recognition are unaffected in this line of Avpr1a knockout mice.	G protein-coupled receptor activity,vasopressin receptor activity,peptide hormone binding,V1A vasopressin receptor binding,peptide binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	C57BL/6J;129S6/SvEv	17116169	104	Expeimentalparadigm: Auditory stimuli  /n  Model Generation: Genomic clones spanning the Nr1 locus were isolated from a 129/SvEv λ bacteriophage library (Stratagene, La Jolla) using Nr1 cDNA exons 11–20 as a probe and used to generate the targeting construct, Nr1neo. An 8.0 kb DNA fragment extending from the EcoRI site of intron 10 to the SmaI site of intron 20 was inserted 5′ of the neo gene at the NotI site of the vector JNS2 (Dombrowicz et al. 1993). A 2.5 kb SmaI-BamHI fragment corresponding to intron 20–intron 21 was cloned into the XbaI and BamHI sites of JNS2 with a NheI linker (New England Biolabs, Beverly, MA). Nr1neo was linearized with PvuI, electroporated into E14Tg2a ES cells (Hooper et al. 1987), and transformed cells selected in the presence of G418 and ganciclovir using methods previously described (Mohn and Koller 1995). Targeted clones were identified by Southern analysis and injected into blastocysts to generate chimeras, which were bred to B6D2 animals to obtain Nr1neo+/- animals. These wild-type and heterozygous animals were intercrossed to obtain Nr1neo +/- offspring mice, which were in turn mated to establish a breeding colony. All wild-type mice and mice homozygous for the mutant Nr1 gene were obtained from the intercross of these heterozygous animals.  /n  Rescue: -  /n  Model Summary: The goal of this study was to corroborate the involvement of the NMDAR in selective attention using a mouse model. To this end, we first investigated the presence of PN-like activity in C57BL/6J mice by recording AEPs during a fear-conditioning paradigm. Two alternating trains of tones, differing in stimulus duration, were presented on 7 subsequent days. One group received a mild foot shock delivered within the presentation of one train (conditioning train) on days 3-5 (conditioning days), while controls were never shocked. The fear-conditioned group (n= 9) indeed showed a PN-like activity during conditioning days manifested as a significant positive enhancement in the AEPs to the stimuli in the conditioning train that was not observed in the controls. The same paradigm was then applied to mice with reduced expression of the NMDAR1 (NR1) subunit and to a wild-type control group (each group n= 6). The NR1 mutants showed an associative AEP enhancement, but its magnitude was significantly reduced as compared with the magnitude in wild-type mice.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
hcrt	HCRT	protein-coding	Zebrafish	ENSDARG00000070932	-	613239	Insomnia Disorder	-	Overexpression	NA	17182791	105	Expeimentalparadigm: Locomotor activity//Behavioral state transition  /n  Model Generation: 2.4 kb fragment of Fugu rubripes genomic DNA containing 2 kb of upstream sequence, the putative<U+00A0>hcrt<U+00A0>first exon, intron, and the beginning of the second exon (Ensembl Fugu Assembly 4.0; scaffold_15 nucleotides 1450910–1453276), was amplified using the Expand High Fidelity kit (Roche). This sequence was subcloned upstream of enhanced green fluorescent protein (EGFP) and flanked by adeno-associated viral inverted terminal repeat elements (Hsiao et al., 2001) and sites recognized by the homing endonuclease I-SceI (Thermes et al., 2002). For transient expression experiments, ～20 pg of plasmid DNA was injected into embryos at the one-cell stage.  /n  Rescue: -  /n  Model Summary: Hypocretin/Orexin Overexpression Induces An Insomnia-Like Phenotype in Zebrafish	neuropeptide hormone activity,type 1 orexin receptor binding,type 2 orexin receptor binding,orexin receptor binding	Ani
Dnaaf4	DNAAF4	protein-coding	Rattus norvegicus	ENSRNOG00000056654	Dyx1c1|Edem2|Ekn1	363096	Developmental Dyslexia	8q24	Knockdown(RNAi)	NA	17259020	106	Expeimentalparadigm: Auditory processing//Spatial Learning//Morris water maze  /n  Model Generation: Transfection of<U+00A0>in utero<U+00A0>RNAi of dyx1c1 was performed by JB at the University of Connecticut. In all Dyx1c1 treatments, plasmids encoding short hairpin (pU6DyxHPB) RNA (Dyx1c1 RNAi) and plasmids encoding eGFP (green fluorescent protein) were co-transfected into the ventricular zone (VZ) by<U+00A0>in utero<U+00A0>electroporation. Sham subjects received transfection only with plasmids (pCAGGS-RFP) encoding mRFP (red fluorescent protein). Transfection occurred around E14 in time–mated dams.  /n  Rescue: -  /n  Model Summary: In conclusion,<U+00A0>in utero<U+00A0>RNAi of Dyx1c1 results in heterogeneous malformations that correspond to distinct behavioral impairments in auditory processing, and spatial learning.	protein binding,nuclear estrogen receptor binding	Ani
Avpr1b	AVPR1B	protein-coding	Mus musculus	ENSMUSG00000026432	AVPR3|V3/V1b|VIBR|VPR3	26361	Aggressive Behaviors	1|1 E4	Knockout	C57Bl/6J;129/SvJ	17284170	107	Expeimentalparadigm: Maternal aggression//Competitive aggression//Defensive aggression//Predatory aggression  /n  Model Generation: A 1FIX II mouse 129/SvJ genomic library (Stratagene, La Jolla, CA, USA) was screened with a 32P-labelled PvuII fragment of a rat V1bR cDNA. Two independent clones were identified and the largest (~16.6 kb; GENBANK Accession Nos AF152533 and AF152534) was used to construct the targeting vector. A 1.2-kb PvuII fragment 5′ to the coding region for transmembrane regions I–VI was inserted in the targeting vector pPNT at the XhoI site. The 1.7-kb PstI/SacI piece containing the 3′ end of the exon (TMVI) and most of the following introns were inserted at the HincII site of pPNT (this destroyed the thymidine kinase selection). The targeting construct thus eliminated the V1bR coding region from the initiating methionine just prior to TMVI. The construct was linearized with NotI and electroporated into embryonic stem cells for selection as described previously.22 Two embryonic stem cell clones were identified by PCR and confirmed by Southern analysis. Chimeric mice were generated from one of them and germ line transmission was observed. Genotyping was performed by PCR. The growth curves and longevity of the mice were not significantly different (Figure 1, Table 2)  /n  Rescue: -  /n  Model Summary: Here, we further characterized the aggressive phenotype in Avpr1b -/- (knockout) mice. We tested maternal aggression and predatory behavior. We also analyzed the extent to which food deprivation and competition over food increases intermale aggression. We quantified defensive behavior in Avpr1b -/- mice and later tested offensive aggression in these same mice. Our results show that attack behavior toward a conspecific is consistently reduced in Avpr1b -/- mice. Predatory behavior is normal, suggesting that the deficit is not because of a global inability to detect and attack stimuli. Food deprivation, competition for food and previous experience increase aggression in both Avpr1b +/+ and -/- mice. However, in these circumstances, the level of aggression seen in knockout mice is still less than that observed in wild-type mice. Defensive avoidance behaviors, such as boxing and fleeing, are largely intact in knockout mice. Avpr1b -/- mice do not display as many 'retaliatory' attacks as the Avpr1b +/+ mice. Interestingly, when territorial aggression was measured following the defensive behavior testing, Avpr1b -/- mice typically show less initial aggressive behavior than wild-type mice, but do show a significant increase in aggression with repeated testing.	G protein-coupled receptor activity,vasopressin receptor activity,peptide binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6J	17375139	108	Expeimentalparadigm: Locomotion test//Elevated plus maze//Morris water maze  /n  Model Generation: The F1 hybrid WT and homozygous DAT KO mice were obtained by crossing congenic (12 backcrosses) C57BL/6JOrl-DAT heterozygous (HT) females with congenic (11 backcrosses) DBA/2JOrl-DAT HT males, as described previously (Morice et al, 2004).  /n  Rescue: Very interestingly, both acute and chronic nicotine treatments greatly improved their deficits in the cued and spatial learning, without eliciting tolerance. We speculate that the procognitive effects of nicotine in DAT KO mice are related to the upregulation of alpha7 nicotinic receptors in the hippocampus, amygdala, and prelimbic cortex, all areas involved in cognition.  /n  Model Summary: Mice deficient in the dopamine transporter (DAT KO) exhibit a phenotype reminiscent of schizophrenia and ADHD, including hyperdopaminergia, hyperactivity, paradoxical calming by methylphenidate and cognitive deficits, some of which being improved by antipsychotic agents.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Manic Episodes	5 C3.3|5 40.63 cM	Mutated	C57BL/6J	17379666	109	Expeimentalparadigm: Sucrose preference//Open field test//Elevated plus maze//Forced swim test//Locomotor activity//Learned helplessness following inescapable shock//Reward-aversion test  /n  Model Generation: The<U+00A0>Clock<U+00A0>mutation was induced in, and has been maintained as a coisogenic line by at least six generations of backcrossing to, the C57BL/6J (B6) inbred strain.<U+00A0>Clock mutant mice were created by N-ethyl-N-nitrosourea mutagenesis and produce a dominant-negative CLOCK protein as described  /n  Rescue: The Manic-Like Behavior of the<U+00A0>Clock<U+00A0>Mutant Mice Can Be Reversed with Lithium Treatment.  /n  Model Summary: These findings establish the<U+00A0>Clock<U+00A0>mutant mice as a previously unrecognized model of human mania and reveal an important role for CLOCK in the dopaminergic system in regulating behavior and mood.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6J	17433376	110	Expeimentalparadigm: Locomotion test//Elevated plus maze  /n  Model Generation: Congenic heterozygous C57BL/6Jorl(B6)-DAT females were crossed with congenic heterozygous DBA/2Jorl(D2)-DAT males to generate the F1 hybrid WT and homozygous DAT KO mice, as previously described (Morice et al., 2004).  /n  Rescue: Co-administration of nicotinic agonists at sub-active doses elicited opposite locomotor effects in wild-type and DAT KO mice, as reported previously for methylphenidate. Interestingly, such a co-administration of nicotinic agonists induced synergistic hypolocomotion in DAT KO mice. These findings show that a targeted increase of DA tone can be responsible for significant adaptations of the cholinergic/nicotinic neurotransmission.  /n  Model Summary: Numerous studies suggest a dysfunction of nicotinic neurotransmission in schizophrenia and show increased tobacco intake in schizophrenic and ADHD patients, possibly as a self-medication. Thus, we examined the potential alteration of nicotinic neurotransmission in DAT knock-out (KO) mice. We showed that constitutively hyperDAergic DAT KO mice exhibited modifications in nicotinic receptor density in an area- and subtype-dependent manner. In some DAergic areas, the small decrease in the beta2* nicotinic subunit (nAChR) density contrasted with the higher decrease and increase in the alpha6* and alpha7 nAChR densities, respectively. Mutant mice were hypersensitive to the stimulant locomotor effects of nicotine at low doses, probably due to enhanced nicotine-induced extracellular DA level. They also showed hypersensitivity to the hypolocomotion induced by nicotine. In contrast, no hypersensitivity was observed for other nicotine-induced behavioral effects, such as anxiety or motor activity in the elevated plus maze.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Disc1	DISC1	protein-coding	Mus musculus	ENSMUSG00000043051	-	244667	Schizophrenia	8 E2|8 73.26 cM	Mutated(ENU mutagenesis)	C57BL/6	17481393	111	Expeimentalparadigm: Prepulse inhibition test//Locomotion tests//Elevated plus maze//T-maze//Morris water maze//Three-chamber test  /n  Model Generation: The detailed protocol of ENU mutagenesis was described previously [9] and also in http://www.gsc.riken.jp/Mouse/. Briefly, we obtained the stock mice from CLEA Japan. We injected ENU (Sigma) to C57BL/6 males intraperitoneally at 8–10 weeks of age with 85 or 100 mg/kg body weight. The injections were carried out twice at weekly intervals. The injected males were mated with DBA/2 or C3H/He females after a sterile period (approximately 10–11 weeks) to produce G1 offspring. We have been conducting sperm cryopreservation for all the G1 males at 3 months of age according to the method described by Nakagata [23]. We carried out the animal studies under the guidance issued by the RIKEN Bioscience Technology Center in “Outline for conducting animal experiments” after the approval by the Animal Experiment Committee at RIKEN Yokohama Institute. TCGE heteroduplex detection was used to screen 1686 ENU-induced mutant mice for mutations in Exon 2 of Disc1, as described (Sakuraba et al., 2005).  /n  Rescue: These were reversed by antipsychotic treatment.  /n  Model Summary: To support the role of DISC1 in human psychiatric disorders, we identified and analyzed two independently derived ENU-induced mutations in Exon 2 of mouse Disc1. Mice with mutation Q31L showed depressive-like behavior with deficits in the forced swim test and other measures that were reversed by the antidepressant bupropion, but not by rolipram, a phosphodiesterase-4 (PDE4) inhibitor. In contrast, L100P mutant mice exhibited schizophrenic-like behavior, with profound deficits in prepulse inhibition and latent inhibition that were reversed by antipsychotic treatment.	protein binding,kinesin binding,identical protein binding,protein-containing complex binding,molecular adaptor activity	Ani
Nrg1	NRG1	protein-coding	Mus musculus	ENSMUSG00000062991	6030402G23Rik|ARIA|D230005F13Rik|GGF|GGFII|HRG|HRGalpha|Hgl|NDF|Pro-NRG1|SMDF	211323	Schizophrenia	8|8 A3	Transgene	FVB/N	17483467	112	Expeimentalparadigm: Open field test//Elevated plus maze//Social interaction test  /n  Model Generation: A plasmid containing the CNP promoter (Chandross et al., 1999) close to the 5' end of a multiple cloning site (Ling et al., 2004) was cut with HindIII, blunt ended, and then cut with NotI. Then, the 2.2 kb NotI-SmaI DN-erbB4 DNA was ligated into the plasmid, and clones were isolated and sequenced. The DNA fragment containing the CNP, promoter, DN-erbB4, and simian virus 40 polyadenylation signal was excised with AseI and MluI, gel purified, and used for the generation of transgenic FVB/N mice using standard procedures. Animals carrying the transgene were identified by PCR as described previously (Prevot et al., 2003). Two transgenic lines, CNP3 and CNP48, which express high levels of DN-erbB4 in peripheral nerves, were carried to homozygosity and used for additional analysis. The genotypes of homozygous mice were confirmed by analyzing the progeny of presumptive homozygote mice backcrossed to wild-type (WT) mice or by real-time quantitative PCR. The use of animals was approved by the Animal Care and Use Committee of Children’s Hospital Boston.  /n  Rescue: -  /n  Model Summary: Several psychiatric disorders are associated with white matter defects, suggesting that oligodendrocyte (OL) abnormalities underlie some aspects of these diseases. Neuregulin 1 (NRG1) and its receptor, erbB4, are genetically linked with susceptibility to schizophrenia and bipolar disorder. In vitro studies suggest that NRG1-erbB signaling is important for OL development. To test whether erbB signaling contributes to psychiatric disorders by regulating the structure or function of OLs, we analyzed transgenic mice in which erbB signaling is blocked in OLs in vivo. Here we show that loss of erbB signaling leads to changes in OL number and morphology, reduced myelin thickness, and slower conduction velocity in CNS axons. Furthermore, these transgenic mice have increased levels of dopamine receptors and transporters and behavioral alterations consistent with neuropsychiatric disorders.	transcription coregulator activity,signaling receptor binding,ErbB-2 class receptor binding,integrin binding,protein binding,growth factor activity,protein tyrosine kinase activator activity,receptor tyrosine kinase binding,ErbB-3 class receptor binding,chemorepellent activity,receptor ligand activity	Ani
Nrg1	NRG1	protein-coding	Mus musculus	ENSMUSG00000062991	6030402G23Rik|ARIA|D230005F13Rik|GGF|GGFII|HRG|HRGalpha|Hgl|NDF|Pro-NRG1|SMDF	211323	Schizophrenia	8|8 A3	Knockout	C57BL/6	17512671	113	Expeimentalparadigm: Y-maze//Barnes maze//Resident–intruder test//Novelty object recognition test//Open field test  /n  Model Generation: NRG1 transmembrane-domain–knockout mice were generated using a targeting vector in which most of exon 11, which encodes the transmembrane domain, and some of the immediate downstream intron were replaced with a neomycin resistance gene cassette, preceded by an oligonucleotide carrying stop codons in each reading frame and a polyadenylation sequence. The targeting vector was electroporated into J1 embryonic stem (ES) cells (129/terSv), and founding chimeras were outcrossed to C57Bl/6 mice to establish the line. Heterozygous mice were healthy and fertile, although homozygous embryos died of cardiac defects around E10.5–E11.5. These mice will be described more fully elsewhere (R. P. Harvey, D. Lai, and M. Zhou, unpublished data). ErbB4 hypomorphic mice heterozygous for a null allele of the gene were generated by replacement of the coding region of exon 2 with a reporter gene (Gassmann et al. 1995). Heterozygous null NRG1 and ErbB4 mice were bred at Charles River Laboratories by crossing to a C57Bl/7 background. Six weeks prior to behavioral testing, male mice and litter-mate control mice for each line were shipped to the testing laboratory at PsychoGenics, where they were housed in groups of three to five related mice per cage.  /n  Rescue: -  /n  Model Summary: In the present study the functional role of the NRG1 gene, as it relates to cognitive and social processes known to be disrupted in schizophrenia, was assessed in mice with heterozygous deletion of transmembrane (TM)-domain NRG1 in comparison with wildtypes (WT). Social affiliative behavior was assessed using the sociability and preference for social novelty paradigm, in terms of time spent in: (i) a chamber containing an unfamiliar conspecific vs. an empty chamber (sociability), or (ii) a chamber containing an unfamiliar conspecific vs. a chamber containing a familiar conspecific (preference for social novelty). Social dominance and aggressive behavior were examined in the resident-intruder paradigm. Spatial learning and memory were assessed using the Barnes maze paradigm, while spatial working memory was measured using the continuous variant of the spontaneous alternation task. Barnes maze data revealed intact spatial learning in NRG1 mutants, with elevated baseline latency to enter the escape hole in male NRG1 mutants reflecting an increase in activity level. Similarly, although a greater number of overall arm entries were found, spontaneous alternation was unaffected in NRG1 mice. Social affiliation data revealed NRG1 mutants to evidence a specific loss of WT preference for spending time with an unfamiliar as opposed to a familiar conspecific. This suggests that NRG1 mutants show a selective impairment in response to social novelty. While spatial learning and working memory processes appear intact, heterozygous deletion of TM-domain NRG1 was associated with disruption to social novelty behavior. These data inform at a novel phenotypic level on the functional role of this gene in the context of its association with risk for schizophrenia.	transcription coregulator activity,signaling receptor binding,ErbB-2 class receptor binding,integrin binding,protein binding,growth factor activity,protein tyrosine kinase activator activity,receptor tyrosine kinase binding,ErbB-3 class receptor binding,chemorepellent activity,receptor ligand activity	Ani
Cdk5	CDK5	protein-coding	Mus musculus	ENSMUSG00000028969	Crk6	12568	Cognitive Disorders	5 A3|5 11.73 cM	Conditional Knockout	floxed Cdk5;Cre-ERT<U+00A0>	17529984	114	Expeimentalparadigm: Contextual and cue fear conditioning//Extinction trials//Nociceptive responses//Hotplate test//Locomotor activity//Elevated plus anxiety maze//Open field test//Water maze  /n  Model Generation: We generated an inducible conditional Cdk5 knockdown model to study the role of Cdk5 in learning and synaptic plasticity. This Cre/loxP<U+00A0>system allowed temporal control of Cdk5 gene deletion in the adult brain. Using homologous recombination, exons encoding vital Cdk5 catalytic-domain components were flanked with<U+00A0>loxP<U+00A0>elements (floxed;<U+00A0>Fig. 1a). Homozygous floxed Cdk5 mice were crossed with animals bearing an inducible Cre-ERTrecombinase transgene under the control of the prion protein promoter  /n  Rescue: -  /n  Model Summary: Here we report that conditional knockout of Cdk5 in the adult mouse brain improved performance in spatial learning tasks and enhanced hippocampal long-term potentiation and NMDA receptor (NMDAR)-mediated excitatory postsynaptic currents.	nucleotide binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ErbB-2 class receptor binding,protein binding,ATP binding,cytoskeletal protein binding,kinase activity,transferase activity,protein kinase binding,acetylcholine receptor activator activity,histone kinase activity,ErbB-3 class receptor binding,ephrin receptor binding,tau-protein kinase activity,Hsp90 protein binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	NA	17556551	115	Expeimentalparadigm: Morris water maze//Contextual fear discrimination paradigm  /n  Model Generation: In one of several mouse lines using a proopiomelanocortin (POMC)–bacterial artificial chromosome to drive expression of the Cre recombinase (27), crossing with lacZ reporter mice [Rosa26 (28)] revealed robust Cre-loxP recombination in the DG granule cell (GC) layer throughout the dorsal/ventral axis (Fig. 1, A to D), with sparser recombination in the arcuate nucleus of the hypothalamus, the lateral habenular nucleus, and a small number of scattered cortical and midbrain cells. Immunofluorescence studies with antibodies specific for β-galactosidase (a Cre-loxP recombination marker), NeuN (a neuronal marker), S100β (a glial cell marker), and glutamic acid decarboxylase (GAD-67, an interneuron marker) indicated that the Cre-loxP recombination is confined to GCs in the DG of the hippocampus (Fig. 1, E to K). Cre-loxP recombination in the DG GC layer begins between postnatal weeks 2 to 3 and remains spatially restricted until at least 24 weeks of age (fig. S1). It is known that DG GCs can arise via adult neurogenesis. Cre-loxP recombination is detected in newly born neurons that had reached the GC layer (Fig. 1, L to N). We generated DG-NR1 knockout (KO) mice by crossing these POMC-Cre mice with floxed NR1 (f NR1) mice (29). In situ hybridization showed that NR1 RNA begins to decrease sometime between 1.5 and 4 weeks after birth and is nearly absent by 16 weeks of age in the DG GCs (Fig. 2, A to F, and fig. S1).  /n  Rescue: -  /n  Model Summary: We have tested this hypothesis by generating and analyzing a mouse strain that lacks the gene encoding the essential subunit of the N-methyl-d-aspartate (NMDA) receptor NR1, specifically in dentate gyrus granule cells. The mutant mice performed normally in contextual fear conditioning, but were impaired in the ability to distinguish two similar contexts. A significant reduction in the context-specific modulation of firing rate was observed in the CA3 pyramidal cells when the mutant mice were transferred from one context to another.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockdown	C57BL/6J	17584943	116	Expeimentalparadigm: Locomotion test//Conditioned place preference  /n  Model Generation: The DAT-KD mice were generated by the insertion of a DNA construct containing the neomycin-resistant gene and other elements into the promoter region of DAT gene in an attempt to control DAT expression [18]. This promoter modification results in a 90% reduction in DAT expression [18]. Mice used in this study were produced from the breeders that have been backcrossed with C57BL/6J mice for 8–9 generations.  /n  Rescue: -  /n  Model Summary: We examined the cocaine induced behavior of DAT knockdown mice that have DAT expression reduced by 90% when compared to the wild type mice. Despite a dramatic reduction of DAT expression and marked elevation in basal dopamine tone, cocaine produced reward, as measured by conditioned place preference, and stimulated locomotor activity in these mice.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Egr3	EGR3	protein-coding	Mus musculus	ENSMUSG00000033730	EGR-3|Pilot	13655	Aggressive Behaviors	14|14 D2	Knockout	C57BL/6	17637609	117	Expeimentalparadigm: Resident-intruder test//Open field test//High-performance liquid chromatography//Activity monitoring  /n  Model Generation: Previously-generated Egr3–/– mice (Tourtellotte and Milbrandt, 1998) were back-crossed to C57BL/6 mice for 13 generations. An 8-kb genomic mouse (strain 129/SvJ) DNA fragment containing the entire Egr3 gene was subcloned into pBluescript (Stratagene). A 1.5-kb fragment containing a neomycin resistance selection cassette pMC1NeopA (ref. 22) was used to disrupt the gene coding sequence by deleting a 0.9-kb fragment of the gene that encoded the entire zinc-finger DNA binding domain and the remaining carboxyl terminus of the protein. Northern-blot analysis was performed using PolyA RNA prepared from wild-type and Egr3 homozygous mutant brains and probed with a rat Egr3 cDNA using standard methods. Western blots were generated from total lysates of adult wild-type and Egr3 homozygous mutant brains using a previously characterized affinity-purified Egr3 polyclonal antibody+23.  /n  Rescue: -  /n  Model Summary: Here we show that mice lacking the IEG transcription factor Egr3 (Egr3-/- mice) display increased aggression, and a decreased latency to attack, in response to the stressful social stimulus of a foreign intruder. Together with our findings of persistent and intrusive olfactory-mediated social investigation of conspecifics, these results suggest increased impulsivity in Egr3-/- mice.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,sequence-specific DNA binding,metal ion binding,sequence-specific double-stranded DNA binding	Ani
Disc1	DISC1	protein-coding	Mus musculus	ENSMUSG00000043051	-	244667	Schizophrenia	8 E2|8 73.26 cM	Transgene	C57BL/6	17675407	118	Expeimentalparadigm: Open field test//Hidden food test//Prepulse Inhibition//Forced swim test  /n  Model Generation: A C-terminal truncated human DISC1 (amino acids 1–597) was inserted under the αCaMKII promoter in a modified pMM403 vector (42). The insert was injected into oocytes of C57BL/6 mice at the Transgenic Core Laboratory of The Johns Hopkins University. Integration of the transgenes into the mouse genome was confirmed by genomic PCR with primers containing a transgene specific sequence (sense human DISC1 nucleotides 1354–1373: 5′-GAATGGAGCCGAGGCTGTTG-3′) and a vector derived sequence (antisense, αCaMKII-R: CAGTGTGATGGATGGATATC). Lines 10 and 37 were established by mating with C57BL6 mice maintaining the purity of the genetic background. Heterozygous line 10 and 37 male tg and wt littermates were compared in further experiments. All procedures related to animals were performed according to the Johns Hopkins animal care and use guidelines.  /n  Rescue: -  /n  Model Summary: Here, we report generation and characterization of Disrupted-In-Schizophrenia-1 (DISC1) genetically engineered mice as a potential model for major mental illnesses, such as schizophrenia. DN-DISC1 mice also display several behavioral abnormalities, including hyperactivity, disturbance in sensorimotor gating and olfactory-associated behavior, and an anhedonia/depression-like deficit.	protein binding,kinesin binding,identical protein binding,protein-containing complex binding,molecular adaptor activity	Ani
Gtf2i	GTF2I	protein-coding	Mus musculus	ENSMUSG00000060261	6030441I21Rik|BAP-135|Diws1t|GtfII-I|Spin|TFII-I|WBSCR6	14886	Aggressive Behaviors	5 G2|5 74.48 cM	Knockout	NA	17680805	119	Expeimentalparadigm: Behavioral experiments//Resident–intruder test//Elevated plus maze//Cube exploration test//Locomotor activity in the open field//Fear conditioning test//Morris water maze  /n  Model Generation: The murine Gtf2ird1 gene was disrupted using a conventional replacement targeting strategy. The targeting vector consisted of 2.7 kb short arm and a 5.8 kb long arm derived from RPCI-21-510M19 (PAC library derived from 129S6/SvEvTac mice) cloned into the EcoRI and KpnI sites, respectively, of the pKSLoxPNT cloning vector (Hanks et al. 1995). The resulting vector contained a neomycin-resistant gene (Neo), flanked by loxP sites, in the same transcriptional orientation as the Gtf2ird1 gene (Fig. 1a). Integration of the linearized vector into the Gtf2ird1 gene locus of R1 murine embryonic stem cells (Nagy et al. 1993) generated neomycin-resistant clones with the expected genomic fragments by Southern blot and polymerase chain reaction (PCR) analysis (Fig. 1b). The targeting resulted in the replacement of Gtf2ird1 exons 2, 3, 4 and part of 5 with the neomycin-resistant gene cassette transcribed by the PGK1 promoter (Fig. 1a). Mice carrying the targeted allele were generated by aggregation of targeted cells with ICR morula-stage embryos to obtain germline-transmitting chimeric mice (Nagy et al. 2002). Chimeric males were mated with CD1 females to produce hybrid CD1x[ICRx129] Gtf2ird1 heterozygously targeted mice, and these mice were subsequently backcrossed to CD1 to generate animals for intercross breeding. Both Gtf2ird1+/- and Gtf2ird1-/- mice were viable and fertile and the mutant allele was transmitted at the expected Mendelian ratio. F1 heterozygous littermates were crossed to homozygosity in order to generate Gtf2ird1-/- mice. Genotyping was performed by PCR analysis of purified genomic DNA using the forward primer mIRD1-GF (5′-CGACCACCATAGGTTGAAGG-3′), in combination with the two reverse primers mIRD1-GR (5′-TGGGGAACTGTTTGAGAAGG-3′) and NEO-GR (5′-GGGGAACTTCCTGACTAGGG-3′). A 381 bp product is generated from the wild-type (WT) locus and a 350 bp product is generated from the targeted locus.  /n  Rescue: -  /n  Model Summary: We show that mice with heterozygous or homozygous disruption of Gtf2ird1 exhibit decreased fear and aggression and increased social behaviors. These findings are reminiscent of the hypersociability and diminished fear of strangers that are hallmarks of WBS. Other core features of WBS, such as increased anxiety and problems with spatial learning were not present in the targeted mice. Investigation of a possible neurochemical basis for the altered behaviors in these mice using high-performance liquid chromatography analysis showed increased levels of serotonin metabolites in several brain regions, including the amygdala, frontal cortex and parietal cortex. Serotonin levels have previously been implicated in fear and aggression, through modulation of the neural pathway connecting the prefrontal cortex and amygdala. These results suggest that hemizygosity for GTF2IRD1 may play a role in the complex behavioral phenotype seen in patients with WBS, either individually, or in combination with other genes, and that the GTF2I transcription factors may influence fear and social behavior through the alteration of neurochemical pathways.	DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,RNA polymerase II-specific DNA-binding transcription factor binding	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Anxiety Disorder	11 B5|11 46.18 cM	Knockout	C57BL/6	17692295	120	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: Animals were male SERT+/+ (n = 11), SERT+/- (n = 13), and SERT-/- (n = 8) mice on a C57/BL6 background strain (Bengel et al., 1998). A mouse c129 genomic P1 library (Genomic Systems, St. Louis, MO) was screened by a polymerase chain reaction targeting exon 2 (Kp1, 59-TGAGATTCACCAAGGGGACG; Kp2, 39- CCTCCACCATTCTGGTAGCAT). Two clones, P1(20) and P1(242), were purified and further characterized by restriction mapping and Southern blot analysis. 39 and 59 DNA fragments encompassing exon 2 with an overall length of 7.5 kb were inserted into the pPNT-neo replacement targetingvector, containing a neo and TK cassette under the control of the PGK promoter (Fig. 1A) (Tybulewicz et al., 1991). A 1.1 kb BamHI/ HindIII fragment containing 5-HTT exon 2 was replaced by a 1.8 kb PGK neomycin-polyA expression cassette. Before electroporation, the targeting construct was linearized at the single NotI restriction site of pPNT-neo. 129 R1 ES cells were cultured, transfected, and subjected to double selection. DNA was digested with Asp718 and hybridized with a 39 probe that recognized a 5-HTT sequence external to the construct (Fig. 1B). In addition, recombinant ES cell clones were identified by Southern blot analysis, with the use of a 59 HindIII/BamHI probe to confirm accurate gene targeting (data not shown). After confirmation of two targeted ES cell clones (ES 49, ES 53; targeting frequency 5 2/61), both clones were microinjected in C57BL/6J blastocysts to obtain chimeric progeny. Chimeric males were mated to CD-1 and C57BL/6J female mice; pups were geno typed by Southern blot analysis of tail biopsies (Fig. 1C). After confirmation of germline transmission, 5-HTT1/2 mice were mated to produce 5-HTT2/2 mutants.  /n  Rescue: -  /n  Model Summary: To better understand how these mice organize their behavior, we assessed the open field and elevated plus maze spatiotemporal patterning of activity in adult male SERT wild type (+/+), heterozygous (+/-) and -/- mice on C57BL/6J genetic background using new videotracking and analytic procedures. In addition, we analyzed their spatial memory, assessing within- and between-trial habituation, and examined specific motor characteristics of their movement in these two tests. In the open field test, SERT-/- mice showed reduced vertical exploration throughout the arena, reduced central (but not peripheral) horizontal exploration, unaltered within-trial habituation, and slightly poorer between-trial habituation for horizontal activity. In the elevated plus maze, SERT-/- mice demonstrated anxiety-like avoidance of open arms, hypoactivity, as well as unaltered within-trial and between-trial habituation (except for poorer between-trial habituation of total horizontal activity). In both tests, SERT-/- mice showed greater prevalence of horizontal over vertical dimension of their exploration in the areas protected by the walls (open field periphery, plus maze closed arms), but not in open aversive areas, such as the center of the open field or center or open arms of the maze. In both arenas, SERT-/- mice consistently displayed increased turning behavior, potentially representing a perseverance-like phenotype or aberrant spatial strategies in novel environments.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Neurodevelopmental Disorders	4 D2.2|4 61.33 cM	Knockout	NA	17713528	121	Expeimentalparadigm: Grooming//Zero maze//Open field test//Light-dark test  /n  Model Generation: SAPAP3 knockout mice were generated by homologous recombination in R1 embryonic stem cells using standard procedures. A targeting vector was designed to replace exon 3 (containing the translation initiation codon) of the SAPAP3 gene with a NEO cassette. Genotypes were determined by PCR of mouse tail DNA, using primer F1 (ATTGGTAGGCAATACCAACAGG) and R1 (GCAAAGGCTCTTCATATTGTTGG) for the wildtype allele (147 base pairs), and F1 and R2 (CTTTGTGGTTCTAAGTACTGTGG; in neo cassette) for the mutant allele (222 base pairs).  /n  Rescue: Here we show that mice with genetic deletion of Sapap3 exhibit increased anxiety and compulsive grooming behaviour leading to facial hair loss and skin lesions; both behaviours are alleviated by a selective serotonin reuptake inhibitor. Electrophysiological, structural and biochemical studies of Sapap3-mutant mice reveal defects in cortico-striatal synapses.  /n  Model Summary: Here we show that targeted deletion of SAPAP3 in mice leads to a behavioral phenotype similar to OCD: compulsive over-grooming behavior, increased anxiety, and response to selective serotonin reuptake inhibitors (SSRIs).	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Nlgn3	NLGN3	protein-coding	Mus musculus	ENSMUSG00000031302	A230085M13Rik|HNL3|NL3|NLG3	245537	Autism Spectrum Disorder	X|X D	Knockin(Mutated)	129/SvJ;C57BL/6	17823315	122	Expeimentalparadigm: dark//light box //open field//novel home cage activity//rotarod//open field arena//elevated plus maze  /n  Model Generation: To investigate possible mechanisms, we introduced the R451C-substitution into the endogenous neuroligin-3 gene in mice by gene targeting, generating R451C knockin (KI) mice (Fig. S1, 30).  /n  Rescue: -  /n  Model Summary: Here we introduce one of these mutations into mice – the R451C-substitution in neuroligin-3. R451C-mutant mice showed impaired social interactions but enhanced spatial learning abilities. Unexpectedly, these behavioral changes were accompanied by an increase in inhibitory synaptic transmission, with no apparent effect on excitatory synapses. Deletion of neuroligin-3, in contrast, did not cause such changes, indicating that the R451C-substitution represents a gain-of-function mutation. These data suggest that increased inhibitory synaptic transmission may contribute to human ASDs and that the R451C KI mice may be a useful model for studying autism-related behaviors.	signaling receptor activity,neurexin family protein binding,cell adhesion molecule binding,molecular adaptor activity,scaffold protein binding	Ani
Disc1	DISC1	protein-coding	Mus musculus	ENSMUSG00000043051	-	244667	Schizophrenia	8 E2|8 73.26 cM	Transgene	C57BL/6N	17984054	123	Expeimentalparadigm: Spatial working memory task//Forced swimming test//Three-chamber test  /n  Model Generation: The transgene (in the pMM-LBDG521R-DISC1-cc plasmid) used in these studies was designed according to a procedure previously described (23): it contains an α-calmodulin kinase II promoter, a hybrid intron in the 5′ untranslated leader, a HA virus-tag sequence, and a LBDG521R cDNA fused 5′ to the DISC1-cc cDNA (encoding protein residues 671–852, C-terminal portion of DISC1 protein), as well as a polyadenylation signal. The pMM-LBDG521R-DISC1-cc plasmid was digested with SfiI, and transgenic mice were generated by injecting the purified insert into pronuclei of C57BL/6 zygotes. Founders were backcrossed into C57BL/6N mice (Taconic Farms, Germantown, NY). All procedures used were approved by the Animal Research Committee of University of California at Los Angeles.  /n  Rescue: -  /n  Model Summary: Disrupted-in-schizophrenia 1 (DISC1) was initially discovered through a balanced translocation (1;11)(q42.1;q14.3) that results in loss of the C terminus of the DISC1 protein, a region that is thought to play an important role in brain development. Here, we use an inducible and reversible transgenic system to demonstrate that early postnatal, but not adult induction, of a C-terminal portion of DISC1 in mice results in a cluster of schizophrenia-related phenotypes, including reduced hippocampal dendritic complexity, depressive-like traits, abnormal spatial working memory, and reduced sociability.	protein binding,kinesin binding,identical protein binding,protein-containing complex binding,molecular adaptor activity	Ani
FOXP2	FOXP2	protein-coding	Zebra Finch	ENSTGUG00000005315	-	751769	Speech Sound Disorder	-	Knockdown(RNAi)	Zebra Finch	18052609	124	Expeimentalparadigm: Song recording  /n  Model Generation: we designed eight different constructs for the expression of short hairpin RNA (shRNA) targeting the zebra finch<U+00A0>FoxP2<U+00A0>mRNA and Stereotaxic injection of virus.  /n  Rescue: -  /n  Model Summary: Knockdown of<U+00A0>FoxP2<U+00A0>resulted in an incomplete and inaccurate imitation of tutor song. Inaccurate vocal imitation was already evident early during song ontogeny and persisted into adulthood. The acoustic structure and the duration of adult song syllables were abnormally variable, similar to word production in children with DVD.	NA	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Attention-Deficit/Hyperactivity Disorder	10|10 D2	Knockin	129S6/SvEv	18212115	125	Expeimentalparadigm: Locomotion test//Tail suspension test//Light-dark box test//Social interaction test  /n  Model Generation: Knockin mice carrying the R439H Tph2 allele (GenBank accession no. NM_173391), equivalent to the human R441H TPH2 allele (GenBank accession no. NM_173353) identified in major unipolar depression patients (18), were derived as follows. A 4.6-kb “long arm” and a 2.0-kb “short arm” were cloned by PCR with EXL DNA polymerase (Stratagene, La Jolla, CA) using genomic DNA obtained from 129S6/SvEv mice as template. The long arm corresponded to sequences from Tph2 intron 9, whereas the short arm comprised intron 9 sequences as well as exon 10, intron 10, exon 11, and ≈1 kb of the 3′UTR of the mouse Tph2 gene. To engineer the R439H mutation, guanine 1449 in exon 11 was changed to an adenosine using site-directed mutagenesis. The long and short arms were then subcloned into a targeting vector (51) resulting in the insertion of a floxed herpes virus thymidine kinase/neomicin (TK/NEO) selection cassette in the ninth intron of the gene. The targeting construct was transfected into 129S6/SvEv mouse ES cells. Clones carrying recombinant Tph2 alleles were selected using a standard diphtheria toxin (DT)/G418 double selection protocol. Chimeras generated from selected ES cells were intercrossed with C57BL6/J mice; offspring (F1) that inherited the mutant Tph2 allele were identified by PCR analysis (Fig. 1B).  /n  Rescue: -  /n  Model Summary: Here, we generated knockin mice expressing a mutant form of the brain 5-HT synthesis enzyme, tryptophan hydroxylase 2 (Tph2). This mutant is equivalent to a rare human variant (R441H) identified in few individuals with unipolar major depression. Expression of mutant Tph2 in mice results in markedly reduced ( approximately 80%) brain 5-HT production and leads to behavioral abnormalities in tests assessing 5-HT-mediated emotional states. This reduction in brain 5-HT levels is accompanied by activation of glycogen synthase kinase 3beta (GSK3beta), a signaling molecule modulated by many psychiatric therapeutic agents.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Ctse	CTSE	protein-coding	Mus musculus	ENSMUSG00000004552	A430072O03Rik|C920004C08Rik|CE|CatE	13034	Aggressive Behaviors	1 E4|1 57.14 cM	Knockout	C57BL/6	18221376	126	Expeimentalparadigm: Open field test//Elevated plus maze//Resident-intruder test  /n  Model Generation: Wild-type and CatE-/- male mice on C57BL/6 genetic background (8–11<U+2003>weeks) were used as described previously (Yanagawa et al. 2007). Genomic DNA corresponding to the CatE locus was isolated from a 129/Sv mouse genomic library (Stratagene). The targeting vector, pCTSE-KO, was constructed by replacing a 3.1-kbp fragment containing exons 1 to 4 with a PGK-neo-poly(A) cassette. The targeting vector contained 1.2- and 7.0-kbp regions of homology 5′ and 3′ of the neomycin resistant marker, respectively. A PGK-TK-poly(A) cassette was ligated at the 3′ end of the insert. The maintenance, transfection, and selection of embryonic stem (ES) cells were performed as described previously (16). G418-resistant colonies were screened by Southern blot analysis with the 1,075-bp AvaII probe (Fig. 1a). The expected sizes of hybridizing fragments by KpnI digetion of genomic DNA are 4.8 and 8.0 kbp for the wild-type and mutant CatE–/– alleles, respectively. The mutant ES cells were microinjected into C57BL/6 blastocysts, and the resulting male chimeras were mated with female C57BL/6 mice. The germ-line transmission of the mutated allele was confirmed by Southern blot analysis as described above. Heterozygous offspring were intercrossed to produce homozygous mutant animals. All mice were screened by Southern blot analysis and by polymeratse chain reaction (PCR) with probes able to distinguish wild-type, heterozygous and homozygous mutant mice (S1: 5′-AGGGTGGGGTTGATGGTAAG-3′; W1: 5′-TGAAAATGAGGGTGTTGAGGT-3′; N1: 5′-TGGCTGCTATTGGGCGAAGTG-3′). For reverse transcriptase (RT)-PCR analysis, total RNA was extracted using Trizol reagent (Life Technologies), and the first strand cDNA was synthesized using ReveTra Ace (TOYOBO, Osaka). For PCR, the cDNA was amplified by Taq DNA polymerase (Takara Biomedicals, Tokyo). A thermal cycle of 94°C for 1 min, 55°C for 1 min and 72°C for 30 sec was performed using a program of 35 cycles for cathepsin E and glyceraldehydes-3-phosphate dehydrogenase (GAPDH). The amplified products were separated by electrophoresis on a 2% agarose gel and detected. Primers used for mouse cathepsin E were 5′-TGAACCCCTCATCAACTACCT-3′ and 5′-CACTGCATATTCTCCATCAAT-3′, and for GAPDH were 5′-ATGTCGTGGACTCTACTGGC-3′ and 5′-TGACCTTGCCCACAGCCTTG-3′. All animal experiments were carried out according to the guideline for Animal Experiments, Kyushu University. Unless indicated otherwise, all mice were maintained in an SPF animal facility at the Kyushu University Station for Collaborative Research.  /n  Rescue: The increased aggressive response of CatE-/- mice was reduced to the level comparable to that seen for CatE+/+ mice by pretreatment with an NK-1-specific antagonist.  /n  Model Summary: In this study, we investigate the behavioral effect of disrupting the gene encoding cathepsin E in mice. We found that the cathepsin E-deficient (CatE-/-) mice were behaviorally normal when housed communally, but they became more aggressive compared with the wild-type littermates when housed individually in a single cage.	aspartic-type endopeptidase activity,serine-type endopeptidase activity,peptidase activity,hydrolase activity,identical protein binding	Ani
Mapk3	MAPK3	protein-coding	Mus musculus	ENSMUSG00000063065	Erk-1|Erk1|Ert2|Esrk1|Mnk1|Mtap2k|Prkm3|p44|p44erk1|p44mapk	26417	Bipolar Disorder	7 F3|7 69.25 cM	Knockout	129SvIm/J	18227838	127	Expeimentalparadigm: Elevated plus maze//Forced swim test//Exploratory behavior//Behavioral response to amphetamine//Monitoring the behavioral changes  /n  Model Generation: ERK1 KO mice were generated by standard methods.9 In brief, mice were generated on a 129SvIm/J × CD1 background and backcrossed to and maintained on the 129SvIm/J background.  /n  Rescue: -  /n  Model Summary: Here, we examined the role of the ERK pathway in behavioral plasticity related to facets of bipolar disorder. Mice with ERK1 ablation acquired reduced phosphorylation of RSK1, an ERK substrate, in prefrontal cortex and striatum, but not in hippocampus or cerebellum, indicating the ablation-induced brain region-specific ERK signaling deficits. ERK1 ablation produced a behavioral excitement profile similar to that induced by psychostimulants. The profile is characterized by hyperactivity, enhanced goal-directed activity and increased pleasure-related activity with potential harmful consequence. ERK1-ablated mice were hyperactive in multiple tests and resistant to behavioral despair in the forced swim test. These mice displayed more home-cage voluntary wheel running activities, rearings in a large arena and open-arm visits in an elevated plus maze. Treatments with valproate and olanzapine, but not lithium reduced baseline activities in ERK1-ablated mice. All three treatments attenuated amphetamine-induced hyperactivity in ablated mice.	nucleotide binding,phosphotyrosine residue binding,protein kinase activity,protein serine/threonine kinase activity,MAP kinase activity,MAP kinase kinase activity,protein binding,ATP binding,kinase activity,transferase activity,phosphatase binding,identical protein binding,scaffold protein binding,DNA-binding transcription factor binding	Ani
Dbp	DBP	protein-coding	Mus musculus	ENSMUSG00000059824	-	13170	Bipolar Disorder	7 B3|7 29.45 cM	Knockout	129/Ola×C57/BL6	18247375	128	Expeimentalparadigm: Locomotion test  /n  Model Generation: The generation of transgenic mice carrying DBP KO has been described in detail previously [Lopez-Molina et al., 1997]. Phage clones containing the DBP locus were isolated from the 129/Sv library Lambda FixII (No. 946305, Stratagene) kindly provided by Dr Marc Ballivet. A rat DBP cDNA was used as a hybridization probe. The NotI inserts of the phage clones were introduced into pBluescript II KS+ (Strategene) and characterized further. For the ‘insertion KO’, a 11 kb NotI–EcoRV fragment (EcoRV in the fourth exon) as well as a 1.6 kb EcoRV–RsaI (EcoRV in the fourth exon) fragment were inserted in the ClaI and NotI sites, respectively, of pTK-NEO-UMS (Bueler et al., 1992), kindly provided by Dr Charles Weissmann. The vector obtained was called pTK-NEO-UMS-DBP1. For the ‘replacement KO’, a 1.3kb fragment of the DBP gene starting at the last three codons of DBP was first inserted in the NotI site of pTK-NEO-UMS. Secondly, the bacterial lacZ gene was inserted into the II site. This lacZ fragment contained a NotI site upstream its translation initiation codon in which a 7 kb NotI–BstEII fragment (BstEII in the DBP first exon, upstream of the DBP starting codon) was inserted. The vector obtained was called ‘pTK-B.A.-LacZ-NEO-UMS-D’. For the electroporation both recombination vectors were linearized with SacII.  /n  Rescue: -  /n  Model Summary: Here we report that mice with a homozygous deletion of DBP have lower locomotor activity, blunted responses to stimulants, and gain less weight over time. In response to a chronic stress paradigm, these mice exhibit a diametric switch in these phenotypes. DBP knockout mice are also activated by sleep deprivation, similar to bipolar patients, and that activation is prevented by treatment with the mood stabilizer drug valproate. Moreover, these mice show increased alcohol intake following exposure to stress. Microarray studies of brain and blood reveal a pattern of gene expression changes that may explain the observed phenotypes. CFG analysis of the gene expression changes identified a series of novel candidate genes and blood biomarkers for bipolar disorder, alcoholism, and stress reactivity.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,sequence-specific double-stranded DNA binding	Ani
Shank1	SHANK1	protein-coding	Mus musculus	ENSMUSG00000038738	-	243961	Autism Spectrum Disorder	7|7 B3	Knockout	129Sv;C57BL/6	18272690	129	Expeimentalparadigm: Open-field test//Accelerating Rotarod test//Light–dark transition test//Contextual and cued fear conditioning//Radial arm maze  /n  Model Generation: An ~110 kb bacterial artificial chromosome (BAC) clone containing the complete genomic sequence of mouse Shank1 was isolated from a high-density colony array of mouse C57BL/6 genomic BAC clones (Genome Systems, St. Louis, MO). To construct the Shank1 targeting vector, a 14 kb EcoR1-BamH1 Shank1 genomic fragment was cloned into pBluescript II SK vector. A 2 kb BstXI-HindIII fragment containing exons 14 and 15 encoding almost the entire PDZ domain was then replaced by the PGK-neo cassette in the same transcriptional orientation as Shank1. A thymidine kinase cassette was added at the end of the long arm allowing for double selection. The targeting vector was linearized with NotI and electroporated into J1 embryonic stem (ES) cells, which were subsequently selected in geneticin (G418) and 1-(2-deoxy-2-fluoro-β-d-arabinofuranosyl)-5-iodouracil (FIAU) containing medium as described previously (Li et al., 1992). Genomic DNA isolated from G418- and FIAU-resistant colonies was digested with BamHI or EcoRV and analyzed by Southern blotting. Two independent clones (362R and 388R) from 179 drug-resistant colonies were isolated. Chimeric mice were produced by injecting targeted ES cell clones into C57BL/6 blastocysts, and heterozygous offspring were backcrossed into C57BL/6 and 129SvJae strains (gift from R. Jaenisch, Massachusetts Institute of Technology, Cambridge, MA). The animals used for experiments in this study were in a 129SvJae/C57BL/6 hybrid genetic background.  /n  Rescue: -  /n  Model Summary: Here, we report the phenotype of Shank1 knock-out mice. Shank1 mutants showed altered PSD protein composition; reduced size of dendritic spines; smaller, thinner PSDs; and weaker basal synaptic transmission. Standard measures of synaptic plasticity were normal. Behaviorally, they had increased anxiety-related behavior and impaired contextual fear memory. Remarkably, Shank1-deficient mice displayed enhanced performance in a spatial learning task; however, their long-term memory retention in this task was impaired.	protein binding,protein C-terminus binding,SH3 domain binding,signaling receptor complex adaptor activity,synaptic receptor adaptor activity,somatostatin receptor binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,ankyrin repeat binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Alcohol Use Disorder	6|6 C3	Targeted	C57BL/6	18276852	130	Expeimentalparadigm: Alcohol sensitivity//Two-bottle choice paradigm  /n  Model Generation: We first explored preclinically whether in activation of NK1R might modulate stress- and reward-related processes that impact alcohol use. We chose a genetic inactivation strategy, because available NK1R antagonists have limited activity in rats and mice, because of insufficient NK1R amino acid homology between humans and these rodent species (8). We evaluated NK1R null-mutant mice for voluntary alcohol consumption, alcohol sensitivity, and alcohol metabolism (12). NK1R null mice (13) were back-crossed into a C57BL/6 background for 10 generations to ensure that there was adequate voluntary alcohol consumption in control animals (14). We used a two-bottle free-choice model with increasing alcohol concentration, and alcohol was continuously available. Wild type littermates (+/+) ultimately consumed in excess of 10 g alcohol/kg of body weight per day at the end of an escalation procedure in which alcohol concentration was gradually increased from 3 to 15% over 60 days.  /n  Rescue: -  /n  Model Summary: We investigated the role of the neurokinin 1 receptor (NK1R), a mediator of behavioral stress responses, in alcohol dependence and treatment. In preclinical studies, mice genetically deficient in NK1R showed a marked decrease in voluntary alcohol consumption and had an increased sensitivity to the sedative effects of alcohol.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Foxp2	FOXP2	protein-coding	Mus musculus	ENSMUSG00000029563	2810043D05Rik|CAG-16|D0Kist7	114142	Language Disorder	6|6 A1	Knockin	Zebra Finch	18287060	131	Expeimentalparadigm: Vocalization//Righting reflex//Midair-righting test  /n  Model Generation: Mouse ES cells (PhoenixBio) derived from a 129S6/SvEvTac mouse were used for gene targeting. ES cells were electroporated with the targeting vector, and G418-resistant clones were isolated. Targeted ES clones were screened by Southern blot hybridization with 3′ flanking probe. To remove the<U+00A0>PGK-neo<U+00A0>marker cassette, a correctly targeted ES cell clone was transfected with the<U+00A0>Cre<U+00A0>expression plasmid and grown in the absence of G418 as described (30). Loss of<U+00A0>neo<U+00A0>was determined by Southern blot hybridization with the internal KI probe. Mutant mice were generated by injection of correctly targeted ES cells into C57BL/6 blastocysts. F1<U+00A0>mice were bred by crossing of chimeric male offspring and C57BL/6 female mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: In contrast, heterozygous Foxp2 (R552H)-KI mice, which showed modest impairment of USVs with different USV qualities and which did not exhibit nuclear aggregates	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,transcription coregulator binding,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,identical protein binding,protein homodimerization activity,sequence-specific DNA binding,metal ion binding,nuclear androgen receptor binding	Ani
Grik2	GRIK2	protein-coding	Mus musculus	ENSMUSG00000056073	C130030K03Rik|GluK2|Glur-6|Glur6|Glurbeta2	14806	Bipolar Disorder	10 B3|10 24.87 cM	Knockout	129/Sv;C57BL/6	18332879	132	Expeimentalparadigm: Passive avoidance test//Open field test//Home cage activity//Social interaction test//Elevated plus maze test//Forced swim test//Resident-intruder test  /n  Model Generation: KAR KO mice were originated from 129/Sv and C57/ Bl6 background, and then backcrossed with 129Sv/Ev mice for at least 10 generations to provide an isogenic 129Sv/Ev strain.25 GluR6 KO, GluR5 KO and WT male mice, aged 8 weeks old, were single housed in an animal room at a constant temperature (22±1 °C) and a 12-h light/dark cycle with free access to food and water.  /n  Rescue: Chronic treatment with lithium, a classic antimanic mood stabilizer, reduced hyperactivity, aggressive displays and some risk-taking type behavior in GluR6 KO mice. Hippocampal and prefrontal cortical membrane levels of GluR5 and KA-2 receptors were decreased in GluR6 KO mice, and chronic lithium treatment did not affect these decreases. The membrane levels of other glutamatergic receptors were not significantly altered by GluR6 ablation or chronic lithium treatment.  /n  Model Summary: The glutamate receptor 6 (GluR6 or GRIK2, one of the kainate receptors) gene resides in a genetic linkage region (6q21) associated with bipolar disorder (BPD), but its function in affective regulation is unknown. Compared with wild-type (WT) and GluR5 knockout (KO) mice, GluR6 KO mice were more active in multiple tests and super responsive to amphetamine. In a battery of specific tests, GluR6 KO mice also exhibited less anxious or more risk-taking type behavior and less despair-type manifestations, and they also had more aggressive displays.	SNARE binding,ionotropic glutamate receptor activity,ion channel activity,extracellularly glutamate-gated ion channel activity,protein binding,glutamate receptor activity,ligand-gated ion channel activity,kainate selective glutamate receptor activity,PDZ domain binding,ubiquitin conjugating enzyme binding,ubiquitin protein ligase binding,signaling receptor activity,identical protein binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockin	C57BL/6J	18347339	133	Expeimentalparadigm: Locomotion test  /n  Model Generation: For all experiments we used age- and gender-matched WT and DAT-tg mice (3–5 months old) maintained on a C57BL/6J genetic background. A BAC containing the mouse DAT locus was obtained from Genome Sciences. The BAC4 clone was chosen for pronuclear injection because the DAT locus (40 kb) is flanked by 80 kb of downstream and upstream genomic sequences. The BAC DNA was isolated by using the Clontech BAC preparation kit. The isolated BAC DNA was resuspended at 2 ng/μl in injection buffer (0.03 mM spermine/0.07 mM spermidine). Pronuclear injections were carried out by the Duke Transgenic Mouse Facility using C57BL/6J embryos.  /n  Rescue: -  /n  Model Summary: Behaviorally, DAT-tg animals display similar locomotor stimulation when treated with DAT blockers such as GBR12909, methylphenidate, and cocaine. However, these mice demonstrate markedly increased locomotor responses to amphetamine compared with WT animals. Furthermore, compared with controls, there is a 3-fold greater increase in the amount of DA released by amphetamine in DAT-tg mice that correlates with the 3-fold increase in protein expression. Finally, DAT-tg animals show reduced operant responding for natural reward while displaying preference for amphetamine at much lower doses (0.2 and 0.5 mg/kg) than WT mice (2 mg/kg). These results suggest that overexpression of DAT leads to a marked increase in sensitivity to psychomotor and rewarding properties of amphetamine.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Epha5	EPHA5	protein-coding	Mus musculus	ENSMUSG00000029245	Cek7|Ehk1|Els1|Hek7|Rek7|bsk	13839	Aggressive Behaviors	5 E1|5 43.0 cM	Knockout	NA	18353288	134	Expeimentalparadigm: Shock induced target biting//Resident–intruder test//Locomotor activity  /n  Model Generation: EphA5 animals were obtained from Regeneron Pharmaceutical (Tarrytown, New York, USA). The generation of these knockout mice has been described previously (Feldheim et al., 2004). The line was maintained in our colony with EphA5 heterozygous knockout mice used for breeding. All mice were viable and fertile and appeared to be in good health. The genotype of mice was confirmed by polymerase chain reaction (PCR) of genomic DNA obtained from tails prior to the beginning of testing. The three primers used in PCR were: GCC-CGT TAT GAA AGT GCA TCT TTT CC, GCT-GGC GAA AGG GGG ATG TGC, and ACT GGC ATG GAA ATT GGC TCT GG. The 300-bp fragment was amplified from the knockout allele with two of the primers. The DNA polymerase, Taq, was purchased from Promega (Madison, WI).  /n  Rescue: -  /n  Model Summary: In the present studies, we demonstrated altered aggressive responses by animals lacking functional EphA5 receptors. These behavioral changes were accompanied by altered concentrations of serotonin (5-HT) and the metabolite, 5-HIAA, in the hypothalamus. The changes of serotonin activity in hypothalamus also result in increase of body weight in EphA5 knockout mice. Furthermore, EphA5 knockout mice exhibited a significant decrease in activity levels following exposure to na<U+00EF>ve intruders in their home cages. We conclude that the EphA5 receptor may be involved in mediation of aggressive behavior regulated, in part, by hypothalamic serotonin.	nucleotide binding,protein kinase activity,protein tyrosine kinase activity,transmembrane receptor protein tyrosine kinase activity,ephrin receptor activity,GPI-linked ephrin receptor activity,transmembrane-ephrin receptor activity,protein binding,ATP binding,kinase activity,transferase activity,growth factor binding	Ani
Bace1	BACE1	protein-coding	Mus musculus	ENSMUSG00000032086	ASP2|Bace	23821	Schizophrenia	9|9 A5.2	Knockout	NA	18385378	135	Expeimentalparadigm: Plus maze//Y-maze//Social recognition task  /n  Model Generation: We used homologous recombination in embryonic stem cells to generate BACE1-deficient mice. (For methods, see the Nature Neuroscience web site.)  /n  Rescue: -  /n  Model Summary: Although NRG1 has been genetically linked to schizophrenia and NRG1(+/-) mice exhibit a number of schizophrenia-like behavioral traits, it is not known whether altered BACE1-dependent NRG1 signaling can cause similar behavioral abnormalities. To test this hypothesis, we analyze the behaviors considered to be rodent analogs of clinical features of schizophrenia in BACE1(-/-) mice with impaired processing of NRG1. We demonstrate that BACE1(-/-) mice exhibit deficits in prepulse inhibition, novelty-induced hyperactivity, hypersensitivity to a glutamatergic psychostimulant (MK-801), cognitive impairments, and deficits in social recognition.	amyloid-beta binding,endopeptidase activity,aspartic-type endopeptidase activity,protein binding,peptidase activity,hydrolase activity,enzyme binding	Ani
Grm5	GRM5	protein-coding	Mus musculus	ENSMUSG00000049583	6430542K11Rik|Glu5R|Gprc1e|mGluR5|mGluR5b	108071	Alcohol Use Disorder	7|7 D3	Knockout	C57BL/6J	18400131	136	Expeimentalparadigm: Two-bottle choice paradigm//Conditioned place preference//Righting reflex  /n  Model Generation: mGlu5-deficient mice (Lu et al.,<U+00A0>1997) on a C57BL/6J background (Grm5tm1Rod; stock 003558) were obtained from Jackson Laboratories (Bar Harbor, ME, USA). A heterozygous breeding colony (currently F10) was established by crossing mGlu5<U+2212>/<U+2212><U+00A0>mice with C57BL/6J wild-type mice from the Animal Resources Centre (Perth, Australia).<U+00A0>  /n  Rescue: -  /n  Model Summary: Metabotropic glutamate 5 receptors regulate sensitivity to ethanol in mice	PLC activating G protein-coupled glutamate receptor activity,adenylate cyclase inhibiting G protein-coupled glutamate receptor activity,G protein-coupled receptor activity,protein binding,glutamate receptor activity,A2A adenosine receptor binding,identical protein binding,G protein-coupled receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,protein tyrosine kinase binding	Ani
Prok2	PROK2	protein-coding	Mus musculus	ENSMUSG00000030069	Bv8|PK2|Prok1	50501	Bipolar Disorder	6 D3|6 46.29 cM	Mutated	C57BL/6;129S7	18417646	137	Expeimentalparadigm: Locomotion test  /n  Model Generation: Male and female transgenic mice were generated as previously described (23). The Prok2 targeting construct was generated as an insertional targeting vector incorporating the 5′ Hprt chromosomal engineering cassette (11). A 2,362-bp 5′ arm and 1,229-bp 3′ arm were PCR-amplified from a 129S7-derived BAC clone RPCI 21-497L12 by using Hi-Fidelity PCR mix (Invitrogen, Carlsbad, CA), and they were cloned into the 5′ Hprt vector as a three-piece ligation. The targeting vector was linearized for transfection by using a NheI digest. AB2.2 (129S7/SvEvBrd-Hprtb-m2) ES cells were propagated, transfected by electroporation, and selected with G418 by using standard protocols (29). Homologous recombination was confirmed by using Southern blotting of EcoRI digested with 5′ and 3′ external probes amplified from the genomic PAC clone. The 5′ probe was 858 bp, amplified with primers 5′-GCTTCATGGGGAACAGTTGGCTGGGGTG-3′ and 5′-AGAATCACAGAGCAAGGAGCATCCTTC-3′. The 3′ probe was 424 bp, amplified with primers 5′-ATCCACCTCTTCAGTGGCAGGCACCCCGC-3′ and 5′-TATGACCCTGTGCTATGCCAGGATCTCCC-3′. Chimeric mice were generated by microinjection of targeted ES cells into C57BL/6-Tyrc-Brd blastocysts. Mice were maintained by backcross onto the C57BL/6-Tyrc-Brd genetic background described by N (numbers of backcross generations) and F (numbers of familial brother sister matings as described for congenic strains) (http://informatics.jax.org). Mice were genotyped by using the following intron 2-specific primers that amplify a 373-bp PCR product containing an SNP (NCBI SNP ID code rs29958198) at position 132,076,478 bp of chromosome 2 (NCBI ID code m35): 5′-CCTCTGGGGCGTCTATTGGTCTCC-3′ and 5′-ACTTGGGGGCACTCCGCGTCTGTTC-3′. The SNP creates a restriction fragment length polymorphism on AluI digestion, the recognition site being present in C57BL/6 and absent from 129S7.  /n  Rescue: -  /n  Model Summary: We have previously observed that the targeted null mutation of Prokr2 disrupts circadian coordination of cycles of locomotor activity and thermoregulation. We have now observed spontaneous but sporadic bouts of torpor in the majority of these transgenic mice lacking Prokr2 signaling. During these torpor bouts, which lasted for up to 8 h, body temperature and locomotor activity decreased markedly. Oxygen consumption and carbon dioxide production also decreased, and there was a decrease in respiratory quotient. These spontaneous torpor bouts generally began toward the end of the dark phase or in the early light phase when the mice were maintained on a 12:12-h light-dark cycle and persisted when mice were exposed to continuous darkness. Periods of food deprivation (16-24 h) induced a substantial decrease in body temperature in all mice, but the duration and depth of hypothermia was significantly greater in mice lacking Prokr2 signaling compared with heterozygous and wild-type littermates. Likewise, when tested in metabolic cages, food deprivation produced greater decreases in oxygen consumption and carbon dioxide production in the transgenic mice than controls.	G protein-coupled receptor binding	Ani
Hoxb8	HOXB8	protein-coding	Mus musculus	ENSMUSG00000056648	Hox-2.4	15416	Obsessive Compulsive Disorder	11 D|11 59.82 cM	Targeted	C57BL/6J;CBA	18430798	138	Expeimentalparadigm: Open field test//Grooming//Hot plate test//Lidocaine test//Capsaicin test  /n  Model Generation: The Hoxb8lacZ heterozygote mice used in this work were in the C57BL/6J × CBA genetic background (but see Results for data on different backgrounds). They were intercrossed to produce homozygote embryos. Mice and embryos were genotyped by PCR as described in ref. 10.  /n  Rescue: -  /n  Model Summary: Hoxb genes are expressed at high levels in the dorsal horn of the spinal cord. Hoxb8 null mutants manifest a striking phenotype of excessive grooming and hairless lesions on the lower back.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific DNA binding,sequence-specific double-stranded DNA binding	Ani
Drd4	DRD4	protein-coding	Mus musculus	ENSMUSG00000025496	D4R|Drd-4	13491	Attention-Deficit/Hyperactivity Disorder	7 F5|7 86.6 cM	Knockout	C57BL/6J	18456309	139	Expeimentalparadigm: Delay discounting task//Locomotion test//Novelty object recognition test  /n  Model Generation: All mice were produced as described by Rubinstein et al. (1997). The D4KO genotype was originally created in C57Bl/6J × 129/Ola F1 animals. The subjects used in Experiment 1 were male D4KO (N = 12) and male WT (N = 11) mice from litters produced after 10 generations of backcrossing to C57Bl/6J wild-type mice (N10). The mice were backcrossed on the C57Bl/6J WT mice to eliminate possible confounding effects of the 129 genotype.  /n  Rescue: -  /n  Model Summary: If these various psychopathologies are a result of attenuated D4R-mediated signaling, mice lacking D4Rs (D4KO) should be more impulsive than wild-type (WT) mice and exhibit more novelty seeking. However, in our study, D4KO and WT mice showed similar levels of impulsivity as measured by delay discounting performance and response inhibition on a Go/No-go test, suggesting that D4R-mediated signaling may not affect impulsivity. D4KO mice were more active than WT mice in the first 5 min of a novel open field test, suggesting greater novelty seeking but for both genotypes, with the more impulsive D4KO mice habituated less readily in the novel open field. These data suggest that the absence of D4Rs is not sufficient to cause psychopathologies associated with heightened impulsivity and novelty seeking.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,SH3 domain binding,neurotransmitter receptor activity,dopamine binding,identical protein binding,metal ion binding,epinephrine binding,norepinephrine binding,heterocyclic compound binding	Ani
Disc1	DISC1	protein-coding	Mus musculus	ENSMUSG00000043051	-	244667	Schizophrenia	8 E2|8 73.26 cM	Transgene	C57BL/6J	18458327	140	Expeimentalparadigm: Morris water maze//Radial arm maze//Novel object recognition test//Fear conditioning test  /n  Model Generation: Genetically engineered mutant Disc1 mice contain the same Disc1 mutation backcrossed in C57BL/6J.  /n  Rescue: -  /n  Model Summary: DISC1 is a strong candidate susceptibility gene for schizophrenia, bipolar disorder, and depression. Using a mouse strain carrying an endogenous Disc1 orthologue engineered to model the putative effects of the disease-associated chromosomal translocation we demonstrate that impaired Disc1 function results in region-specific morphological alterations, including alterations in the organization of newly born and mature neurons of the dentate gyrus. Field recordings at CA3/CA1 synapses revealed a deficit in short-term plasticity. Using a battery of cognitive tests we found a selective impairment in working memory (WM), which may relate to deficits in WM and executive function observed in individuals with schizophrenia.	protein binding,kinesin binding,identical protein binding,protein-containing complex binding,molecular adaptor activity	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Targeted	C57BL/6J	18597079	141	Expeimentalparadigm: Latent inhibition//Social affiliations//Olfactory test//Spatial and nonspatial recognition  /n  Model Generation: Grin1D481N mice were generated by site-directed mutagenesis and homologous recombination (Kew et al. 2000) and derived from founders generously provided by Dr. M. Pauly-Evers, Hoffman-La Roche (Basel, Switzerland). These mice were backcrossed 11 generations onto the C57BL/6J strain and then bred from heterozygous intercrosses in the animal colony at the Samuel Lunenfeld Research Institute, Toronto, Canada. C57BL/6J male mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA) and were acclimatized to the animal colony at least 1 week before testing.  /n  Rescue: -  /n  Model Summary: Grin1(D481N) mutant mice showed abnormally persistent latent inhibition (LI) that was reversed by two agents that enhance NMDAR glycine site function, D: -serine (600 mg/kg) and ALX-5407 (1 mg/kg), and by the classical atypical antipsychotic clozapine (3 mg/kg). Similarly, blockade of the NMDAR glycine site with the antagonist L-701,324 (5 mg/kg) induced persistent LI in C57BL6/J mice. In a social affiliations task, Grin1(D481N) mutant animals showed reduced social approach behaviors that were normalized by D: -serine (600 mg/kg). During a nonassociative spatial object recognition task, mutant mice demonstrated impaired reactivity to a spatial change that was reversible by D: -serine (300 and 600 mg/kg) and clozapine (0.75 mg/kg). In contrast, responses to social novelty and nonspatial change remained unaffected, indicating that the Grin1(D481N) mutation induces selective deficits in sociability and spatial discrimination, while leaving intact the ability to react to novelty.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Chrnb2	CHRNB2	protein-coding	Mus musculus	ENSMUSG00000027950	Acrb-2|Acrb2|C030030P04Rik|[b]2-nAchR	11444	Attention-Deficit/Hyperactivity Disorder	3 F1|3 39.19 cM	Knockout	C57BL/6J	18607712	142	Expeimentalparadigm: Open field test//Free roaming activity over 24 h//Spontaneous repetitive behaviours test//Social behaviour test//Elevated plus maze  /n  Model Generation: The generation of genetically modified mice with a β2 nAChR subunit deletion has been described by Picciotto et al. (1995). β2-/- Mice were then backcrossed for nineteen generations to the C57BL6/J parental strain, thereby reducing to a minimum the percentage of genetic material from the original stem cell. β2+/+ and β2-/- mutant siblings (from parents backcrossed) were supplied by Charles River Laboratories (France).  /n  Rescue: -  /n  Model Summary: We use beta2-/- and their controls to investigate the consequences of chronic nicotine exposure on cognitive behaviour. We show that in control mice, this treatment elicits somewhat slight effects, particularly affecting nocturnal activity and self-grooming. By contrast, in beta2-/- mice, chronic nicotine treatment had restorative effects on exploratory behaviour in the open-field and affected rearing, but did not modify motor functions. We confirmed that beta2-/- mice exhibit impaired exploratory and social behaviour, and further demonstrated their nocturnal hyperactivity. These data support the proposal that beta2-/- mice represent a relevant model for cognitive disorders in humans and that nicotine administered chronically at low dose may relieve some of these.	transmembrane signaling receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,protein binding,acetylcholine receptor activity,acetylcholine-gated cation-selective channel activity,neurotransmitter receptor activity,acetylcholine binding,protein-containing complex binding,quaternary ammonium group binding,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Nr5a1	NR5A1	protein-coding	Mus musculus	ENSMUSG00000026751	Ad4BP|ELP|ELP-3|Ftz-F1|Ftzf1|SF-1|SF1|STF-1	26423	Aggressive Behaviors	2 B|2 24.42 cM	Knockout	C57BL/6J	18729641	143	Expeimentalparadigm: Stimulus mouse  /n  Model Generation: Mice with the disrupted SF-1 allele were backcrossed for more than 10 generations to C57BL/6J mice to produce a congenic line.  /n  Rescue: -  /n  Model Summary: Sex hormones are a major factor responsible for the development of sex differences. Steroidogenic factor 1 (SF-1) is a key regulator of gonadal and adrenal development, and SF-1 knockout mice (SF-1 KO) are born without gonads and adrenal glands. Consequently, these mice are not exposed to gonadal sex steroids. SF-1 KO pups die shortly after birth due to adrenal deficiency. In the present study, SF-1 KO mice were rescued by neonatal corticosteroid injections followed by adrenal transplantations on day 7-8 postnatally. Control mice received corticosteroid injections and were gonadectomized prior to puberty. Mice were observed interacting with ovariectomized hormone primed females and gonad-intact males. In the absence of sex steroid replacement, adult SF-1 KO mice were significantly more aggressive than control mice in tests with stimulus females.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,transcription coregulator binding,DNA binding,chromatin binding,double-stranded DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,phospholipid binding,zinc ion binding,lipid binding,enzyme binding,sequence-specific DNA binding,metal ion binding,sequence-specific double-stranded DNA binding	Ani
Slitrk1	SLITRK1	protein-coding	Mus musculus	ENSMUSG00000075478	3200001I04Rik	76965	Anxiety Disorder	14|14 E3	Knockout	C57BL/6J	18794888	144	Expeimentalparadigm: Open field test//Elevated plus mazet//Classic fear conditioning test//Forced swim test//Tail suspension test  /n  Model Generation: Slitrk1-null mutant mice were generated as described previously.12 Briefly, to construct the Slitrk1-targeting vector, overlapping Slitrk1 genomic clones were isolated from a phage library derived from mice of the 129SV strain (Stratagene, La Jolla, CA, USA). The targeting construct contained the 3.6-kb 5′ and 5.2-kb 3′ homology regions, and the 2.5-kb fragment containing the open-reading frame of Slitrk1 was replaced with the phosphoglycerol kinase (PGK)–neo expression cassette flanked by a loxP sequence. E14 embryonic stem (ES) cells were electroporated with the targeting construct and selected with G418. Drug-resistant clones were analyzed by Southern blotting. BamHI- and ScaI-digested genomic DNA were hybridized with a 1.5-kb 3′ genomic fragment that corresponded to the genomic sequence outside of the targeting vector and a 0.6-kb PstI PGK–neo probe, respectively. Chimeric mice were generated by the injection of targeted ES cells into C57BL/6J blastocysts. To excise the PGK–neo cassette, mice with germline transmission were first mated with mice transgenic for Cre recombinase under the control of the cytomegalovirus immediate early enhancer-chicken β-actin hybrid (CAG) promotor.13 Correct excision of the PGK–neo cassette was confirmed by Southern blot. Mice carrying the mutated Slitrk1 allele were backcrossed to C57BL/6J for more than six generations before analysis. Genotyping of progenies was performed by Southern blot or PCR analysis of DNA isolated from tail samples; the PCR primers used were Slitrk1S (5′-TACTACGCTGCAAACCTGCTTG-3′), Slitrk1WTAS (5′-AATAGCCCAGACGCCAGTCA-3′) and Slitrk1KOAS (5′-CAATACATTCATGCCTTCGTGCAAC-3′).  /n  Rescue: -  /n  Model Summary: To clarify the role of Slitrk1 in vivo, we developed Slitrk1-knockout mice and analyzed their behavioral and neurochemical phenotypes. Slitrk1-deficient mice exhibited elevated anxiety-like behavior in the elevated plus-maze test as well as increased immobility time in forced swimming and tail suspension tests. Neurochemical analysis revealed that Slitrk1-knockout mice had increased levels of norepinephrine and its metabolite 3-methoxy-4-hydroxyphenylglycol. Administration of clonidine, an alpha2-adrenergic agonist that is frequently used to treat patients with Tourette's syndrome, attenuated the anxiety-like behavior of Slitrk1-deficient mice in the elevated plus-maze test. These results lead us to conclude that noradrenergic mechanisms are involved in the behavioral abnormalities of Slitrk1-deficient mice. Elevated anxiety due to Slitrk1 dysfunction may contribute to the pathogenesis of neuropsychiatric diseases such as Tourette's syndrome and trichotillomania.	molecular_function	Ani
Bcl2	BCL2	protein-coding	Mus musculus	ENSMUSG00000057329	Bcl-2|C430015F12Rik|D630044D05Rik|D830018M01Rik	12043	Bipolar Disorder	1 E2.1|1 49.76 cM	Mutated	B6;129S2 Bcl-2<tm1Sjk>/J)	18799817	145	Expeimentalparadigm: Open field test//Black-white box test//Forced swim test//Saccharin preference//Elevated plus maze//Acute amphetamine response//Amphetamine sensitization  /n  Model Generation: Male Bcl-2 heterozygous mice and colony littermate Wild Type (WT) controls (N = 53 in total, 25 WT and 28 heterozygous mice; Strain Name: B6;129S2 Bcl-2<tm1Sjk>/J), 11–12 weeks old at the beginning of experiments, were bred for the current project from a cryopreserved strain by Jackson Laboratories (Jackson Laboratories, ME). We chose not to use null mutants because they were reported to have retarded growth, a variety of peripheral disorders and early death and, therefore, are not appropriate for behavioral studies. Such clear pathologies were not reported for heterozygous animals [46].  /n  Rescue: -  /n  Model Summary: New hypotheses regarding affective disorders suggest a critical role for cellular resilience and plasticity. Bcl-2 is a central protein in these processes and is elevated by mood stabilizers and antidepressants. In previous studies, mice with targeted mutations of Bcl-2 showed anxiety-related behavioral changes. The present study further explored the relationship between Bcl-2 and behavior using mice with a targeted mutation but with a different background strain than previously tested. Bcl-2 heterozygous mice (B6;129S2-Bcl-2<tm1Sjk>/J) were tested in models of depression, mania and anxiety. Compared to Wild Type (WT) controls, mutant mice showed behaviors modeling two facets of mania: increased reward seeking and amphetamine sensitization. Moreover, the sensitization was attenuated by chronic pretreatment with lithium. In contrast to previous data, the mutation did not affect measures of anxiety. Although data are still minimal, it supports additional studies of the role of Bcl-2 in affective and anxiety disorders.	protease binding,protein binding,transcription factor binding,channel activity,channel inhibitor activity,protein phosphatase binding,ubiquitin protein ligase binding,identical protein binding,protein homodimerization activity,protein-containing complex binding,protein heterodimerization activity,BH domain binding,BH3 domain binding,protein phosphatase 2A binding,molecular adaptor activity,DNA-binding transcription factor binding	Ani
Camk2a	CAMK2A	protein-coding	Mus musculus	ENSMUSG00000024617	CaMKII|mKIAA0968	12322	Bipolar Disorder	18 E1|18 34.41 cM	Mutated	NA	18803808	146	Expeimentalparadigm: Rotarod test//Open field test//Light-dark box test//Elevated plus maze//Hot plate test//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: alpha-CaMKII+/- mice were obtained from Jackson Laboratories (Bar Harbor, Maine). We used heterozygous alpha-CaMKII knockout mice, because it is hard to obtain homozygotes, due to a difficulty of mating between heterozygous male and heterozygous female mice.  /n  Rescue: -  /n  Model Summary: Here we report that mice heterozygous for a null mutation of the alpha-isoform of calcium/calmodulin-dependent protein kinase II (alpha-CaMKII+/-) have profoundly dysregulated behaviours and impaired neuronal development in the dentate gyrus (DG). The behavioral abnormalities include a severe working memory deficit and an exaggerated infradian rhythm, which are similar to symptoms seen in schizophrenia, bipolar mood disorder and other psychiatric disorders.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,calmodulin-dependent protein kinase activity,protein binding,calmodulin binding,ATP binding,calcium-dependent protein serine/threonine kinase activity,kinase activity,transferase activity,GTPase activating protein binding,glutamate receptor binding,identical protein binding,protein homodimerization activity,metal ion binding	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Aggressive Behaviors	X A7.3|X 37.63 cM	Knockout	129 Sv/Ev	18817733	147	Expeimentalparadigm: Open field test//Light-dark box test//Partition test//Resident-intruder test//Home cage behavioral monitoring and food intake measurements  /n  Model Generation: Mecp2flox mice were a gift from Adrian Bird and Sim1-cre mice were from Brad Lowell and Joel Elmquist. All of the mice used in these experiments were generated by crossing heterozygous female Mecp2flox/+ mice that had been backcrossed to 129 Sv/Ev for 7 generations to male Sim1-cre mice on a pure FVB background.  /n  Rescue: -  /n  Model Summary: Rett Syndrome (RTT) is an autism spectrum disorder caused by mutations in the X-linked gene encoding methyl-CpG binding protein 2 (MeCP2). In order to map the neuroanatomic origins of the complex neuropsychiatric behaviors observed in patients with RTT and to uncover endogenous functions of MeCP2 in the hypothalamus, we removed Mecp2 from Sim1-expressing neurons in the hypothalamus using Cre-loxP technology. Loss of MeCP2 in Sim1-expressing neurons resulted in mice that recapitulated the abnormal physiological stress response that is seen upon MeCP2 dysfunction in the entire brain. Surprisingly, we also uncovered a role for MeCP2 in the regulation of social and feeding behaviors since the Mecp2 conditional knockout (CKO) mice were aggressive, hyperphagic, and obese.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Schizophrenia	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	18832466	148	Expeimentalparadigm: Conditional associative learning task  /n  Model Generation: The generation of the D2 transgenic mice has been described in ref.1. Briefly, mice expressing the human D2R under the control of the tet operator (tetO) were generated on a C57BL/6J-CBA(J) F2 background. tetO-D2R mice were backcrossed for six to eight generations into the C57BL/6J background. For the behavioral analysis, tetO-D2R mice were crossed with mice expressing the tetracycline transactivator under the control of the calcium/calmodulin-dependent kinase IIa (CamKIIa) promoter. CamKIItTA mice were backcrossed onto 129SveVTac background for 15–17 generations. Mice were genotyped by PCR using the following primers: tetO, primer 1, GCGGCCGCCAACTCTCG, and primer 2, TCAAAACAGCGTGGATGGCGTCTC; tTA, primer 1, TAGAAGGGGAAAGCTGGCAAGATT, and primer 2, CCGCGGGGAGAAAGGAC. For studying CAL performance after switching off the transgene in the adult animal, 8- to 10-week-old mice were fed doxycycline-supplemented food (40 mg/kg; Mutual Pharmaceutical). Continuous reinforcement (CRF) training (describedbelow) was started 2 weeks after doxycycline treatment was started. For lesion studies, control littermates (single transgenics and nontransgenic wild-type mice) were used. All mice were males.  /n  Rescue: -  /n  Model Summary: To explore the nature of this deficit, we genetically modified mice to model the increase in striatal dopamine D(2) receptors (D(2)Rs) observed in patients with schizophrenia. Previously, we reported deficits in spatial working memory tasks in these mice, congruent with the working memory deficits observed in schizophrenia. However, patients with schizophrenia suffer from deficits in many executive functions, including associative learning, planning, problem solving, and nonspatial working memory. We therefore developed operant tasks to assay two executive functions, conditional associative learning (CAL) and nonspatial working memory. Striatal D(2)R-overexpressing mice show a deficit in CAL because of perseverative behavior, caused by interference from the previous trial. D(2)R up-regulation during development was sufficient to cause this deficit, because switching off the transgene in adulthood did not rescue the phenotype. We validated prefrontal dependency of CAL by using neurotoxic lesions. Lesions of the medial PFC including the anterior cingulate, infralimbic, and prelimbic cortices impair CAL because of increased interference from previously rewarded trials, exactly as observed in D(2)R transgenic mice. In contrast, lesions restricted to the infralimbic and prelimbic cortices have no effect on CAL but impair performance in the nonspatial working memory task.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Crhbp	CRHBP	protein-coding	Mus musculus	ENSMUSG00000021680	CRH-BP	12919	Aggressive Behaviors	13 D1|13 49.5 cM	Knockout	C57BL/6J	18929624	149	Expeimentalparadigm: Light-dark box test//Maternal behavior observations//Maternal aggression and pup retrieval testing//Forced swim stress test//Novel object test//Light-dark box test test//Intermale aggression testing  /n  Model Generation: CRF-BP knockout mice (Karolyi et al., 1999) on a C57BL/6J background (14 generations) were mated with high maternal defense mice that we had selectively bred for high maternal aggression (Gammie et al., 2006). A 129SVJ mouse lambda genomic DNA library (Stratagene) was screened with a mouse CRH-BP cDNA PvuII fragment (15, 17). The 17-kb DNA insert from hybridization-positive lambda clone 11C contained exons 1–6 of the mCRH-BP gene and was subcloned into pGEM-3Z (Promega). A 1.2-kb BglII fragment of the CRH-BP gene containing 5′ flanking sequences and 94 bp of the untranslated portion of exon 1 was inserted between the XhoI–NotI sites of the pPNT vector (18) as the 5′ region of homology. A 3.6-kb BamHI fragment of the CRH-BP gene containing exon 6 was inserted into the BamHI site of pPNT as the 3′ region of homology. The resulting 7.1-kb targeting vector contained the phosphoglycerate kinase (PGK)-neomycin resistance cassette (PGK-neo) in place of the translated portion of CRH-BP exon 1 and exons 2–5, and included the herpes simplex virus thymidine kinase cassette. The targeting vector was linearized with HindIII for transfection.  /n  Rescue: -  /n  Model Summary: Corticotropin-releasing factor (CRF) binding protein (CRF-BP) is a secreted protein that acts to bind and limit the activity of the neuropeptides, CRF and urocortin (Ucn) 1. We previously selected for high maternal defense (protection of offspring) in mice and found CRF-BP to be elevated in the CNS of selected mice. We also previously determined that both CRF and Ucn 1 are potent inhibitors of offspring protection when administered centrally. Thus, elevated CRF-BP could promote defense by limiting endogenous actions of CRF or Ucn 1. To test this hypothesis, we crossed the deletion for CRF-BP into the mice selected for high maternal defense and evaluated offspring protection and other maternal behaviors. CRF-BP knockout (KO) mice exhibited significant deficits in maternal aggression relative to wild-type (WT) mice in three different measures. Other maternal features were almost identical between groups, including dam and pup weight, litter size, nursing time, and pup retrieval. Both groups performed similarly in a forced swim stress test and aggression in both groups was reduced following the swim test. Virgin KO female mice exhibited higher levels of anxiety-like behavior in terms of decreased time in the light portion of the light/dark box test. For males, no differences in light/dark box or swim test were found. However, increased anxiety-like behavior in male KO mice was identified in terms of contact and approach to a novel object both with and without previous exposure to the swim test. No differences in isolation induced resident intruder male aggression were found between groups.	peptide binding,corticotropin-releasing hormone binding	Ani
Disc1	DISC1	protein-coding	Mus musculus	ENSMUSG00000043051	-	244667	Schizophrenia	8 E2|8 73.26 cM	Transgene(BAC clone)	C57BL/6JCrl;C57BL/6JCrl	18945897	150	Expeimentalparadigm: Latent inhibition//Modified porsolt swim test//Tail suspension test  /n  Model Generation: All experimental procedures were conducted in accordance with the United Kingdom Animals (Scientific Procedures) Act of 1986 and were approved by the Ethical Review Committee, University of Aberdeen, and the UK Home Office (London). The purified NruI fragment at ~5 ng/μl was injected into fertilized eggs superovulated from F1 mice of CBA/CaCrl and C57BL/6JCrl (Charles River UK) mice. Transgenic founders were identified by a 319 bp EGFP product with EGFPFor (5′-ACCATCTTCTTCAAGGACGACG-3′) and EGFPRev (5′-TGCTCAGGTAGTGGTTGTCG-3′), and by a 591 bp fragment with primers 5′-ATAATAAGCGGATGAATGGC-3′ and 5′-CTGCTCACAACCTACACACG-3′. The copy number was determined by semiquantitative PCR for 17, 21, 25 and 30 cycles, on the ratio of a 517 bp band from the endogenous Disc1 (In13For, 5′-CTACAACACAGAGCCTTGCTGC-3′ and E14Rev, 5′-AGCAGTAGCAGCGGCATTGG-3′), with a 706 bp fragment from the transgene (E8For, 5′-TTGCTGGAAGCCAAGATGCTGG-3′ and EGFPRTR2, 5′-TCACGAACTCCAGCAGGACC-3′). Experiments were performed on M19 transgenic mice and wild-type (WT) littermates from heterozygote × WT littermate breeding, on the genetic background of 50% CBA/CaCrl and 50% C57BL/6JCrl, unless specified otherwise.  /n  Rescue: -  /n  Model Summary: Disrupted-in-Schizophrenia-1 (DISC1), identified by positional cloning of a balanced translocation (1;11) with the breakpoint in intron 8 of a large Scottish pedigree, is associated with a range of neuropsychiatric disorders including schizophrenia. To model this mutation in mice, we have generated Disc1(tr) transgenic mice expressing 2 copies of truncated Disc1 encoding the first 8 exons using a bacterial artificial chromosome (BAC). With this partial simulation of the human situation, we have discovered a range of phenotypes including a series of novel features not previously reported.	protein binding,kinesin binding,identical protein binding,protein-containing complex binding,molecular adaptor activity	Ani
Cacna1b	CACNA1B	protein-coding	Mus musculus	ENSMUSG00000004113	BIII|Cav2.2|Cchn1a|alpha(1B)	12287	Aggressive Behaviors	2 A3|2 16.58 cM	Mutated	C57BL/6J;129S4/SvJae	19004821	151	Expeimentalparadigm: Resident-intruder test//Water competition test//  /n  Model Generation: For this study, homozygotes (Cav2.2–/–) in the F1 (C57BL/6J × 129S4/SvJae) background were produced by crossing heterozygous 129 co-isogenic mice (Cav2.2+/–) with heterozygous N12 C57BL/6J mice (Cav2.2+/–). The Cav2.2–/– male mice (10–15 weeks old) in the F1 background were used for behavioral tests, and wild type littermates served as control.  /n  Rescue: -  /n  Model Summary: Voltage-dependent N-type Ca(2+) channels play important roles in the regulation of diverse neuronal functions in the brain, but little is known about its role in social aggressive behaviors. Mice lacking the alpha1B subunit (Ca(v)2.2) of N-type Ca(2+) channels showed markedly enhanced aggressive behaviors to an intruder mouse in the resident-intruder test. The dorsal raphe nucleus (DRN), which contains serotonin neurons, is known to be involved in aggression in animals. We thus examined the DRN neurons in the Ca(v)2.2-deficient (Ca(v)2.2(-/-)) mice. Microinjection of omega-conotoxin GVIA, an N-type Ca(2+) channel-specific blocker, into the DRN of wild type mice resulted in escalated aggression, mimicking the phenotypes of Ca(v)2.2(-/-).	nucleotide binding,ion channel activity,voltage-gated ion channel activity,voltage-gated calcium channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,ATP binding,protein C-terminus binding,high voltage-gated calcium channel activity,metal ion binding,protein phosphatase 2A binding,voltage-gated calcium channel activity involved in regulation of presynaptic cytosolic calcium levels	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Attention-Deficit/Hyperactivity Disorder	10|10 D2	Knockin	C57BL/6;CC57BR/Mv	19006079	152	Expeimentalparadigm: Open field test//Forced swim test//Intermale aggression test  /n  Model Generation: The parental C57BL/6J (B6) and CC57BR/Mv (BR) strains have been maintained for at least 50 generations using close inbreeding at the Institute of Cytology and Genetics. The CC57BR/Mv strain was created from a hybrid progeny between C57BL and BALB strains and therefore is kindred to the B6 strain (Medvedev, 1969). The partially congenic B6-1473G and B6-1473C lines were created from F1(B6×BR) hybrids between B6 and BR strains using three successive backcrossings of heterozygous males with females of the B6 strain. The heterozygous backcrosses of the third generation were intercrossed to generate B6-1473C and B6-1473G progeny with C/C and G/G genotypes, respectively (Fig. 1). The genome of these lines thus consists of 94% B6 genome and 6% BR genome.  /n  Rescue: -  /n  Model Summary: The C1473G polymorphism is involved in the determination of TPH2 activity and is linked to aggression intensity and forced-swim immobility in mice. At the same time, the polymorphism does not affect locomotion and anxiety-related behavior in the open field test. The B6-1473C and B6-1473G mice represent a valuable experimental model for investigating molecular mechanisms of serotonin-related behavior.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Nlgn2	NLGN2	protein-coding	Mus musculus	ENSMUSG00000051790	NL2|NLG2	216856	Anxiety Disorder	11|11 B3	Knockout	129S6/SvEvTac;C57BL/6J;C57BL/6NCrl;129S2/SvPasCrlf	19016888	153	Expeimentalparadigm: Locomotor//Light-dark box//Open field test//Rotarod//Social interaction with a juvenile//Social learning//Social vs. inanimate preference test//Preference for social novelty test//Social interaction with an adult caged conspecific//Hot plate sensitivity//Shock threshold.  /n  Model Generation: Neuroligin-2 knockout (KO) mice were generated using SM1 embryonic stem cell clone derived from 129S6/SvEvTac mouse, and the resulting chimeric mice were bred with C57BL/6J mice to obtain F1 heterozygous KO mice. Thus, the F1 mice were on a 129S6/SvEvTac/C57BL/6J hybrid background. KO mice were maintained by interbreeding mice heterozygous for the NL2 allele for approximately 30 generations. Littermates were used for the breeding in some generations, though this was avoided as much as possible. Prior to the behavioral study, KO mice were backcrossed to C57BL/6NCrl mice for two generations and subsequently to 129S2/SvPasCrlf mice for another two generations. Resulting NL2 heterozygote mice were interbred and resulting age and sex-matched littermate pair offspring were used for behavioral studies. The use of such a hybrid background minimizes the possibility of deleterious recessive mutations that occur in inbred strains being homozygous in the experimental mice.  /n  Rescue: -  /n  Model Summary: This decrease in inhibitory synaptic function in NL2-deficient mice correlates with a discrete behavioral phenotype that includes a marked increase in anxiety-like behavior, a decrease in pain sensitivity, and a slight decrease in motor coordination. This work confirms that NL2 modulates inhibitory synaptic function and is the first demonstration that global deletion of neuroligin 2 can lead to a selective behavioral phenotype.	protein binding,signaling receptor activity,neurexin family protein binding,identical protein binding,cell adhesion molecule binding	Ani
Fkbp1a	FKBP1A	protein-coding	Mus musculus	ENSMUSG00000032966	FKBP12|Fkbp|Fkbp1	14225	Obsessive Compulsive Disorder	2|2 G3	Conditional Knockout	CamKIIα-Cre;CamKII-Cre/Fkbp12+fl/fl	19081378	154	Expeimentalparadigm: Associative conditioned fear//Marble burying//Novel object recognition//Morris water maze//Arm Reversal in Y-maze  /n  Model Generation: Mice with floxed FKBP12 (Fkbp12fl) alleles were generated as described previously (Tang et al., 2004). Linearized Fkbp12 loxP targeting vector was electroporated into the AB2.1 ES cell line containing the original Fkbp12 null allele. Mice expressing the cre recombinase Tg(CamkIIα-cre) (T-29-1), referred to as CamKIIα-Cre were kindly provided by Dr. S. Tonegawa. Mice were genotyped using Cre-specific primers and primers that identify floxed alleles of the FKBP12 locus. The wild-type mice used in this study were CamKII-Cre/Fkbp12++/+ and cKO mice used in this study were CamKII-Cre/Fkbp12+fl/fl.  /n  Rescue: -  /n  Model Summary: Behaviorally, FKBP12 conditional knockout (cKO) mice displayed enhanced contextual fear memory and autistic/obsessive-compulsive-like perseveration in several assays including the water maze, Y-maze reversal task, and the novel object recognition test. Our results indicate that FKBP12 plays a critical role in the regulation of mTOR-Raptor interactions, LTP, memory, and perseverative behaviors.	peptidyl-prolyl cis-trans isomerase activity,transforming growth factor beta receptor binding,protein binding,FK506 binding,isomerase activity,enzyme binding,Hsp70 protein binding,type I transforming growth factor beta receptor binding,identical protein binding,transmembrane transporter binding,SMAD binding,activin binding	Ani
Pten	PTEN	protein-coding	Mus musculus	ENSMUSG00000013663	2310035O07Rik|A130070J02Rik|B430203M17Rik|MMAC1|PTENbeta|TEP1	19211	Autism Spectrum Disorder	19 C1|19 28.14 cM	Knockout	C57BL/6	19211884	155	Expeimentalparadigm: Open field test//Social interaction test  /n  Model Generation: PtenloxP<U+00A0>mice (Suzuki et al., 2001) were a gift from Dr. Tak Mak (University of Toronto, Toronto, Ontario, Canada), and the<U+00A0>Nse–cre<U+00A0>line was generated in the laboratory of Dr. Suzanne J. Baker (St. Jude Children's Research Hospital, Memphis, TN) and characterized in our laboratory (Kwon et al., 2006b). Both lines have been maintained in<U+00A0>C57BL/6<U+00A0>inbred background.<U+00A0>Pten<U+00A0>mutant mice (Nse–cre;PtenloxP/loxP) were generated by breeding male<U+00A0>PtenloxP/loxP<U+00A0>mice and female<U+00A0>Nse–cre;PtenloxP/+<U+00A0>mice. Controls used here were littermates either without<U+00A0>cre<U+00A0>or in a few cases<U+00A0>Nse–cre;PtenloxP/+.<U+00A0>Tsc1loxP<U+00A0>mice were a gift from Dr. David Kwiatkowski (Harvard Medical School, Boston, MA) and were crossed with the<U+00A0>Nse–cre<U+00A0>line by a similar strategy.  /n  Rescue: Here, we report that rapamycin, a specific inhibitor of mammalian target of rapamycin complex 1 (mTORC1), can prevent and reverse neuronal hypertrophy, resulting in the amelioration of a subset of PTEN-associated abnormal behaviors, providing evidence that the mTORC1 pathway downstream of PTEN is critical for this complex phenotype.  /n  Model Summary: We previously generated a conditional<U+00A0>Pten<U+00A0>knock-out mouse line with<U+00A0>Pten<U+00A0>loss in limited postmitotic neurons in the cortex and hippocampus.<U+00A0>Pten-null neurons developed neuronal hypertrophy and loss of neuronal polarity. The mutant mice exhibited macrocephaly and behavioral abnormalities reminiscent of certain features of human autism.<U+00A0>	phosphatidylinositol-3-phosphate phosphatase activity,phosphoprotein phosphatase activity,protein serine/threonine phosphatase activity,protein tyrosine phosphatase activity,platelet-derived growth factor receptor binding,protein binding,anaphase-promoting complex binding,phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity,hydrolase activity,phosphatase activity,myosin phosphatase activity,enzyme binding,protein kinase binding,PDZ domain binding,ionotropic glutamate receptor binding,identical protein binding,inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity,phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity,molecular function inhibitor activity,ubiquitin-specific protease binding,protein tyrosine kinase binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Aggressive Behaviors	2 A3|2 17.14 cM	Knockout	C57BL/6J;129S6	19232330	156	Expeimentalparadigm: Resident-Intruder paradigm//Forced swim procedure  /n  Model Generation: NR1neo/neo mice were generated by incorporating a neomysin resistance gene (neo) into an intron 20 of the NR1 (Grin1) locus as described in detail (Mohn et al., 1999). The initial mutation was inserted in mice on a mixed genetic background consisting of alleles derived from 129/SvEv, C57BL/6, and DBA/2 (Mohn et al., 1999). This insertion mutation greatly reduced expression of the NR1 gene in all brain regions thus far examined. To obtain mice that differ genetically only at the NR1 locus, a strategy was devised to generate NR1 hypomorphic mice and genetically identical wild type populations (Duncan et al., 2004). C57BL/6 heterozygous animals (NR1+/neo) were intercrossed with 129S6 heterozygous animals. All of the F1 offspring of these litters are genetically identical at all loci except at the NR1 gene. The 129S6 (Taconic) mice were used as breeding females and were co-isogenic. C57BL/6 mice were backcrossed > 14 generations from C57BL/6J mice purchased from Jackson Laboratories. The NR1 mutation was maintained on the C57BL/6J and 129S6 genetic backgrounds by breeding heterozygous animals. Resulting heterozygous offspring from these crosses were used to maintain the lines and to provide heterozygous breeders for the generation of the F1 hybrid homozygous mice (NR1neo/neo) and their control populations (NR1). Both male and female mice 7–8 months of age were used in these studies.+/+  /n  Rescue: -  /n  Model Summary: To gain insight into neuroanatomical circuits disrupted by reduced NMDA receptor function, the present work compared regional brain activation in NR1 hypomorphic mice and their wild type controls after a resident-intruder test. Induction of Fos protein was used as an index of neuronal activation. Wild type mice exhibited robust induction of Fos in select brain regions, including specific nuclei of the hypothalamus and amygdala, lateral septum, and widespread regions of the cerebral cortex. Although the behavioral patterns were different for male and female mice, neuroanatomical patterns of Fos induction were remarkably similar for the two sexes. To determine socially specific components of Fos induction by the resident-intruder test, responses were compared for mice assessed in a test of general arousal and stress involving forced swim. Some common brain regions were activated by both tests but regionally specific differences were also found. The NR1 hypomorphic mice tested in the resident-intruder procedure displayed distinctly different behavioral interactions compared to the wild type mice and exhibited a significantly blunted Fos response in almost all brain regions. The mutant mice also exhibited reduced Fos in response to swim stress in specific brain regions.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Camk2a	CAMK2A	protein-coding	Mus musculus	ENSMUSG00000024617	CaMKII|mKIAA0968	12322	Aggressive Behaviors	18 E1|18 34.41 cM	Overexpression	C57BL/6N	19257910	157	Expeimentalparadigm: Open field test//Elevated zero maze//Light-dark box test//Social interaction test//Locomotor activity monitoring in the home cage//Rotarod//Resident-intruder test  /n  Model Generation: To introduce MluI restriction sites at the 5' and 3' ends of the cDNA encoding alpha-CaMKII, a plasmid containing wild-type CaMKII (kindly provided by Dr. Alcino J. Silva) was amplified by PCR with the following primers: forward primer, GGGGATATCGCCGCCACCATGGACTACAAGGACGACGATGACAAACTCAAAACGCGTGCTACCATCACCTGCACCCGATTC, and reverse primer, GGGGATATCACGCGTTCAATGCGGCAGGACGGA. The resulting fragment was ligated with a 12.5 kb MluI fragment containing the alpha-CaMKII promoter, a hybrid intron in the 5' untranslated leader sequence, Kozak consensus sequence, FLAG-tag sequence following an initiation codon and the SV40 polyadenylation signals from pMM-403-CaMKIV [18,19], generating a new construct, pMM-403-alpha-CaMKII. The transgene contained an alpha-CaMKII promoter, a hybrid intron in the 5' untranslated leader sequence, the coding region of alpha-CaMKII and a SV40 polyadenylation [poly (A)] signal. pMM-403-alpha-CaMKII was digested with SfiI and transgenic mice were generated by injecting the purified insert into the pronuclei of C57BL/6N mice (Charles River, Kanagawa, Japan). Genotyping was performed by Southern blot analysis using a probe derived from a 1.1 kb fragment produced by EcoRV/NotI digestion [SV40 poly (A) probe] from pNN-265-LBDG521R-CREBS133A [18].  /n  Rescue: -  /n  Model Summary: We generated transgenic mice overexpressing alpha-CaMKII in the forebrain under the control of the alpha-CaMKII promoter. In contrast to alpha-CaMKII (+/-) heterozygous knockout mice, alpha-CaMKII overexpressing mice display an increase in anxiety-like behaviors in open field, elevated zero maze, light-dark transition and social interaction tests, and a decrease in locomotor activity in their home cages and novel environments; these phenotypes were the opposite to those observed in alpha-CaMKII (+/-) heterozygous knockout mice. In addition, similarly with alpha-CaMKII (+/-) heterozygous knockout mice, alpha-CaMKII overexpressing mice display an increase in aggression. However, in contrast to the increase in defensive aggression observed in alpha-CaMKII (+/-) heterozygous knockout mice, alpha-CaMKII overexpressing mice display an increase in offensive aggression.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,calmodulin-dependent protein kinase activity,protein binding,calmodulin binding,ATP binding,calcium-dependent protein serine/threonine kinase activity,kinase activity,transferase activity,GTPase activating protein binding,glutamate receptor binding,identical protein binding,protein homodimerization activity,metal ion binding	Ani
Gpr3	GPR3	protein-coding	Mus musculus	ENSMUSG00000049649	Gpcr20|Gpcr21|Gpcr3	14748	Aggressive Behaviors	4|4 D2.3	Knockout	NA	19259266	158	Expeimentalparadigm: Locomotion test//Open field test//Skill learning and motor coordination on rota-rod//Elevated plus maze//Resident-intruder test//Forced swim test//Tail suspension test//Active avoidance procedure  /n  Model Generation: The generation of Gpr3-/- mice and their genotyping by polymerase chain reaction (PCR) amplification of tail DNA were described previously [7]. Heterozygous progeny were backcrossed with CD1 females for 12-17 generations before generating the Gpr3-/- and Gpr3+/+ founders. Experimental Gpr3-/- and Gpr3+/+ mice were generated by a syngenic cross between founders.  /n  Rescue: -  /n  Model Summary: We investigated the consequences of its genetic deletion in several behavioral paradigms and on neurotransmission. Compared to wild-type, hippocampal neurons from Gpr3(-/-) mice displayed lower basal intracellular cAMP levels, consistent with the strong constitutive activity of GPR3 in transiently transfected cells. Behavioral analyses revealed that Gpr3(-/-) mice exhibited a high level of avoidance of novel and unfamiliar environment, associated with increased stress reactivity in behavioral despair paradigms and aggressive behavior in the resident-intruder test. On the contrary, no deficit was found in the learning ability to avoid an aversive event in active avoidance task. The reduced ability of Gpr3(-/-) mice to cope with stress was unrelated to dysfunction of the hypothalamic-pituitary-adrenal axis, with Gpr3(-/-) mice showing normal corticosterone production under basal or stressful conditions. In contrast, dramatic alterations of monoamine contents were found in hippocampus, hypothalamus and frontal cortex of Gpr3(-/-) mice.	G protein-coupled receptor activity	Ani
Drd4	DRD4	protein-coding	Mus musculus	ENSMUSG00000025496	D4R|Drd-4	13491	Attention-Deficit/Hyperactivity Disorder	7 F5|7 86.6 cM	Knockout	C57BL/6	19282420	159	Expeimentalparadigm: Locomotion test//Conditioned place preference  /n  Model Generation: Adolescent (4–6-week-old) male 20–25 g) mice (see experiments below for sample size), congenic (i.e. backcrossed onto inbred C57Bl/6J mice for more than 10 generations), were derived from mating D4R heterozygotes (129/OlaxC57Bl/6J) as previously described (Rubinstein, et al., 1997) were used in this study.  /n  Rescue: -  /n  Model Summary: In the locomotor test, D4 receptor KO mice displayed attenuated increases in AMPH-induced locomotor activity whereas responses to cocaine and MP did not differ. These results suggest distinct mechanisms for D4 receptor modulation of the reinforcing (perhaps via attenuating dopaminergic signalling) and locomotor properties of these stimulant drugs. Thus, individuals with D4 receptor polymorphisms might show enhanced reinforcing responses to MP and AMPH and attenuated locomotor response to AMPH.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,SH3 domain binding,neurotransmitter receptor activity,dopamine binding,identical protein binding,metal ion binding,epinephrine binding,norepinephrine binding,heterocyclic compound binding	Ani
Slc6a9	SLC6A9	protein-coding	Mus musculus	ENSMUSG00000028542	Glyt-1|Glyt1	14664	Cognitive Disorders	4 D1|4 53.62 cM	Conditional Knockout	C57BL/6	19332109	160	Expeimentalparadigm: Elevated plus maze//Hanging wire//Rotarod//Conditioned freezing//Active avoidance learning//Object recognition test  /n  Model Generation: Briefly, to achieve neuron plus glia forebrain-selective recombination of the floxed<U+00A0>GlyT1<U+00A0>allele, conditional GlyT1 knockout mice<U+00A0>GlyT1tm1.2fl/fl<U+00A0>(Yee et al., 2006) were bred with<U+00A0>Emx1Cre/Cre<U+00A0>mice, which contain a Cre-recombinase gene “knocked in” into the endogenous Emx1 locus (Iwasato et al., 2000) resulting in ubiquitous dorsal telencephalon specific expression of Cre in both neurons and astrocytes and minor ectopic expression of Cre beyond the forebrain. Further breeding resulted in<U+00A0>Emx1Cre:GlyT1tm1.2fl/fl<U+00A0>mice (referred to in the following as “mutant”). Subjects used in this study were generated by breeding<U+00A0>Emx1Cre:GlyT1tm1.2fl/fl<U+00A0>mice with<U+00A0>GlyT1tm1.2fl/fl<U+00A0>mice (referred to in the following as “control”) thus producing mutants and controls in a 1:1 ratio as littermates and keeping mutants homozygous for the<U+00A0>GlyT1tm1.2fl<U+00A0>allele and heterozygous for the<U+00A0>Emx1Cre<U+00A0>allele. All subjects were generated and maintained on a pure C57BL/6 background.<U+00A0>  /n  Rescue: -  /n  Model Summary: Altered mnemonic functions and resistance to NMDA receptor antagonism by forebrain conditional knockout of glycine transporter 1	amino acid:sodium symporter activity,glycine transmembrane transporter activity,symporter activity,glycine:sodium symporter activity	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Posttraumatic Stress Disorder	2 E3|2 56.63 cM	Knockin	C57Bl/6	19339601	161	Expeimentalparadigm: Unconditioned taste preferences test//conditioned taste aversion test  /n  Model Generation: The replacement targeting vector consisted of a 7.0 kb 129 SV (Stratagene, La Jolla, CA) mouse genomic fragment containing the single-exon BDNF-coding sequence. The<U+00A0>neo<U+00A0>gene with the phosphoglycerate kinase 1 promoter and the bovine growth hormone polyadenylation sequence (pGKneobpA) was introduced into a<U+00A0>SalI site to disrupt the coding exon as a positive selectable marker (Fig.<U+200B>(Fig.11a). A pGK–thymidine kinase cassette was used as a negative selectable maker.Two independent targeted ES cell BDNF recombinant clones injected into C57Bl/6 blastocysts generated chimeras that transmitted the mutated BDNF allele to the progeny exhibiting indistinguishable phenotypes.  /n  Rescue: Finally, this delay in extinction learning could be rescued pharmacologically with a cognitive enhancer,<U+00A0>d-cycloserine (DCS).  /n  Model Summary: Using the CTA paradigm, we found a novel impairment in extinction learning, but not acquisition or retention, of aversive memories resulting from the variant BDNFMet. BDNFMet<U+00A0>mice were slower to extinguish an aversive CTA memory compared with wild-type counterparts.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Nlgn3	NLGN3	protein-coding	Mus musculus	ENSMUSG00000031302	A230085M13Rik|HNL3|NL3|NLG3	245537	Autism Spectrum Disorder	X|X D	Knockin	C57BL/6J	19360662	162	Expeimentalparadigm: Ultrasonic vocalizations//Reciprocal social play//Open field test//Automated three-chambered sociability apparatus//Elevated plus maze//Dark-light box test//Nesting//Rotarod coordination//forepaw reaching for vision//Acoustic startle threshold for hearing//Prepulse inhibition of acoustic startle for sensorimotor gating//Hot plate//Tail flick for pain sensitivity//Contextual and cued fear conditioned learning and memory//Morris water maze  /n  Model Generation: Twenty mice (10 male and 10 female) homozygous for the neuroligin-3 R451C mutation were shipped from Rockefeller University in New York, NY to NIMH in Bethesda, MD for behavioral testing. Homozygotes were mated with C57BL/6J (The Jackson Laboratory, Bar Harbor, ME) to produce Cohort 1. Because the gene that codes for NL3 is located on the X chromosome, Cohort 1 contained litters in which all females were heterozygous (Het), and males were either full mutant (NL3) or full wildtype (WT), depending on the mother. Heterozygote females from Cohort 1 were mated with either C57BL/6J or NL3 knockin males to generate Cohorts 2 and 3, consisting of wildtype (WT) or NL3 males and wildtype (WT), heterozygous (Het), or homozygous (NL3) females. Identical behavioral tests were conducted with offspring from both breeding schemes. When tests were run with both types of cohorts, they were analyzed for genotype of the dam. Tailsnips were genotyped at Rockefeller University, as described in Supplementary Material.  /n  Rescue: -  /n  Model Summary: Mice with the human R451C mutation (NL3), identical to the point mutation found in two brothers with autism spectrum disorders, were generated and phenotyped in multiple behavioral assays with face validity to the diagnostic symptoms of autism. No differences between NL3 and their wildtype (WT) littermate controls were detected on measures of juvenile reciprocal social interaction, adult social approach, cognitive abilities, and resistance to change in a spatial habit, findings which were replicated in several cohorts of males and females. Physical and procedural abilities were similar across genotypes on measures of general health, sensory abilities, sensorimotor gating, motor functions, and anxiety-related traits. Minor developmental differences were detected between NL3 and WT, including slightly different rates of somatic growth, slower righting reflexes at postnatal days 2-6, faster homing reflexes in females, and less vocalizations on postnatal day 8 in males. Significant differences in NL3 adults included somewhat longer latencies to fall from the rotarod, less vertical activity in the open field, and less acoustic startle to high decibel tones.	signaling receptor activity,neurexin family protein binding,cell adhesion molecule binding,molecular adaptor activity,scaffold protein binding	Ani
Avpr1b	AVPR1B	protein-coding	Mus musculus	ENSMUSG00000026432	AVPR3|V3/V1b|VIBR|VPR3	26361	Aggressive Behaviors	1|1 E4	Knockout	C57BL/6;129/SvJ	19419666	163	Expeimentalparadigm: Aggression test//Social recognition test//Basile Rotor-rod and hanging wire cage//Vision test//Food consumption//Body temperature//Hidden-cookie test//Sex behavior test//Elevated plus maze//Open field test//Morris water maze  /n  Model Generation: A 1FIX II mouse 129/SvJ genomic library (Stratagene, La Jolla, CA, USA) was screened with a 32P-labelled PvuII fragment of a rat V1bR cDNA. Two independent clones were identified and the largest (~16.6 kb; GENBANK Accession Nos AF152533 and AF152534) was used to construct the targeting vector. A 1.2-kb PvuII fragment 5′ to the coding region for transmembrane regions I–VI was inserted in the targeting vector pPNT at the XhoI site. The 1.7-kb PstI/SacI piece containing the 3′ end of the exon (TMVI) and most of the following introns were inserted at the HincII site of pPNT (this destroyed the thymidine kinase selection). The targeting construct thus eliminated the V1bR coding region from the initiating methionine just prior to TMVI. The construct was linearized with NotI and electroporated into embryonic stem cells for selection as described previously.22 Two embryonic stem cell clones were identified by PCR and confirmed by Southern analysis. Chimeric mice were generated from one of them and germ line transmission was observed. Genotyping was performed by PCR.  /n  Rescue: -  /n  Model Summary: To this end, we crossed our Avpr1b(-/-) mice with Mus musculus castaneus, one of the few sub-species that will breed with laboratory strains. Subsequent F(2) offspring were tested in a resident-intruder behavioral test to assess aggressive behavior. We found that even on this more "wild" background, Avpr1b(-/-) mice continued to demonstrate longer attack latencies and fewer attacks in a resident-intruder test than wildtype littermates. These findings are consistent with previous reports of reduced aggressive behavior in Avpr1b(-/-) mice and show that the deficit does persist on a different background strain.	G protein-coupled receptor activity,vasopressin receptor activity,peptide binding	Ani
Inhbe	INHBE	protein-coding	Mus musculus	ENSMUSG00000047492	-	16326	Aggressive Behaviors	10 D3|10 74.5 cM	Overexpression	C57BL/6	19463785	164	Expeimentalparadigm: Elevated plus maze//Resident–intruder test  /n  Model Generation: C57BL/6 and A/J mice were obtained from SLC Japan (Hamamatsu, Japan). The generation of TgActβE mice has been described previously [9]. Standard procedures were followed in order to generate transgenic mice [18]. Female C57BL/6 and male C3H/He mice were obtained from SLC Japan (Hamamatsu, Japan) and mated to obtain B6C3F1 mice. pCAGGS-ActE was digested with SalI and BamHI. The 3.5-kbp transgene fragment was isolated by agarose gel electrophoresis and purified with a GENECLEAN Kit (BIO 101). The purified transgene was microinjected into pronuclei of fertilized eggs from B6C3F1 mice at a concentration of 5 μg/μl. After overnight incubation, embryos at the two-cell stage were transferred into the oviducts of pseudopregnant ICR females. To identify the presence of the transgene in the transgenic founders, genomic DNA prepared from tail biopsies was screened by PCR analysis using the primers 5′-TGACCAAGCAGCAGCAAATCCTGGAT-3′ and 5′-CTTTGAGGAGGCTGAAGACG-3′. Southern blot hybridization was performed using the coding region of human activin βE subunit cDNA as a probe. The signal was detected by ALKPhos Direct for chemifluorescence (Amersham Pharmacia Biotech) according to the manufacturer’s instructions. The transgenic mice were backcrossed to C57BL/6 mice and analyzed together with littermate controls after three to six generations of backcrossing. Experimental procedures and the care of animals were performed in accordance with the requirements of the Institutional Animal Care Committee at Kitasato University, in compliance with NIH guidelines.  /n  Rescue: -  /n  Model Summary: To study the function of activin E, a TGF-beta superfamily member, in the regulation of affective behavior, we investigated the behavior of transgenic mice overexpressing activin E (TgActbetaE mice). Male TgActbetaE mice showed aggressive behavior in resident-intruder tests. In elevated plus-maze tests, the percentage of open arm entries was significantly increased in female TgActbetaE mice compared with that in wild-type mice. Furthermore, female TgActbetaE mice stayed in the central area for a significantly longer time than wild-type mice in open field tests.	cytokine activity,hormone activity,growth factor activity	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Attention-Deficit/Hyperactivity Disorder	10|10 D2	Knockout	C57BL/6	19520831	165	Expeimentalparadigm: Maternal care  /n  Model Generation: A Tph2+/- embryonic stem (ES) cell line was created by homologous recombination of an “expression-selection cassette” described below into the Tph2 locus of the ES cell line E14Tg2A (BayGenomics) leading to the deletion of a 5.2-kb-long region, which contains the coding part of exon 1 (Ex1) and Ex2, and, thus, disabling the transcription and translation of the entire Tph2 gene (Fig. S1A). Tph2+/- ES cells were injected into C57BL/6 blastocysts and transferred into pseudopregnant females. After transmission of the knockout allele from chimera to F1 generation, Tph2-/- mice were obtained from heterozygous breeding and the line was further maintained on the mixed background by breeding +/- with +/- animals. To obtain such mice on a pure genetic background, we bred F1 (129/OlaHsd/C57BL/6 background) heterozygous Tph2-deficient animals to the inbred FVB/N and C57BL/6 mouse line (Charles River) for 7 and 6 generations, respectively.  /n  Rescue: -  /n  Model Summary: We created mice (Tph2(-/-)) that lack serotonin in the central nervous system. Surprisingly, these mice can be born and survive until adulthood. However, depletion of serotonin signaling in the brain leads to growth retardation and 50% lethality in the first 4 weeks of postnatal life. Telemetric monitoring revealed more extended daytime sleep, suppressed respiration, altered body temperature control, and decreased blood pressure (BP) and heart rate (HR) during nighttime in Tph2(-/-) mice. Moreover, Tph2(-/-) females, despite being fertile and producing milk, exhibit impaired maternal care leading to poor survival of their pups.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Nrcam	NRCAM	protein-coding	Mus musculus	ENSMUSG00000020598	Bravo|C030017F07Rik|C130076O07Rik|mKIAA0343	319504	Autism Spectrum Disorder	12 B2|12 20.71 cM	Knockout	129S6/Sv;Swiss Webster	19540269	166	Expeimentalparadigm: Elevated plus maze//Olfactory test//Open field test//Rotarod//Sociability and preference//Acoustic startle procedure//Water maze  /n  Model Generation: Wild type (Nrcam+/+) and null mutant (Nrcam-/-) mice were on a mixed 129S6/SvEvTac (129S6) × Swiss Webster (CFW) background [36], maintained by heterozygous matings from breeder stock kindly provided by Dr. Martin Grumet (Rutgers University, Piscataway, NJ).  /n  Rescue: -  /n  Model Summary: Overall, the loss of Nrcam led to behavioral alterations in sociability, acquisition of a spatial task, and reversal learning, dependent on sex. In comparison to male wild type mice, male Nrcam-null mutants had significantly decreased sociability in a three-chambered choice task. Low sociability in the male null mutants was not associated with changes in anxiety-like behavior, activity, or motor coordination. Male, but not female, Nrcam-null mice had small decreases in prepulse inhibition. Nrcam deficiency in female mice led to impaired acquisition of spatial learning in the Morris water maze task. Reversal learning deficits were observed in both male and female Nrcam-null mice. These results provide evidence that NRCAM mediates domains of function relevant to symptoms observed in autism.	protein binding,ankyrin binding,protein binding involved in heterotypic cell-cell adhesion,cell-cell adhesion mediator activity	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockdown	C57BL/6J	19553461	167	Expeimentalparadigm: Radial arm maze learning task  /n  Model Generation: Wild-type (WT) and dopamine transporter (DAT) knock-out (KO) littermates were generated from heterozygotes that had been backcrossed over 10 generations onto the C57BL/6J background. DAT-KO mice lack the gene encoding the plasma membrane transporter that regulates spatial and temporal extracellular dopamine (DA) signaling (Giros et al., 1996). Because of loss of the DAT, these mutants exhibit a persistent fivefold increase in extracellular striatal DA levels (Giros et al., 1996; Gainetdinov and Caron, 2003) and show locomotor hyperactivity, deficits in cognitive functions, deficits in sensorimotor gating, and altered hippocampal activity during awake behavioral periods (Giros et al., 1996; Gainetdinov et al., 1999; Dzirasa et al., 2006).  /n  Rescue: -  /n  Model Summary: Here, we investigated neural phase signaling in two mouse models of cognitive dysfunction: mice with genetically induced hyperdopaminergia [dopamine transporter knock-out (DAT-KO) mice] and mice with genetically induced NMDA receptor hypofunction [NMDA receptor subunit-1 knockdown (NR1-KD) mice]. Cognitive function in these mice was assessed using a radial-arm maze task, and local field potentials were recorded from dorsal hippocampus and prefrontal cortex as DAT-KO mice, NR1-KD mice, and their littermate controls engaged in behavioral exploration. Our results demonstrate that both DAT-KO and NR1-KD mice display deficits in spatial cognitive performance.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Schizophrenia	13 C1|13 40.1 cM	Knockout	C57BL/6J	19553461	168	Expeimentalparadigm: Radial arm maze learning task  /n  Model Generation: Wild-type (WT) and dopamine transporter (DAT) knock-out (KO) littermates were generated from heterozygotes that had been backcrossed over 10 generations onto the C57BL/6J background. DAT-KO mice lack the gene encoding the plasma membrane transporter that regulates spatial and temporal extracellular dopamine (DA) signaling (Giros et al., 1996). Because of loss of the DAT, these mutants exhibit a persistent fivefold increase in extracellular striatal DA levels (Giros et al., 1996; Gainetdinov and Caron, 2003) and show locomotor hyperactivity, deficits in cognitive functions, deficits in sensorimotor gating, and altered hippocampal activity during awake behavioral periods (Giros et al., 1996; Gainetdinov et al., 1999; Dzirasa et al., 2006).  /n  Rescue: -  /n  Model Summary: Here, we investigated neural phase signaling in two mouse models of cognitive dysfunction: mice with genetically induced hyperdopaminergia [dopamine transporter knock-out (DAT-KO) mice] and mice with genetically induced NMDA receptor hypofunction [NMDA receptor subunit-1 knockdown (NR1-KD) mice]. Cognitive function in these mice was assessed using a radial-arm maze task, and local field potentials were recorded from dorsal hippocampus and prefrontal cortex as DAT-KO mice, NR1-KD mice, and their littermate controls engaged in behavioral exploration. Our results demonstrate that both DAT-KO and NR2-KD mice display deficits in spatial cognitive performance.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Schizophrenia	2 A3|2 17.14 cM	Knockout	C57BL/6J;129S6/SvEvTac	19563516	169	Expeimentalparadigm: Social choice test//Elevated zero-maze//Open field test//Locomotor activity  /n  Model Generation: The NR1neo-/- mice (Mohn et al. 1999) were obtained from the laboratory of Dr. Beverly Koller (The University of North Carolina at Chapel Hill) and a breeding colony was established at AstraZeneca Pharmaceuticals LP (Wilmington DE 19850, USA). Their breeding involves three populations of mice: NR1neo+/- heterozygotes maintained on C57BL/6J background (Jackson Laboratory), NR1neo+/- heterozygotes maintained on 129S6/SvEvTac background (Taconic Farm), and an intercross between female C57BL/6J NR1neo+/- and male 129S6/SvEvTac NR1neo+/-. The progeny from the intercross are genetically identical F1 hybrids with the exception at the NR1 locus: 50% NR1neo+/-, 25% NR1neo-/- and 25% wild type (WT). A PCR protocol provided by B. Koller was used for genotyping these mice: NR1 (+) fwd primer (intron 20) 5'TGA GGG GAA GCT CTT CCT GT3'; NR1 (-) fwd primer (neo) 5'GCT TCC TCG TGC TTT ACG GTA T3'; NR1 common reverse primer (intron 20) 5'AAG CGA TTA GAC AAC TAA GGG T3'. For experiments described here, only male mice were used. Two cohorts of 16 NR1neo-/- and 16 wild type littermates were generated by AstraZeneca Neuroscience (Wilmington, DE 19850, USA) and arrived at the University of Pennsylvania when 8 weeks old. A third cohort of 8 NR1neo-/- and 8 wild type littermates was later generated and housed at Astra Zeneca Neuroscience to verify the results of locomotor activity testing collected from cohort 1 (Table 1).  /n  Rescue: -  /n  Model Summary: We evaluated electrophysiological and behavioral properties of NMDAR deficiency utilizing mice that express only 5-10% of the normal level of NMDAR NR1 subunit. Auditory and visual event related potentials yielded significantly increased amplitudes for the P20 and N40 components in NMDAR deficient (NR1(neo)-/-) mice suggesting decreased inhibitory tone. Compared to wild types, NR1(neo)-/- mice spent less time in social interactions and showed reduced nest building. NR1(neo)-/- mice displayed a preference for open arms of a zero maze and central zone of an open field, possibly reflecting decreased anxiety-related behavioral inhibition. However, locomotor activity did not differ between groups in either home cage environment or during behavioral testing. NR1(neo)-/- mice displayed hyperactivity only when placed in a large unfamiliar environment, suggesting that neither increased anxiety nor non-specific motor activation accounts for differential behavioral patterns.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Nrg1	NRG1	protein-coding	Mus musculus	ENSMUSG00000062991	6030402G23Rik|ARIA|D230005F13Rik|GGF|GGFII|HRG|HRGalpha|Hgl|NDF|Pro-NRG1|SMDF	211323	Schizophrenia	8|8 A3	Mutated	C57BL/6/129	19643092	170	Expeimentalparadigm: Pre pulse inhibition//Fear conditioning test//Novel object recognition//Locomotor test  /n  Model Generation: Nrg1+/- mice were obtained from C. Birchmeier (Meyer and Birchmeier, 1995) and bred on a C57BL/6/129 hybrid background at the University of Pennsylvania. Briefly, exon 6 of the neuregulin gene is fused to beta-galactosidase, which results in partial deletion of the EGF like domains of all three major types of Nrg1.  /n  Rescue: -  /n  Model Summary: Behavior of Nrg1(+/-) mice and their wild type littermates was evaluated using pre-pulse inhibition, contextual fear conditioning, novel object recognition, locomotor, and social choice paradigms. Event-related potentials (ERPs) were recorded to assess auditory gating and novel stimulus detection. Gating of ERPs was unaffected in Nrg1(+/-) mice, but mismatch negativity in response to novel stimuli was attenuated. The Nrg1(+/-) mice exhibited behavioral deficits in contextual fear conditioning and social interactions, while locomotor activity, pre-pulse inhibition and novel object recognition were not impaired.	transcription coregulator activity,signaling receptor binding,ErbB-2 class receptor binding,integrin binding,protein binding,growth factor activity,protein tyrosine kinase activator activity,receptor tyrosine kinase binding,ErbB-3 class receptor binding,chemorepellent activity,receptor ligand activity	Ani
Atp1a3	ATP1A3	protein-coding	Mus musculus	ENSMUSG00000040907	Atpa-2	232975	Bipolar Disorder	7 A3|7 13.73 cM	Mutated	C57BL/6NCr	19666602	171	Expeimentalparadigm: Locomotion test//Spontaneous epileptic seizures  /n  Model Generation: Here, we present a mouse model for epilepsy caused by mutation of the Na,K-ATPase α3-isoform. We have used in vivo mutagenesis with N-nitroso-N-ethylurea (ENU) (14) to generate a mutant named Myshkin (Myk) that displays seizures and neuronal hyperexcitability in heterozygotes (Myk/+) and perinatal death in homozygotes (Myk/Myk). The Myshkin allele contains a point mutation in the Na,K-ATPase α3-isoform that inactivates this enzyme and is solely responsible for complex partial and secondarily generalized seizures in these mice.++++ We backcrossed Myk/+ mice to the C57BL/6NCr strain (National Cancer Institute) for 12 generations before conducting phenotypic tests on sex-balanced groups of Myk/+ and +/+ N12 littermates at 10–14 weeks of age.  /n  Rescue: -  /n  Model Summary: Increased locomotor activity, Increased methamphetamine, response, Spontaneous epileptic seizures, Neuronal hyperexcitability, Reduced learning and memory, Ataxia, Mania-like behavior	nucleotide binding,amyloid-beta binding,transporter activity,P-type sodium:potassium-exchanging transporter activity,ATP binding,P-type potassium transmembrane transporter activity,ATP hydrolysis activity,ATPase-coupled cation transmembrane transporter activity,D1 dopamine receptor binding,heparan sulfate proteoglycan binding,metal ion binding,chaperone binding,P-type sodium:potassium-exchanging transporter activity involved in regulation of cardiac muscle cell membrane potential	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	C57BL/6J	19748515	172	Expeimentalparadigm: Light-dark box test//5-Choice serial reaction time task  /n  Model Generation: The NK1R-/- mouse, with targeted disruption of the mouse tacr1 gene, was developed on a hybrid 129/Sv x C57BL/6J background strain while the clinical trials with MK 869 were underway (De Felipe et al., 1998).  /n  Rescue: We tested the animals in the afternoon, when locomotor activity of wildtype mice is low and stable. In line with our predictions, d-amphetamine increased the motor activity of wildtype mice. However, the hyperactivity of NK1R-/- mice was abolished by this stimulant (Yan et al., 2009).  /n  Model Summary: The influence of tachykinins on central monoamine transmission systems attracted attention because the tachykinin-1 receptor (known as TACR1 in humans, or NK1R in rodents) was a promising target for a novel class of antidepressants. Studies of neurochemical abnormalities in mice lacking functional NK1R, either through drug antagonism or functional ablation of the NK1 receptor gene (NK1R-/-), were aimed at understanding the neurochemical basis of ‘antidepression’. However, as described below, this research led to the serendipitous discovery that NK1R-/- mice express core features of ADHD.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Conditional Knockout	Ms2Yah;Ts1Yah;C57BL/6J	19783846	173	Expeimentalparadigm: SHIRPA//Open field test//Y-maze//Elevated plus maze//Rotarod//Treadmill//Novel object recognition test//Morris water maze  /n  Model Generation: The Abcg1 and U2af1 targeting vectors were isolated, respectively, from the 5′Hprt and 3′Hprt libraries (84) and inserted by homologous recombination in HM-1 Hprt-deficient ES cells (85). Subsequently, a transient expression of the Cre recombinase provided ES cells with three different configurations (Fig. 1). We obtained ES cell clones carrying two loxP sites in the Abcg1 and U2af1 loci in a cis configuration, which were named Cis(Abcg1tm1Yah–U2af1tm1Yah), ES cells with a deletion of the Abcg1–U2af1 region, the Ms2Yah clone and the Ts1Yah clone which provide a duplication of this region. Ms2Yah and Ts1Yah clones were injected into C57BL/6J blastocysts to generate chimera. These animals were crossed with C57BL/6J mice to obtain the corresponding mouse line. The Ms2Yah [B6.129Del(17Abcg1–U2af1)] and the Ts1Yah [B6.129Dup(17Abcg1–U2af1)] were generated on 129/Ola and backcrossed on the C57BL/6J genetic background up to N7 in this study.  /n  Rescue: -  /n  Model Summary: Mental retardation in Down syndrome (DS), the most frequent trisomy in humans, varies from moderate to severe. Here we show that the trisomy of the 12 genes, found in the 0.59 Mb (Abcg1-U2af1) Hsa21 sub-telomeric region, in mice (Ts1Yah) produced defects in novel object recognition, open-field and Y-maze tests, similar to other DS models, but induces an improvement of the hippocampal-dependent spatial memory in the Morris water maze along with enhanced and longer lasting long-term potentiation in vivo in the hippocampus. Overall, we demonstrate the contribution of the Abcg1-U2af1 genetic region to cognitive defect in working and short-term recognition memory in DS models. Increase in copy number of the Abcg1-U2af1 interval leads to an unexpected gain of cognitive function in spatial learning.Expression analysis pinpoints several genes, such as Ndufv3, Wdr4, Pknox1 and Cbs, as candidates whose overexpression in the hippocampus might facilitate learning and memory in Ts1Yah mice.	NA	Ani
Trpc2	TRPC2	protein-coding	Mus musculus	ENSMUSG00000100254	3010009O07Rik|TRPC2a|TRPC2b|Trrp2|mTrp2|smTRPC2|trp2	22064	Aggressive Behaviors	7 E2|7 54.71 cM	Knockout	C57BL/6J	19799641	174	Expeimentalparadigm: Maternal behavior observations//Maternal defense testing  /n  Model Generation: The focal animals in this study were derived from crosses of male KO mice bred in a C57BL6/J background (Stowers et al., 2002)(generously donated by Dr. Catherine Dulac, Harvard University) and females from our colony of hsd:icr mice (Harlan, USA) selected for high levels of maternal defense (S) (Gammie et al., 2006). The heterozygous offspring of these initial pairings were then bred to each other; sibling matings were avoided. Offspring of the heterozygous pairings were genotyped using PCR analysis of DNA obtained from ear snips. The resulting KO males and females were bred back into our S mice to create heterozygous offspring with a greater proportion of the S genetic background. These back crosses were performed in three consecutive generations, with the offspring of each crossing genotyped as before. After the final cross, the S background represented approximately 87% of the genetic background of the offspring. All focal female animals, including WT controls, came from this third crossing. WT controls were littermates of KOs.  /n  Rescue: -  /n  Model Summary: In this study, we examine the gene's effect on brain regions governing maternal aggression. We intruder-tested lactating dams and then quantified Fos immunoreactivity (Fos-IR) in the vomeronasal amygdala, hypothalamus, olfactory regions and accessory olfactory bulb (AOB). Our data confirm previous reports that loss of the Trpc2 gene severely diminishes maternal aggression. We also show that deletion of the gene results in differential hypotrophy of the glomerular layer (GlA) of the AOB, with the anterior portion the GlA resembling that of wild-type mice, and the posterior portion reduced or absent. This anatomy is suggestive of residual functioning in the apical VNO of these animals. Our Fos study describes an impact of the deletion on a network of 21 brain regions involved in emotion, aggression and olfaction, suggesting that signals from the VNO mediate activity throughout the brain. Home-cage observations of KO dams show specific deficits in nest-building, suggesting a role for pup pheromones in inducing and maintaining pup-directed maternal behaviors as well as maternal aggression.	damaged DNA binding,ion channel activity,calcium channel activity,protein binding,store-operated calcium channel activity,diacylglycerol binding,inositol 1,4,5 trisphosphate binding	Ani
Nrxn1	NRXN1	protein-coding	Mus musculus	ENSMUSG00000024109	1700062G21Rik|9330127H16Rik|A230068P09Rik|mKIAA0578	18189	Autism Spectrum Disorder	17|17 E5	Knockout	129Sv;C57BL/6	19822762	175	Expeimentalparadigm: Elevated plus maze//Open field test//Locomotion test//Grooming//Social interaction with a juvenile//Reciprocal social interaction with an adult conspecific//Social interaction with an adult caged conspecific//3-box social vs. inanimate preference test//Rotarod//Locomotor habituation in the open field//Interaction with pheromones//Olfactory food finding//Prepulse inhibition<U+00A0>//Startle reactivity//Morris water maze//Visible water maze//Nesting behavior  /n  Model Generation: All mice tested were sex-matched, littermate progeny of matings between heterozygous neurexin-1α KO mice, and purposely maintained on a hybrid SV129/C57 black6 background to avoid artifactual phenotypes caused by mutations in homozygous inbred strains.  /n  Rescue: -  /n  Model Summary: To explore the underlying biology, we studied the electrophysiological and behavioral phenotype of mice lacking neurexin-1alpha. Hippocampal slice physiology uncovered a defect in excitatory synaptic strength in neurexin-1alpha deficient mice, as revealed by a decrease in miniature excitatory postsynaptic current (EPSC) frequency and in the input-output relation of evoked postsynaptic potentials. This defect was specific for excitatory synaptic transmission, because no change in inhibitory synaptic transmission was observed in the hippocampus. Behavioral studies revealed that, compared with littermate control mice, neurexin-1alpha deficient mice displayed a decrease in prepulse inhibition, an increase in grooming behaviors, an impairment in nest-building activity, and an improvement in motor learning. However, neurexin-1alpha deficient mice did not exhibit any obvious changes in social behaviors or in spatial learning.	transmembrane signaling receptor activity,signaling receptor binding,type 1 fibroblast growth factor receptor binding,calcium channel regulator activity,calcium ion binding,protein binding,acetylcholine receptor binding,protein-containing complex binding,metal ion binding,calcium-dependent protein binding,cell adhesion molecule binding,neuroligin family protein binding	Ani
Ucn	UCN	protein-coding	Mus musculus	ENSMUSG00000038676	Mpv17|Ucn1	22226	Anxiety Disorder	5 B1|5 17.11 cM	Knockout	C57BL/6×129	19884890	176	Expeimentalparadigm: Elevated plus maze//Open field test//Light-dark box test  /n  Model Generation: Ucn1/Ucn2 dKO mice were generated by crossbreeding Ucn136 and Ucn237 single knockout mice, on mixed C57BL/6 × 129 background, to produce offspring heterozygous for both genes. Male and female heterozygous mice were then bred to produce control, Ucn1, Ucn2 and double-mutant mice.  /n  Rescue: -  /n  Model Summary: Here, we describe genetically modified mice in which both Ucn1 and Ucn2 are developmentally deleted. The double knockout mice showed a robust anxiolytic phenotype and altered hypothalamic-pituitary-adrenal axis activity compared with wild-type mice. The significant reduction in anxiety-like behavior observed in these mice was further enhanced after exposure to acute stress, and was correlated with the levels of serotonin and 5-hydroxyindoleacetic acid measured in brain regions associated with anxiety circuits. Thus, we propose that the Ucn/CRFR2 serotonergic system has an important role in regulating homeostatic equilibrium under challenge conditions.	G protein-coupled receptor binding,hormone activity,histone deacetylase inhibitor activity,corticotropin-releasing hormone receptor 1 binding,corticotropin-releasing hormone receptor 2 binding	Ani
Ucn2	UCN2	protein-coding	Mus musculus	ENSMUSG00000049699	Ucn II|Ucn-2|ucn-II	171530	Anxiety Disorder	9|9 F2	Knockout	C57BL/6×129	19884890	177	Expeimentalparadigm: Elevated plus maze//Open field test//Light-dark box test  /n  Model Generation: Ucn1/Ucn2 dKO mice were generated by crossbreeding Ucn136 and Ucn237 single knockout mice, on mixed C57BL/6 × 129 background, to produce offspring heterozygous for both genes. Male and female heterozygous mice were then bred to produce control, Ucn1, Ucn2 and double-mutant mice.  /n  Rescue: -  /n  Model Summary: Here, we describe genetically modified mice in which both Ucn1 and Ucn2 are developmentally deleted. The double knockout mice showed a robust anxiolytic phenotype and altered hypothalamic-pituitary-adrenal axis activity compared with wild-type mice. The significant reduction in anxiety-like behavior observed in these mice was further enhanced after exposure to acute stress, and was correlated with the levels of serotonin and 5-hydroxyindoleacetic acid measured in brain regions associated with anxiety circuits. Thus, we propose that the Ucn/CRFR2 serotonergic system has an important role in regulating homeostatic equilibrium under challenge conditions.	G protein-coupled receptor binding,hormone activity,protein binding,hormone binding,corticotropin-releasing hormone receptor binding,corticotropin-releasing hormone receptor 2 binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6J	19932884	178	Expeimentalparadigm: Y-maze  /n  Model Generation: DAT KO mice were produced as described (Sora et al, 2001), bred at the Animal Laboratory Institute of Tohoku University Graduate School of Medicine and maintained on a mixed genetic background combining C57BL/6 and 129Sv/J mouse strains.  /n  Rescue: -  /n  Model Summary: Observation of decreased Y-maze spontaneous alternation in DAT KO mice is potentially consistent with the idea that these animals have impaired working memory function. Since the number of total arm entries was not significantly different between the two genotypes, confounding influences of locomotor hyperactivity in DAT KO mice seems unlikely. Documentation of significantly decreased frontal cortical BDNF in the DAT KO mice provides a plausible potential mechanism for impairments in spontaneous alternation.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Snap25	SNAP25	protein-coding	Rattus norvegicus	ENSRNOG00000006037	SNAP-25B|SNAP-25a	25012	Attention-Deficit/Hyperactivity Disorder	3q36	Overexpression	Wistar-Han	20002519	179	Expeimentalparadigm: Open field test//Water maze//Contextual fear conditioning test//Passive avoidance conditioning//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: Male Wistar rats were obtained from the Biomedical Facility in University College Dublin (Dublin, Ireland). All animals were postnatal day 49 on the day of surgery with subsequent testing, behavioural and microdialysis, beginning at postnatal days 80–84.  /n  Rescue: -  /n  Model Summary: Here, we over-express SNAP-25 in the adult rat dorsal hippocampus by infusion of a recombinant adeno-associated virus vector, to evaluate the consequence of late adolescent-adult dysfunction of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor protein in the absence of developmental disruption. We report a specific and significant increase in the levels of extracellular glutamate detectable by microdialysis and a reduction in paired-pulse facilitation in the hippocampus. In addition, SNAP-25 over-expression produced cognitive deficits, delaying acquisition of a spatial map in the water maze and impairing contextual fear conditioning, both tasks known to be dorsal hippocampal dependent.	SNARE binding,voltage-gated potassium channel activity,SNAP receptor activity,protein binding,lipid binding,myosin binding,syntaxin-1 binding,protein domain specific binding,syntaxin binding,transmembrane transporter binding,protein N-terminus binding,calcium-dependent protein binding,molecular adaptor activity	Ani
Pitx3	PITX3	protein-coding	Mus musculus	ENSMUSG00000025229	Ptx3|ak|aphakia	18742	Attention-Deficit/Hyperactivity Disorder	19 C3|19 38.75 cM	Mutated	Aphakia	20026251	180	Expeimentalparadigm: Locomotion test  /n  Model Generation: The Ak mice used in this study originated from the Jackson labs and homozygous ak/ak mice were generated in the Transgenic Core Facility at the University of Iowa.  /n  Rescue: Of interest to the present studies, intra-accumbens administration of amphetamine or MK-801 induced locomotor hyperactivity in rats. This effect was blocked by 6-OHDA lesions of the nucleus accumbens in the case of amphetamine, but not MK-801 (Mele et al., 1998). These studies further support that NMDA receptor antagonists induced hyperlocomotion can occur independent of nigrostriatal DA circuits.  /n  Model Summary: These studies indicate that the nigrostriatal DA circuit plays a critical role in maintaining normal responsiveness to psychotropic drugs that either stimulate or block DA neurotransmission. We propose that ak mice may represent a valuable genetic model not only to study Parkinson’s disease, but also to dissect the pathophysiologic and pharmacotherapuetic mechanisms of other DA-mediated disorders such as attention-deficit hyperactivity disorder, drug abuse and schizophrenia.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific double-stranded DNA binding	Ani
Csnk1d	CSNK1D	protein-coding	Mus musculus	ENSMUSG00000025162	1200006A05Rik|D930010H05Rik	104318	Attention-Deficit/Hyperactivity Disorder	11|11 E2	Overexpression	129/Sv;C57BL/6	20145109	181	Expeimentalparadigm: Open field test//Light-dark test//Elevated place maze//Novelty suppressed feeding test//Forced swim test//Tail suspension test  /n  Model Generation: A transgenic mouse line, tetO-CK1δ, was engineered by inserting the tetO sequence with a mini-CMV promoter into the 5′ sequence of the CK1δ cDNA. The transgenic mouse line with inducible overexpression of CK1δ in the forebrain was generated by crossing the tetO-CK1δ positive mice with CaMKIIα-tTA positive mice (40) (Jackson Laboratory) (for details, see SI Materials and Methods).  /n  Rescue: The CK1delta OE mice also presented paradoxical responses to dopamine receptor stimulation, showing hypoactivity following injection of d-amphetamine or methylphenidate, indicating that CK1 activity has a profound effect on dopamine signaling in vivo.  /n  Model Summary: All together, under basal conditions and in response to drug stimulation, the behavioral phenotype of CK1delta OE mice is reminiscent of the symptoms and drug responses observed in attention-deficit/hyperactivity disorder and therefore the CK1delta OE mice appear to be a model for this disorder.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,protein binding,ATP binding,kinase activity,transferase activity,tau-protein kinase activity,protein serine kinase activity	Ani
Nlgn1	NLGN1	protein-coding	Mus musculus	ENSMUSG00000063887	6330415N05Rik|NL1|Nlg1|mKIAA1070	192167	Autism Spectrum Disorder	3|3 A3	Knockout	129S6/SvEvTac;C57BL/6J	20147539	182	Expeimentalparadigm: Locomotion test//Light-dark box test//Open field test//Elevated plus maze//Accelerating rotarod//Social interaction with a juvenile//Social learning//Social versus inanimate preference test//Preference for social novelty test//Social interaction with an adult caged conspecific//Fear conditioning test//Morris water maze//Prepulse inhibition//Startle amplitude//Nesting//Olfaction for a nonsocial stimulus//Shock threshold  /n  Model Generation: To generate mouse KOs lacking NLs 1-3, exon sequences covering the translational start site and at least 380 bp of 5′ coding sequence of the respective genes were deleted by homologous recombination in embryonic stem cells (see Figures S1A and S1B in the Supplemental Data available online). In all cases, this targeting strategy eliminates the respective signal sequences and a significant part of the extracellular esterase-like domain and was therefore predicted to abolish NL expression completely. This was verified by Western blotting of brain homogenates from homozygous KOs using antibodies to the C termini of NLs 1-3, which showed that neither full-length NLs (Figure S1C) nor truncated variants (data not shown) were expressed in the respective KO mice.  /n  Rescue: Interestingly, we further demonstrate that the increased repetitive grooming phenotype can be rescued in adult mice by administration of the NMDA receptor partial coagonist d-cycloserine.  /n  Model Summary: We have now characterized NL1-deficient mice in autism- and mental retardation-relevant behavioral tasks. NL1 knock-out (KO) mice display deficits in spatial learning and memory that correlate with impaired hippocampal long-term potentiation. In addition, NL1 KO mice exhibit a dramatic increase in repetitive, stereotyped grooming behavior, a potential autism-relevant abnormality. This repetitive grooming abnormality in NL1 KO mice is associated with a reduced NMDA/AMPA ratio at corticostriatal synapses.	protein binding,PDZ domain binding,signaling receptor activity,neurexin family protein binding,identical protein binding,protein-containing complex binding,cell adhesion molecule binding,scaffold protein binding	Ani
Grin1	GRIN1	protein-coding	Mus musculus	ENSMUSG00000026959	GluN1|GluRdelta1|GluRzeta1|M100174|NMD-R1|NMDAR1|NR1|Nmdar|Rgsc174	14810	Cocaine Addiction	2 A3|2 17.14 cM	Knockout	RGS9-cre;NR1<U+00A0>flox/flox	20149346	183	Expeimentalparadigm: Conditioned place preference  /n  Model Generation: The striatum-specific Cre mouse was made by employing the restricted expression pattern of RGS9-2 protein, the product of a splice variant of the RGS9 gene that is expressed predominantly in the striatum (21). A<U+00A0>cre<U+00A0>gene was inserted at the 3′ end of the<U+00A0>RGS9<U+00A0>gene (Fig. 1A). To confirm that Cre was expressed mainly in the striatum, the<U+00A0>RGS9-cre<U+00A0>mouse was crossed with the<U+00A0>ROSA26<U+00A0>reporter mouse, which has a functional<U+00A0>lacZ<U+00A0>gene only in cells where a sequence-specific recombination by Cre has occurred (22). Progenies containing both<U+00A0>RGS9-cre<U+00A0>and<U+00A0>ROSA26<U+00A0>genes from postnatal day 8 (P8) to P90 were histochemically processed for β-galactosidase activity. Recombination was detected in the striatum as early as P8. The olfactory tubercle also exhibited recombination, but no signal was detected in the cerebellum and substantia nigra (Fig. 1B).  /n  Rescue: -  /n  Model Summary: NMDAR on striatal neurons is essential for the development of cocaine cue reactivity in the place conditioning paradigm. Our finding identifies a brain region whose constitutive NMDAR level serves as a determinant for susceptibility to this aspect of cocaine addiction.	amyloid-beta binding,ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,ion channel activity,cation channel activity,calcium channel activity,calcium ion binding,protein binding,calmodulin binding,ligand-gated ion channel activity,glycine binding,glutamate binding,enzyme binding,phosphatase binding,voltage-gated cation channel activity,glutamate-gated calcium ion channel activity,glutamate receptor binding,ionotropic glutamate receptor binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Esr1	ESR1	protein-coding	Rattus norvegicus	ENSRNOG00000019358	ER-alpha|Esr|RNESTROR	24890	Aggressive Behaviors	1q11	Knockout	Wistar	20184922	184	Expeimentalparadigm: Social recognition test//Light-dark box test//Resident–intruder test  /n  Model Generation: Male and female Wistar rats were obtained from Charles River WIGA (Sulzfeld, Germany). An adeno-associated virus (AAV) vector was made to express a small hairpin RNA (shRNA) against either the sequence specific for the ERα gene (5′-GATCCCCGGCATGGAGCATCTCTACA CTTCCTGTCA TGTAGAGATGCTCCATGCCTTTTTTGGAAT-3′ and 5′-CTAGATTCCAAAAAA GGCATGGAGCATCTCTACA TGACAGGAAG TGTAGAGATGCTCCATGCCGGG-3′) or the sequence specific for luciferase as control (5′-GATCCCCCCGCTGGAGAGCAACTGCAT CTTCCTGTCA ATGCAGTTGCTCTCCAGCGGTTTTTGGAA-3′ and 5′-CTAGTTCCAAAAACCGCTGGAGAGCAACTGCAT TGACAGGAAG ATGCAGTTGCTCTCCAGCGGGGG-3′). The nucleotides specific for ERα or luciferase are underlined. The shRNA became incorporated into the neurons adjacent to the injection sites, and as soon as the shRNA was expressed, it blocked ERα gene expression for the rest of the animals’ life. The shRNAs employed here have been described in detail elsewhere [55]. About 2 weeks after ovariectomy some females received intracerebral infusions under ketamine/xylazine anesthesia (100 mg/kg and 10 mg/kg, respectively). After the females were fixed in a stereotaxic frame and small holes were drilled, a total of 2 μl of either an shRNA encoded within an AAV viral vector directed against the ERα gene (ERα shRNA) or with an shRNA containing a sequence direted against luciferase gene (AAV control) as well as an independent enhanced green fluorescent protein (EGFP) expression cassette to mark the injection site was infused. Bilateral cannulae (30 gauge) were aimed at either the VMN (coordinates were: anteroposterior, -2.80; mediolateral, ±.6; dorsoventral -9.6) or the mediodorsal posterior amygdala (MePDA; coordinates were: anteroposterior, -3.14; mediolateral ±3.6; dorsoventral, -8.2). Coordinates were based on the ([60]) atlas with the skull level. The infusion lasted 10 min and the cannulae were slowly withdrawn 5 min after the end of infusion.  /n  Rescue: -  /n  Model Summary: In this study, an shRNA encoded within an AAV viral vector directed against the ERalpha receptor gene (or containing luciferase control), was injected bilaterally into the posterodorsal amygdala (MePDA) or the ventromedial nucleus of the hypothalamus (VMN) of female rats. An 81% reduction of ERalpha expression in the MePDA eliminated social recognition. Moreover, this diminution of ERalpha in the MePDA reduced anxiety in the light/dark choice test. In contrast, social recognition was unaffected after ERalpha knockdown in the VMN while aggressiveness against the juvenile was enhanced. In conclusion, social recognition and anxiety in female rats are modulated by the ERalpha in the amygdala.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,TFIIB-class transcription factor binding,transcription coregulator binding,transcription corepressor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,beta-catenin binding,zinc ion binding,TBP-class protein binding,enzyme binding,protein kinase binding,nuclear estrogen receptor activity,nuclear estrogen receptor binding,type 1 metabotropic glutamate receptor binding,estrogen response element binding,phosphatidylinositol 3-kinase regulatory subunit binding,hormone binding,identical protein binding,sequence-specific DNA binding,protein-containing complex binding,ATPase binding,sequence-specific double-stranded DNA binding,promoter-specific chromatin binding	Ani
Cdk5	CDK5	protein-coding	Mus musculus	ENSMUSG00000028969	Crk6	12568	Attention-Deficit/Hyperactivity Disorder	5 A3|5 11.73 cM	Knockout	129/SvJ;C57BL/6J	20403084	185	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: Male wild type (WT) and p35-/- (p35 KO) mutant mice were generated by breeding heterozygous mutants, maintained in a 129/SvJ×C57BL/6J background via brother-sister mating (kind gifts of Dr. L.H. Tsai) (Chae et al. 1997).  /n  Rescue: Strong immunolabeling for tyrosine-hydroxylase and high striatal DA synthesis and contents with a low DA turnover, which were reverted by psychostimulants, were also found in mutant mice.  /n  Model Summary: We used a mutant mouse, deficient in p35 protein (p35 KO), which displayed reduced Cdk5 activity. Throughout behavioral and biochemical characterization of na<U+00EF>ve and psychostimulant-treated mice, we demonstrated that only juvenile p35 KO mice displayed spontaneous hyperactivity, responded with a paradoxical hypolocomotor effect to psychostimulant drugs and exhibited deficit on proper behavioral inhibition.	nucleotide binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ErbB-2 class receptor binding,protein binding,ATP binding,cytoskeletal protein binding,kinase activity,transferase activity,protein kinase binding,acetylcholine receptor activator activity,histone kinase activity,ErbB-3 class receptor binding,ephrin receptor binding,tau-protein kinase activity,Hsp90 protein binding	Ani
Penk	PENK	protein-coding	Mus musculus	ENSMUSG00000045573	ENK|PPA|Penk1	18619	Posttraumatic Stress Disorder	4 A1|4 2.31 cM	Knockout	C57BL/6J(B6.129 -Penk -rs tm1Pig)	20406487	186	Expeimentalparadigm: Open field test//Situational reminders//Elevated plus maze// Light-dark box test//Open field test//Forced swim test//Freezing behavior  /n  Model Generation: Preproenkephalin Knockout mice (B6.129-Penk-rstm1Pig; background strain C57BL/6J) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). Homozygous mutant offsprings were bred and polymerase chain reaction (PCR) was used to confirm the genotype of the homozygous Penk-/- mice. Using the primers, Penk common-E31, Penk WT-E1R, and Penk Knockout-neoRL, a 700-bp and 500-bp fragments were amplified from WT and Knockout mice respectively. The 700-bp band was specific to WT mice while the 500-bp band was specific in Knockout mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: Anxiety- and depressive-like responses and c-fos<U+00A0>activity in preproenkephalin knocKnockoutut mice: Oversensitivity hypothesis of enkephalin deficit-induced posttraumatic stress disorder	opioid peptide activity,opioid receptor binding	Ani
Slitrk5	SLITRK5	protein-coding	Mus musculus	ENSMUSG00000033214	2610019D03Rik	75409	Neurodevelopmental Disorders	14|14 E4	Knockout	C57BL/6	20418887	187	Expeimentalparadigm: Open field test//Elevated plus maze//Marble burying test//Rotarod//Cylinder test  /n  Model Generation: The Slitrk5 encoding region was replaced with TM-lacZ inserted at amino acid 47 of Slitrk5 after the initiator methionine (amino acid 7 after the signal sequence cleavage site). Velocigene Allele Identification Number: VG737. Mice were generated on C57BL/6 and SV129 mixed background and subsequently backcrossed to C57BL/6 background for five generations. Genotyping: forward primer -5’-GACCCCCTTCCGTCTACAC-3’, reverse primer – 5’-TGGACAAAGTTCCTGCTTGGATAC-3’ and the probe – 5’-CTCGTCCAAATCCC-3’ for wild type; forward primer – 5’-GGGCGCCCGGTTCTT-3’, reverse primer – 5’-CCTCGTCCTGCAGTTCATTCA-3’ and the probe – 5’-ACCTGTCCGGTGCCC-3’ for the knockout. Expression pattern of Slitrk5 was determined by the detection of β-galactosidase activity in mouse tissues. Fresh-frozen tissues were sectioned and subsequently incubated for 4-16 hours with X-gal (1 mg/ml, Calbiochem), then counterstained with Nuclear Fast Red (Vector Labs).  /n  Rescue: That is alleviated by the selective serotonin reuptake inhibitor fluoxetine.  /n  Model Summary: Here we demonstrate that loss of a neuron-specific transmembrane protein, SLIT and NTRK-like protein-5 (Slitrk5), leads to OCD-like behaviors in mice, which manifests as excessive self-grooming and increased anxiety-like behaviors.	molecular_function	Ani
Hoxb8	HOXB8	protein-coding	Mus musculus	ENSMUSG00000056648	Hox-2.4	15416	Obsessive Compulsive Disorder	11 D|11 59.82 cM	Targeted	NA	20510925	188	Expeimentalparadigm: Grooming//Scratching  /n  Model Generation: The Hoxb8 null mutant (Greer and Capecchi, 2002), the ROSA-YFP reporter (Srinivas et al., 2001), the ROSA-LacZ reporter (Soriano, 1999), the Tie2Cre driver (Constien et al., 2001) and the CAG-GFP mouse line (Ikawa et al., 1995) have been described previously.  In this report, we have generated IRES-Cre recombinase knock-ins in the Hoxb8 and Hoxc8 loci, as well as the conditional Hoxb8 allele. To create the Hoxb8-ICre allele, a 3.36 kb fragment, including the Cre recombinase preceded by an internal ribosomal entry site (IRES) and followed by a FRT-neo-FRT cassette, was inserted in the 3’ untranslated region (UTR) of exon 2 in the Hoxb8 gene.  A similar strategy was used to generate the Hoxc8ICre allele.  The Hoxb8 conditional allele was created by inserting one lox511 site into the 5’UTR and a second lox511 site in the 3’UTR.  For a potential temporal control of gene inactivation, the tetracycline-inducible transactivator (IRES-rtTA2M2) was also introduced into the Hoxb8 3’UTR, alongside with the FRT-neo-FRT cassette. The targeting vectors were electroporated into R1 embryonic stem cells and the successfully targeted clones were identified by Southern hybridization analysis of the Hoxb8 and Hoxc8 loci, using the screening strategies outlined in Supplemental Figure S1. All animals used in this study had the FT-flanked neomycin selection cassette removed by breeding with the FLPe deleter line, and the FLPe transgene was subsequently removed.  /n  Rescue: -  /n  Model Summary: Here we report that, in the brain, Hoxb8 cell lineage exclusively labels bone marrow-derived microglia. Furthermore, transplantation of wild-type bone marrow into Hoxb8 mutant mice rescues their pathological phenotype. It has been suggested that the grooming dysfunction results from a nociceptive defect, also exhibited by Hoxb8 mutant mice. However, bone marrow transplant experiments and cell type-specific disruption of Hoxb8 reveal that these two phenotypes are separable, with the grooming phenotype derived from the hematopoietic lineage and the sensory defect derived from the spinal cord cells. Immunological dysfunctions have been associated with neuropsychiatric disorders, but the causative relationships are unclear. In this mouse, a distinct compulsive behavioral disorder is associated with mutant microglia.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific DNA binding,sequence-specific double-stranded DNA binding	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Bipolar Disorder	5 C3.3|5 40.63 cM	Knockdown	C57BL/6J	20591414	189	Expeimentalparadigm: Locomotor response to novelty//Circadian locomotor rhythms//Elevated plus maze//Open field test//Dark-light box test//Forced swim test//Learned helplessness test  /n  Model Generation: 8–10 week old male C57BL/6J mice (bred at UT Southwestern) were used for all the studies. A small hairpin RNA (shRNA) against Clock mRNA was constructed by selecting a unique 24 base sequence (5’-GAACATCAGGCTATGATTACTATC-3’) in the coding region of Clock mRNA. For the scrambled shRNA, a random sequence of 24 bases (5’-CGGAATTTAGTTACGGGGATCCAC-3’) that had no sequence similarities with any known genes/mRNA was used. An antisense sequence of the selected mRNA region followed by a miR23 loop of 10 nucleotide (CTTCCTGTCA) was added at the 5’end of the above sequences. These shRNAs were designed as synthetic duplexes with overhang ends identical to those created by Sap I and Xba I restriction enzyme digestion. The annealed oligonucleotides were cloned into the adeno-associated virus (AAV) plasmid expressing enhanced green fluorescent protein (Stratagene, La Jolla, CA). Viral production was carried out using a helper-free triple transfection method in HEK 293 cells (ATCC) as described in Hommel et al. (1) and was purified according to Zolotukhin et al. (2).  /n  Rescue: -  /n  Model Summary: Here, we used RNA interference and viral-mediated gene transfer to knock down Clock expression specifically in the ventral tegmental area (VTA) of mice. We then performed a variety of behavioral, molecular, and physiological measures. We found that knockdown of Clock, specifically in the VTA, results in hyperactivity and a reduction in anxiety-related behavior, which is similar to the phenotype of the ClockDelta19 mice. However, VTA-specific knockdown also results in a substantial increase in depression-like behavior, creating an overall mixed manic state. Surprisingly, VTA knockdown of Clock also altered circadian period and amplitude, suggesting a role for Clock in the VTA in the regulation of circadian rhythms. Furthermore, VTA dopaminergic neurons expressing the Clock short hairpin RNA have increased activity compared with control neurons, and this knockdown alters the expression of multiple ion channels and dopamine-related genes in the VTA that could be responsible for the physiological and behavioral changes in these mice.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
App	APP	protein-coding	Mus musculus	ENSMUSG00000022892	Abeta|Abpp|Adap|Ag|Cvap|E030013M08Rik|betaApp	11820	Aggressive Behaviors	16 C3.3|16 46.92 cM	Transgene	Tg2576 transgenic mouse;C57BL/6SJ	20655336	190	Expeimentalparadigm: Resident–intruder test  /n  Model Generation: Tg2576 transgenic (HuAPP695.SWE) males and their non-transgenic (nTg) male littermates, kept on C57/B6//SJL mixed genetic background, were obtained from the colony stock maintained by Charles River Laboratories. Twenty-two males (NTg2576 = 11 and NnTg = 11) were used in the study as resident males tested for aggression towards unfamiliar, experimentally na<U+00EF>ve males of A/J strain. The A/J male mice (N = 66) were purchased from the Jackson Laboratory (Stock #000646).  /n  Rescue: -  /n  Model Summary: We used a transgenic mouse model, denoted Tg2576, which over-expresses a mutated human amyloid precursor protein (APP) gene implicated in familial AD, to investigate aggressive behaviour of males at the stage of amyloid beta pathology preceding overt amyloid plaque deposition in the brain. The aggressive behaviour of transgenic and non-transgenic littermate males was evaluated in a standard resident-intruder test in which an isolated resident male responded aggressively toward an experimentally na<U+00EF>ve intruder male of A/J strain. We showed that 7-month-old Tg2576 resident males demonstrated significantly higher and unchanged level of aggression towards intruder males during 3 consecutive encounters as compared to their non-transgenic littermate counterparts.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,G protein-coupled receptor binding,chromatin binding,serine-type endopeptidase inhibitor activity,signaling receptor binding,frizzled binding,insulin receptor binding,integrin binding,protein binding,heparin binding,peptidase activator activity,enzyme binding,peptidase inhibitor activity,signaling receptor activator activity,acetylcholine receptor binding,apolipoprotein binding,chemoattractant activity,identical protein binding,protein homodimerization activity,ion binding,heparan sulfate proteoglycan binding,metal ion binding,ephrin receptor binding,transition metal ion binding,protein heterodimerization activity,protein dimerization activity,low-density lipoprotein particle receptor binding,RAGE receptor binding,chaperone binding,PTB domain binding,growth factor receptor binding	Ani
St8sia2	ST8SIA2	protein-coding	Mus musculus	ENSMUSG00000025789	ST8SiaII|STX|Siat8b	20450	Aggressive Behaviors	7|7 D1	Knockout	C57BL/6J	20659171	191	Expeimentalparadigm: Elevated plus maze//Open field test//Sociability test//Habituation//Social interaction test//Resident–intruder test//Bedding preference test//Hidden food test  /n  Model Generation: All experiments were conducted in age-matched male STX (ST8SiaII) KO mice (n = 9; 33 ± 3g), PST (ST8SiaIV) KO mice (n = 14; 34 ± 3g) and their WT littermates (n = 18; 34 ± 2g;n = 10 from the STX line and n = 8 from the PST line). The generation of ST8SiaII and ST8SiaIV mutations has been described previously (Angata et al. 2004; Eckhardt et al. 2000). Briefly, heterozygous mice from each genotype were intercrossed to obtain homozygous KO mice and WT littermates. All mice originated from 6 (PST) to 7 (STX) different breeding couples, which had been previously backcrossed for more than 10 generations into the C57BL/6J background.  /n  Rescue: -  /n  Model Summary: To address this issue, we assessed two lines of mice deficient for one of the two sialyltransferase enzymes required for the polysialylation of NCAM, sialyltransferase-X (St8SiaII or STX) and polysialyltransferase (ST8SiaIV or PST), in a series of tests for social behaviors. Results showed that PST KO mice display a decreased motivation in social interaction. This deficit can be partly explained by olfactory deficits and was associated with a clear decrease in PSA-NCAM expression in all brain regions analyzed (amygdala, septum, bed nucleus of the stria terminalis and frontal cortices). STX KO mice displayed both a decreased social motivation and an increased aggressive behavior that cannot be explained by olfactory deficits. This finding might be related to the reduced anxiety-like behavior, increased locomotion and stress-induced corticosterone secretion observed in these mice. Moreover, STX KO mice showed mild increase of PSA-NCAM expression in the lateral septum and the orbitofrontal cortex. Altogether, these findings support a role for PSA-NCAM in the regulation of social behaviors ranging from a lack of social motivation to aggression. They also underscore STX KO mice as an interesting animal model that combines a behavioral profile of violence and hyperactivity with reduced anxiety-like behavior.	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity,protein binding,sialyltransferase activity,transferase activity,glycosyltransferase activity	Ani
St8sia4	ST8SIA4	protein-coding	Mus musculus	ENSMUSG00000040710	PST|PST-1|SIAT8-D|ST8SiaIV|Siat8d	20452	Aggressive Behaviors	1|1 D	Knockout	C57BL/6J	20659171	192	Expeimentalparadigm: Elevated plus maze//Open field test//Sociability test//Habituation//Social interaction test//Resident–intruder test//Bedding preference test//Hidden food test  /n  Model Generation: All experiments were conducted in age-matched male STX (ST8SiaII) KO mice (n = 9; 33 ± 3g), PST (ST8SiaIV) KO mice (n = 14; 34 ± 3g) and their WT littermates (n = 18; 34 ± 2g;n = 10 from the STX line and n = 8 from the PST line). The generation of ST8SiaII and ST8SiaIV mutations has been described previously (Angata et al. 2004; Eckhardt et al. 2000). Briefly, heterozygous mice from each genotype were intercrossed to obtain homozygous KO mice and WT littermates. All mice originated from 6 (PST) to 7 (STX) different breeding couples, which had been previously backcrossed for more than 10 generations into the C57BL/6J background.  /n  Rescue: -  /n  Model Summary: To address this issue, we assessed two lines of mice deficient for one of the two sialyltransferase enzymes required for the polysialylation of NCAM, sialyltransferase-X (St8SiaII or STX) and polysialyltransferase (ST8SiaIV or PST), in a series of tests for social behaviors. Results showed that PST KO mice display a decreased motivation in social interaction. This deficit can be partly explained by olfactory deficits and was associated with a clear decrease in PSA-NCAM expression in all brain regions analyzed (amygdala, septum, bed nucleus of the stria terminalis and frontal cortices). STX KO mice displayed both a decreased social motivation and an increased aggressive behavior that cannot be explained by olfactory deficits. This finding might be related to the reduced anxiety-like behavior, increased locomotion and stress-induced corticosterone secretion observed in these mice. Moreover, STX KO mice showed mild increase of PSA-NCAM expression in the lateral septum and the orbitofrontal cortex. Altogether, these findings support a role for PSA-NCAM in the regulation of social behaviors ranging from a lack of social motivation to aggression. They also underscore STX KO mice as an interesting animal model that combines a behavioral profile of violence and hyperactivity with reduced anxiety-like behavior.	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity,sialyltransferase activity,transferase activity,glycosyltransferase activity	Ani
Tnfrsf1a	TNFRSF1A	protein-coding	Mus musculus	ENSMUSG00000030341	CD120a|FPF|TNF-R|TNF-R-I|TNF-R1|TNF-R55|TNF-alphaR1|TNFAR|TNFR60|TNFRI|TNFRp55|TNFalpha-R1|Tnfr-2|Tnfr1|p55|p55-R	21937	Aggressive Behaviors	6 F3|6 59.32 cM	Knockout	B6129S-Tnfrsf1atm1ImxTnfrsf1btm1Imx/J	20685290	193	Expeimentalparadigm: Aggressive behavior//Anxiety-related behavior//Open field test//Light-dark box test  /n  Model Generation: Male wild type (WT) (B6129SF2/J) (n=6) and combined TNF receptor type 1 and type 2 knockout (KO) mice [B6129S-Tnfrsf1atm1ImxTnfrsf1btm1Imx/J] (n=6) from different litters, were purchased from Jackson Laboratories, Bar Harbor, Maine at 5-wk of age.  /n  Rescue: -  /n  Model Summary: The mechanisms underlying violence and aggression and its control remain poorly understood. Using the resident-intruder paradigm, we have discovered that resident mice with combined deletion of TNF receptor type 1 (TNF-R1) and type 2 (TNF-R2) genes show a striking absence of aggressive behavior, which includes fighting, sideways postures, and tail rattling. In parallel, resident TNF-R1 and TNF-R2 knockout mice show an increase in non-aggressive exploration of the intruder mice. Given the relationship between aggression and anxiety, we also measured anxiety-related behavior, as reflected by performance in the Open Field and the Light-Dark Choice Test. Compared with wild type mice, TNF-R1 and TNF-R2 deficient mice spent significantly more time and showed increased movement in the center of the Open Field and in the illuminated compartment of the light-dark box, suggesting an anxiolytic-like profile.	protease binding,tumor necrosis factor receptor activity,protein binding,tumor necrosis factor binding,protein-containing complex binding	Ani
Tnfrsf1b	TNFRSF1B	protein-coding	Mus musculus	ENSMUSG00000028599	CD120b|TNF-R-II|TNF-R2|TNF-R75|TNF-alphaR2|TNFBR|TNFR80|TNFRII|TNFalpha-R2|Tnfr-1|Tnfr2|p75	21938	Aggressive Behaviors	4 E1|4 78.17 cM	Knockout	B6129S-Tnfrsf1atm1ImxTnfrsf1btm1Imx/J	20685290	194	Expeimentalparadigm: Aggressive behavior//Anxiety-related behavior//Open field test//Light-dark box test  /n  Model Generation: Male wild type (WT) (B6129SF2/J) (n=6) and combined TNF receptor type 1 and type 2 knockout (KO) mice [B6129S-Tnfrsf1atm1ImxTnfrsf1btm1Imx/J] (n=6) from different litters, were purchased from Jackson Laboratories, Bar Harbor, Maine at 5-wk of age.  /n  Rescue: -  /n  Model Summary: The mechanisms underlying violence and aggression and its control remain poorly understood. Using the resident-intruder paradigm, we have discovered that resident mice with combined deletion of TNF receptor type 1 (TNF-R1) and type 2 (TNF-R2) genes show a striking absence of aggressive behavior, which includes fighting, sideways postures, and tail rattling. In parallel, resident TNF-R1 and TNF-R2 knockout mice show an increase in non-aggressive exploration of the intruder mice. Given the relationship between aggression and anxiety, we also measured anxiety-related behavior, as reflected by performance in the Open Field and the Light-Dark Choice Test. Compared with wild type mice, TNF-R1 and TNF-R2 deficient mice spent significantly more time and showed increased movement in the center of the Open Field and in the illuminated compartment of the light-dark box, suggesting an anxiolytic-like profile.	tumor necrosis factor receptor activity,protein binding,ubiquitin protein ligase binding,tumor necrosis factor binding	Ani
Gabrb3	GABRB3	protein-coding	Mus musculus	ENSMUSG00000033676	A230092K12Rik|Cp1|Gabrb-3|beta3	14402	Autism Spectrum Disorder	7 B5|7 33.53 cM	Knockout	C57BL/6J	20699105	195	Expeimentalparadigm: Mechanical threshold test//Heat sensitivity test//Acoustic startle//Prepulse inhibition//Rotarod//Marble burying test//Wire hanging test//Pentylenetetrazol induced seizures  /n  Model Generation: Strain 129 mouse genomic DNA was isolated from a P1 phage library (Genome Systems, St. Louis). Details of library screening and vector construction are available upon request. Following electroporation of R1 (12) embryonic stem (ES) cells, clones were screened for targeting by Southern blot analysis of EcoRV-digested genomic DNA. Blots were hybridized with a 3′ probe that is external to the targeting construct. This probe is a 1.1-kb BglII–BamHI genomic subclone. Targeting was confirmed with several other restriction digests and by hybridization with a neomycin phosphotransferase probe and with a 5′ arm probe (data not shown). Two correctly targeted ES cell clones (β3#347, β3#372) were transferred through the germ line. Results presented here are from the β3#347 clone. A cursory analysis of β3#372 yielded similar results. The genetic background of all mice was Strain 129 × C57BL/6J F2 or F3. These mice have been given the strain designation Gabrb3tm1Geh and are available from the Induced Mutant Resource (The Jackson Laboratories). Mice with a heterozygous disruption of the Gabrb3 gene, were originally obtained from Dr. Gregg Homanics at University of Pittsburgh, PA. The mouse line used in the current study was backcrossed for seven generations against the background C57BL/6J strain.  /n  Rescue: -  /n  Model Summary: We chose to examine whether sensory abnormalities were present in mice heterozygous for the Gabrb3 gene, a gene strongly associated with ASD. Mice were assessed for tactile and heat sensitivity, sensorimotor competence (accelerating rotarod task) and sensorimotor gating by prepulse inhibition of the acoustic startle reflex (PPI). All heterozygotes exhibited an increase in seizure susceptibility and similar reductions in Gabrb3 expression in the dorsal root ganglia, spinal cord, whole brain and amygdala. Interestingly, significant differences were noted between heterozygous variants in regards to tactile sensitivity, heat sensitivity, sensorimotor competence and PPI along with differences in Gabrb3 expression in the reticular thalamic nucleus and the bed nucleus of stria terminalis.	transmembrane signaling receptor activity,GABA-A receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,chloride channel activity,protein binding,GABA-gated chloride ion channel activity,neurotransmitter receptor activity,AP-2 adaptor complex binding,identical protein binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Gap43	GAP43	protein-coding	Mus musculus	ENSMUSG00000047261	B-50|Basp2|GAP-43	14432	Autism Spectrum Disorder	16 B4|16 28.37 cM	Knockout	C57BL/6J;129S3/SvImJ	20707874	196	Expeimentalparadigm: Three-chambered test//Tail suspension test//T-maze//Morris water maze//Elevated plus maze//Marble burying//Forced swim test//Social approach//Juvenile interaction//Locomotor testing//Light-dark test//Fear conditioning test  /n  Model Generation: The targeting vector consisted of a 9.0-kilobase (kb) A129/sv genomic fragment, in which 476 bp of the GAP-43 gene (from intron 1 and nucleotides 133–171 from the cDNA) was replaced with the pGKneobpA cassette. The pGKTK cassette was the negative selection marker. Electroporation and selection used the CJ7 embryonic stem (ES) cell line.<U+00A0>  /n  Rescue: -  /n  Model Summary: We found that GAP43 (+/<U+2212>) mice, relative to wild-type (+/+) littermates, displayed resistance to change, consistent with one of the diagnostic critera for ASD. GAP43 (+/<U+2212>) mice also displayed stress-induced behavioral withdrawal and anxiety, as seen in many autistic individuals. In addition, both GAP43 (+/<U+2212>) mice and (+/+) littermates demonstrated low social approach and lack of preference for social novelty, consistent with another diagnostic criterion for ASD.	phosphatidylserine binding,calmodulin binding,lysophosphatidic acid binding,phosphatidylinositol phosphate binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockin	C57BL/6J	20720111	197	Expeimentalparadigm: Novelty object recognition test//Accelerating rotating rod test  /n  Model Generation: Adult DAT-CI male mice were generated by homologous recombination in 129/SvJ embryonic stem cells as previously described (Chen et al., 2006). DAT-CI mice bear a triple point mutation (L104V/F105C/A109V) within DAT protein that is ~90-fold more insensitive to cocaine inhibition than wild type (WT) (Chen et al., 2006). The mutant mice have been backcrossed to C57BL/6J mice for 10 or more generations; thus, they are generally considered to be in the C57BL/6J background (Tilley and Gu, 2008b).  /n  Rescue: Our studies highlighted that amphetamine, nomifensine, and bupropion, through increased striatal dopaminergic transmission, are able to revert motor hyperactivity of DAT-CI animals.  /n  Model Summary: Herein, we showed that DAT-CI animals present higher striatal dopamine turnover, altered basal phosphorylation state of dopamine and cAMP-regulated phosphoprotein 32 kDa (DARPP32) at Thr75 residue, but preserved D(2) receptor (D(2)R) function. However, although we demonstrated that striatal D(1) receptor (D(1)R) is physiologically responsive under basal conditions, its stimulus-induced activation strikingly resulted in paradoxical electrophysiological, behavioral, and biochemical responses.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Cdk5	CDK5	protein-coding	Mus musculus	ENSMUSG00000028969	Crk6	12568	Attention-Deficit/Hyperactivity Disorder	5 A3|5 11.73 cM	Knockout	129/Sv	20832057	198	Expeimentalparadigm: Locomotion test  /n  Model Generation: Screening of a 129/Sv mouse genomic library (Stratagene) with a PCR product encompassing the N-terminal 400 bp of the human p35 open reading frame yielded one clone. Approximately 20 kb of genomic DNA insert was contained within the lambda phage vector Lambda Fix II. The entire insert was excised by digestion with NotI. The resultant 15 kb and 5 kb fragments were cloned into pBluescript SK (Stratagene). Germ-line transmission of the mutation was determined by mating male chimeric animals to C57BL/6 females and confirmed by Southern blot analysis of tail genomic DNA of agouti offspring. Mice heterozygous for the mutation were interbred to generate homozygous mice. One 4C4 chimera displayed partial germ-line transmission and two 6D3 chimeras displayed full germ-line transmission of the mutation. One 6D3 chimera was bred to 129/Sv females to place the mutation in the 129/Sv inbred background.  /n  Rescue: Knockout mice also exhibited an increased susceptibility to changes in PFC neurotransmitter content after chronic methylphenidate exposure, and altered basal DAergic activity in acute striatal and PFC slices.  /n  Model Summary: Here, we report that mice deficient in p35 display increased glucose uptake in the cerebral cortex, basal hyperactivity, and paradoxical decreased locomotion in response to chronic injection of cocaine or methylphenidate. Knockout mice also exhibited an increased susceptibility to changes in PFC neurotransmitter content after chronic methylphenidate exposure and altered basal DAergic activity in acute striatal and PFC slices.	nucleotide binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ErbB-2 class receptor binding,protein binding,ATP binding,cytoskeletal protein binding,kinase activity,transferase activity,protein kinase binding,acetylcholine receptor activator activity,histone kinase activity,ErbB-3 class receptor binding,ephrin receptor binding,tau-protein kinase activity,Hsp90 protein binding	Ani
Shank1	SHANK1	protein-coding	Mus musculus	ENSMUSG00000038738	-	243961	Autism Spectrum Disorder	7|7 B3	Knockout	129Sv;C57BL/6	20868654	199	Expeimentalparadigm: Juvenile play//Elevated plus-maze//Light-dark test//Open field test//Rotarod//Adult social approach//Self-grooming//Olfactory habituation-dishabituation  /n  Model Generation: Briefly, a 2 kb BstXIHindIII fragment containing exons 14 and 15 encoding almost the entire PDZ domain was replaced by the PGK-neo cassette in the same transcriptional orientation as Shank1. Chimeric mice were produced by injecting targeted ES cell clones into C57BL/6 blastocysts. Heterozygous offspring were backcrossed into both C57BL/6 (B6) and 129SvJae (129Jae) strains. These two lines of mice, generated on two independent background strains, were imported to the National Institute of Mental Health (NIMH) in Bethesda, MD for subsequent breeding. High mortality of Shank1 mice was obtained in the B6 background strain. Very low locomotion was obtained for Shank1 mice of all genotypes in the 129Jae background strain. Therefore, the two lines were crossed, to produce a mixed C57BL/6J/129SvJae (B6/Jae) background for the Shank1 mutation, consistent with the original studies of Shank1 mutants (Hung et al., 2008). The cross of heterozygous offspring was inbred for at least three generations. Therefore, the Shank1 mice used for the present experiments were on a 50–50% B6/Jae hybrid genetic background.  /n  Rescue: -  /n  Model Summary: To understand the consequences of SHANK mutations relevant to the diagnostic and associated symptoms of autism, comprehensive behavioral phenotyping on a line of Shank1 mutant mice was conducted on multiple measures of social interactions, social olfaction, repetitive behaviors, anxiety-related behaviors, motor functions, and a series of control measures for physical abilities. Results from our comprehensive behavioral phenotyping battery indicated that adult Shank1 null mutant mice were similar to their wildtype and heterozygous littermates on standardized measures of general health, neurological reflexes and sensory skills. Motor functions were reduced in the null mutants on open field activity, rotarod, and wire hang, replicating and extending previous findings (Hung et al., 2008). A partial anxiety-like phenotype was detected in the null mutants in some components of the light <U+2194> dark task, as previously reported (Hung et al., 2008) but not in the elevated plus-maze. Juvenile reciprocal social interactions did not differ across genotypes. Interpretation of adult social approach was confounded by a lack of normal sociability in wildtype and heterozygous littermates.	protein binding,protein C-terminus binding,SH3 domain binding,signaling receptor complex adaptor activity,synaptic receptor adaptor activity,somatostatin receptor binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,ankyrin repeat binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Chromosome Engineering	129SvEv;C57BL/6	20932954	200	Expeimentalparadigm: Morris water maze//Contextual fear conditioning test//Foot shock sensitivity test  /n  Model Generation: The mutant mice were first established in a 129SvEvxC57BL/6JF1 strain background and were then backcrossed to C57BL/6J mice for five generations. The mutant mice and their littermates were maintained at a temperature- and humidity-controlled animal facility. All mice used in the experiments were 2-4 months old. We used Dp(10)1Yey/+ mice (n=14), the wild-type littermates of Dp(10)1Yey/+ (n=15), Dp(16)1Yey/+ mice (n=15), the wild-type littermates of Dp(16)1Yey/+ (n=14), Dp(17)1Yey/+ mice (n=13) and the wild-type littermates of Dp(17)1Yey/+ (n=15) for behavioral analysis.  /n  Rescue: -  /n  Model Summary: The genomic regions on human chromosome 21 (Hsa21) are syntenic to three regions in the mouse genome, located on mouse chromosome 10 (Mmu10), Mmu16, and Mmu17. Recently, we have developed three new mouse models using chromosome engineering carrying the genotypes of Dp(10)1Yey/+, Dp(16)1Yey/+, or Dp(17)1Yey/+, which harbor a duplication spanning the entire Hsa21 syntenic region on Mmu10, Mmu16, or Mmu17, respectively. In this study, we analyzed the hippocampal long-term potentiation (LTP) and cognitive behaviors of these models. Our results show that, while the genotype of Dp(17)1Yey/+ results in abnormal hippocampal LTP, the genotype of Dp(16)1Yey/+ leads to both abnormal hippocampal LTP and impaired learning/memory.	NA	Ani
Dlg4	DLG4	protein-coding	Mus musculus	ENSMUSG00000020886	Dlgh4|PSD-95|PSD95|SAP90|SAP90A	13385	Autism Spectrum Disorder	11|11 B3	Knockout	C57BL/6J<U+00A0>	20952458	201	Expeimentalparadigm: T-maze//Grooming//Marble burying test//Ultrasonic vocalizations//Light-dark box test//Elevated plus maze//Open field//Rotarod  /n  Model Generation: For the current study, the Dlg4 null mutation was repeatedly backcrossed into the C57BL/6J strain.  Analysis of 150 SNP markers at ~15-20 megabase intervals across all autosomal chromosomes confirmed 95% C57BL/6J congenicty (JRS Allele Typing Services, The Jackson Laboratory, Bar Harbor, ME).  T  /n  Rescue: -  /n  Model Summary: Dlg4<U+2212>/<U+2212><U+00A0>showed increased repetitive behaviors, abnormal communication and social behaviors, impaired motor coordination, and increased stress reactivity and anxiety-related responses.<U+00A0>These findings demonstrate that Dlg4 gene disruption in mice produces a complex range of behavioral and molecular abnormalities relevant to autism spectrum disorders and Williams’ syndrome.	signaling receptor binding,frizzled binding,structural molecule activity,protein binding,protein C-terminus binding,immunoglobulin binding,kinesin binding,kinase binding,protein kinase binding,protein phosphatase binding,PDZ domain binding,beta-1 adrenergic receptor binding,beta-2 adrenergic receptor binding,D1 dopamine receptor binding,P2Y1 nucleotide receptor binding,acetylcholine receptor binding,glutamate receptor binding,ionotropic glutamate receptor binding,neurexin family protein binding,protein-containing complex binding,neuroligin family protein binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Dnaaf4	DNAAF4	protein-coding	Rattus norvegicus	ENSRNOG00000056654	Dyx1c1|Edem2|Ekn1	363096	Developmental Dyslexia	8q24	Knockdown(RNAi)	Sprague Dawley	20977651	202	Expeimentalparadigm: Radial water maze  /n  Model Generation: Transfection of<U+00A0>in utero<U+00A0>RNAi of<U+00A0>Dyx1c1<U+00A0>was performed by YW at the University of Connecticut. Two batches of surgeries were performed. In all<U+00A0>Dyx1c1<U+00A0>treatments, plasmids encoding short hairpin (pU6DyxHPB) RNA (Dyx1c1<U+00A0>RNAi) were transfected into the fetal (embryonic day 14, or E14) ventricular zone (VZ) by<U+00A0>in utero<U+00A0>electroporation, following externalization of the uterine horn.<U+00A0>  /n  Rescue: -  /n  Model Summary: Here we report that<U+00A0>in utero<U+00A0>disruption of<U+00A0>Dyx1c1<U+00A0>is associated with impaired learning and memory on a delayed match-to-sample radial water maze task. Moreover, impairments were present even after twelve weeks of testing, indicating that the disruptions to higher order working memory induced by RNAi of<U+00A0>Dyx1c1<U+00A0>were persistent.	protein binding,nuclear estrogen receptor binding	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Autism Spectrum Disorder	X A7.3|X 37.63 cM	Conditional Knockin	C57BL/6	21068835	203	Expeimentalparadigm: Accelerating rotarod//Wire hang//Accelerating rotarod//Dowel walk//Three Chamber Social Test//Olfactory recognition and learning//Acoustic startle response and repulse inhibition//Morris water maze//Open field test//Partition test//Novel object test  /n  Model Generation: To assess the role of MeCP2 in GABAergic neurons we used a bacterial artificial chromosome (BAC) containing the Viaat (vesicular inhibitory amino acid transporter) promoter to target Cre expression in global GABAergic neurons (Supplemental Fig. 1a-c)23. Viaat encodes a transporter required for loading GABA, as well as glycine, into synaptic vesicles24, 25. Since the BAC contained 77.5 kb upstream and 23 kb downstream of the Viaat locus that includes the truncated coding sequence for Actin-related protein 5 homolog (Actr5), we performed quantitative real-time reverse-transcription polymerase chain reaction (Q-RTPCR) and found neither Viaat nor Actr5 is overexpressed in Viaat-Cre mice (Supplemental Fig. 1d). Characterization of Viaat-Cre expression using ROSA26R-EYFP reporter mice26 showed >98% colocalization between GABA and EYFP labeled cells and no colocalization with the astrocytic marker, glial fibrillary acidic protein (GFAP) (Fig.1b and Supplemental Fig. 2a-i, 3a).  /n  Rescue: -  /n  Model Summary: Here we show that mice lacking Mecp2 from GABA (γ-aminobutyric acid)-releasing neurons recapitulate numerous Rett syndrome and autistic features, including repetitive behaviours. Loss of MeCP2 from a subset of forebrain GABAergic neurons also recapitulates many features of Rett syndrome.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Nrg1	NRG1	protein-coding	Mus musculus	ENSMUSG00000062991	6030402G23Rik|ARIA|D230005F13Rik|GGF|GGFII|HRG|HRGalpha|Hgl|NDF|Pro-NRG1|SMDF	211323	Schizophrenia	8|8 A3	Knockout	C57BL/6NCr	21151609	204	Expeimentalparadigm: Locomotion test//Acoustic startle response and prepulse inhibition//Context tone dependent fear learning//Isolation-induced resident-intruder test  /n  Model Generation: The GFP gene was inserted into the NspV-SacI site between the immunoglobulin (Ig)-like and epidermal growth factor (EGF)-like domains of NRG1β1 cDNA [50]. The 2.6 kb cDNA fragment encoding mouse NRG1β1 and GFP tag was then excised by EcoRI-XbaI digestion, subcloned into the EcoRI-XbaI site of a mammalian vector pT113 (gifted from Dr. Shigekazu Nagata, Osaka University) and ligated to an EF-1α gene promoter. The DNA construct of the transgene was confirmed by DNA sequencing (data not shown). Transgenic mice were generated by pronuclear injection of the fragment (shown in Fig. 1A) into fertilized mouse eggs (DBA/2×C57BL/6 F1). The lines of the NRG1-Tg mice (Tg5 and Tg7, chosen for its low copy number of the transgene) were backcrossed with C57BL6NCr mice (purchased from Nihon Charles River, Yokohama, Japan) for 7–9 generations, and their offspring of heterozygous mice was used in this study. Mice were genotyped by PCR using primers corresponding to the Ig-like domain of NRG1 (forward: 5′-TGCCTCCCAGATTGAAAGAG) and the EGF domain of NRG1 (reverse: 5′-TTCTCCTTCTCCGCACACTT), giving a product with 1112 bp.  /n  Rescue: -  /n  Model Summary: To assess the behavioral impact of hyper NRG1 signaling, we generated and analyzed two independent mouse transgenic (Tg) lines carrying the transgene of green fluorescent protein (GFP)-tagged type-1 NRG1 cDNA. The promoter of elongation-factor 1α gene drove ubiquitous expression of GFP-tagged NRG1 in the whole brain. As compared to control littermates, both heterozygous NRG1-Tg lines showed increased locomotor activity, a nonsignificant trend toward decreasing prepulse inhibition, and decreased context-dependent fear learning but exhibited normal levels of tone-dependent learning. In addition, social interaction scores in both Tg lines were reduced in an isolation-induced resident-intruder test.	transcription coregulator activity,signaling receptor binding,ErbB-2 class receptor binding,integrin binding,protein binding,growth factor activity,protein tyrosine kinase activator activity,receptor tyrosine kinase binding,ErbB-3 class receptor binding,chemorepellent activity,receptor ligand activity	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6	21167025	205	Expeimentalparadigm: Developmental milestones test//Three-chambered social approach task//Male-female social interactions//Olfactory habituation-dishabituation testing  /n  Model Generation: We made use of gene targeting in Bruce4 C57BL/6 embryonic stem (ES) cells [32] to generate a mouse line that has loxP sites inserted before exon 4 and after exon 9 (encoding the ankyrin repeats), with the selection cassette (flanked by FRT sites) excised by FLP recombinase. This floxed strategy was chosen to allow us the option of doing conditional (region-specific) knockouts if needed. C57BL/6 was used as the chosen embryonic stem cell line because of the more robust social and cognitive abilities in this line as compared to many of the 129-derived ES lines. For all studies reported here, the floxed allele was first excised by crossing with a CMV-Cre transgenic line (again on a C57BL/6 background) that has ubiquitous Cre expression and a line maintained with a deletion of exons 4 through 9. This Shank3-deficient line was carried forward by crossing heterozygotes with the C57BL/6 strain to maintain a pure C57 background suitable for electrophysiology and behavioral analyses.  /n  Rescue: -  /n  Model Summary: We documented specific deficits in synaptic function and plasticity, along with reduced reciprocal social interactions in<U+00A0>Shank3<U+00A0>heterozygous mice. Our results are consistent with altered synaptic development and function in<U+00A0>Shank3<U+00A0>haploinsufficiency, highlighting the importance of Shank3 in synaptic function and supporting a link between deficits in synapse function and neurodevelopmental disorders.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Attention-Deficit/Hyperactivity Disorder	X A7.1|X 34.83 cM	Knockin	C57BL/6	21220020	206	Expeimentalparadigm: Open field//Social interaction test//Elevated zero maze test//Rotarod//Passive avoidance  /n  Model Generation: FXPM KI [(CGG·CCG)n] mice were generated as previously described (Entezam et al., 2007) with the neomycin gene removed by crossing these animals to mice expressing CRE recombinase under the control of the MMTV promoter. The genetic background was C57BL/6. Briefly, WT and KI mice were produced by pairing female mice heterozygous for the KI allele with WT males. This strategy yielded both WT and KI male mice in the same litters.  /n  Rescue: -  /n  Model Summary: We have studied a male knock-in (KI) mouse model of the fragile X premutation (120-140 repeats) during young adulthood. In comparison to wild type, KI mice were hyperactive, exhibited less anxiety in both the open field and the elevated zero maze, were impaired on the passive avoidance test, and showed some subtle deficits on a test of social interaction. Motor learning as assessed by the rotarod test was normal. Dendritic arbors were less complex and spine densities and lengths increased in medial prefrontal cortex, basal lateral amygdala, and hippocampus compared with wild type. Regional rates of cerebral protein synthesis measured in vivo in KI mice were increased. KI mice also had elevated levels of Fmr1 mRNA and decreased levels of FMRP.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Itgb3	ITGB3	protein-coding	Mus musculus	ENSMUSG00000020689	CD61|GP3A|INGRB3	16416	Obsessive Compulsive Disorder	11 E1|11 67.84 cM	Knockout	C57BL/6J	21254450	207	Expeimentalparadigm: Elevated plus maze//Open field test//Three-chamber sociability//Social novelty test//Olfactory habituation-dishabituation test//Grooming in a novel environment//Home cage grooming  /n  Model Generation: All mice used in experiments were male progeny of pairings of Itgb3 +/- mice on a C57BL/6J background (backcrossed at least 7 generations from 129S2/SvPas according to the Jackson Laboratory, Bar Harbor, ME) that were housed with 3-5 mixed genotype littermate animals per cage.  /n  Rescue: -  /n  Model Summary: Recent work shows that integrin β3 interacts with the serotonin transporter (SERT) in both platelets and in the midbrain. Furthermore, multiple studies have now reported gene-gene interaction between the integrin β3 and SERT genes in association with ASD. Given the lack of previous data on the impact of integrin β3 on brain or behavioral phenotypes, we sought to compare mice with decreased or absent expression of the integrin β3 receptor subunit (Itgb3 +/- and -/-) with wildtype littermate controls in behavioral tasks relevant to ASD. These mice did not show deficits in activity level in the open field or anxiety-like behavior on the elevated plus maze, two potential confounds in the evaluation of mouse social behavior. In the three-chamber social test, mice lacking integrin β3 were shown to have normal sociability but did not show a preference for social novelty. Importantly, the absence of integrin β3 did not impair olfaction or the ability to recall familiar social odors. Additionally, mice lacking integrin β3 showed increased grooming behavior in novel environments.	fibronectin binding,protease binding,protein disulfide isomerase activity,protein kinase C binding,integrin binding,protein binding,fibroblast growth factor binding,enzyme binding,C-X3-C chemokine binding,insulin-like growth factor I binding,neuregulin binding,identical protein binding,vascular endothelial growth factor receptor 2 binding,cell adhesion molecule binding,extracellular matrix binding,fibrinogen binding	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Aggressive Behaviors	2 E3|2 56.63 cM	Conditional Knockout	C57BL/6J	21255268	208	Expeimentalparadigm: Intruder test//Intruder test//Tests for depression-like behaviors//Anxiety tests//Cognitive tests  /n  Model Generation: Mice with floxed BDNF gene were made from 129S6 embryonic stem cells (Zakharenko et al., 2003) and backcrossed to C57BL/6J background animals a minimum of 6 generations. The transgenic BAC KA1-driver line, which has intact endogenous KA-1 receptor alleles, was made from C57BL/6J embryonic stem cells (Nakazawa et al., 2002) and was maintained on C57BL/6 background. The two lines were crossed to obtain heterozygous BDNF floxed Cre-positive males (BDNF f+, Cre), which were then crossed to heterozygous BDNF floxed females (BDNF f+). The resulting homozygous BDNF floxed cre-positive (BDNF ff, Cre) males and homozygous BDNF floxed cre-negative (BDNF ff) females were crossed to obtain BDNF ff, Cre animals further referred to as KO, and BDNF ff animals referred to as WT. The presence of Cre and floxed BDNF alleles was determined as previously described (Zakharenko et al., 2003). Only male KO and WT mice were tested in experiments.  /n  Rescue: -  /n  Model Summary: Here we performed behavioral characterization of conditional BDNF knockout mice generated using a Cre recombinase driver line, KA1-Cre, which expresses Cre in few areas of brain: highly at hippocampal area CA3 and moderately in dentate gyrus, cerebellum and facial nerve nucleus. The mutant animals exhibited elevated conspecific aggression and social dominance, but did not show changes in anxiety-like behaviors assessed using the elevated plus maze and open field test. There were no changes in depression-like behaviors tested in the forced swim test, but small increase in immobility in the tail suspension test. In cognitive tasks, mutants showed normal social recognition and normal spatial and fear memory, but exhibited a deficit in object recognition. Thus, this knockout can serve as a robust model for BDNF-dependent aggression and object recognition deficiency.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Grm6	GRM6	protein-coding	Mus musculus	ENSMUSG00000000617	Gm3|Gprc1f|mGluR6|nerg1|nob2|nob3|nob4	108072	Attention-Deficit/Hyperactivity Disorder	11|11 B1.3	Knockout	C57BL/6J	21333627	209	Expeimentalparadigm: Motor activity test//Y-maze test//Elevated plus maze test  /n  Model Generation: All procedures involving animals were approved by the Animal Experiment Committees of RIKEN, Hokkaido University, and Nagoya City University. Wild type (+/+) and homozygote (-/-) mice with the C57BL/6JJmsSlc (Japan SLC, Inc., Shizuoka, Japan) genetic background (backcross generations; N = 15) were derived from a cross between heterozygote (+/-) mice and genotyped by PCR using tail DNA [2].  /n  Rescue: -  /n  Model Summary: In the present study, we examined motor activity, cognitive and emotional behaviors, and drug administration in juvenile GM3-knockout (GM3-KO) mice. GM3-KO male and female mice showed hyperactivity in the motor activity test, Y-maze test, and elevated plus maze test. In the Y-maze test, there was significantly less spontaneous alternation behavior in GM3-KO male mice than in wild-type mice. In the elevated plus maze test, the amount of time spent on the open arms by GM3-KO male mice was significantly higher than that of sex-matched wild-type mice. In contrast, there was no significant difference between GM3-KO and wild-type female mice in these tests. Thus, juvenile GM3-KO mice show gender-specific phenotypes resembling attention-deficit hyperactivity disorder (ADHD), namely hyperactivity, reduced attention, and increased impulsive behaviors.	adenylate cyclase inhibiting G protein-coupled glutamate receptor activity,group III metabotropic glutamate receptor activity,G protein-coupled receptor activity,glutamate receptor activity,protein homodimerization activity	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Anxiety Disorder	13 D1|13 56.92 cM	Knockout	129Sv	21333660	210	Expeimentalparadigm: Open field test//Elevated plus maze//Novelty suppressed feeding test//Forced swim test  /n  Model Generation: 5-HT1A receptor KO mice (5-HT1A-/-) generated by Parks et al. (Parks et al., 1998) on the C57BL/6 background were crossed with homozygous 5-HT1B receptor KO mice (5-HT1B-/-) generated by Saudou et al. (1994) on the 129 Sv background. These F1 heterozygous 5-HT1A+/- and 5-HT1B+/- mice were then bred to generate double 5-HT1A/1B-/- mice F2 and their wild-type littermates (5-HT1A/1B+/+ control mice). All the animals were genotyped by PCR (Supplementary Materials and Supplementary Fig. 1).  /n  Rescue: -  /n  Model Summary: Here, we studied the neurochemical and behavioral effects of a double 5-HT(1A/1B) receptor knockout in mice (5-HT(1A/1B)-/-) as compared to their wild-type littermates (5-HT(1A/1B)+/+). It is known that single deletion of either 5-HT(1A) or 5-HT(1B) receptor induces behavioral changes that are not correlated with differences in brain serotonergic tone. Deletion of both receptors resulted in (i) higher emotionality of animals, as observed in three unconditioned paradigms of anxiety (open field, elevated plus maze and novelty suppressed feeding tests); (ii) a ≈200% increase in the mean spontaneous firing rate of 5-HT neurons in the dorsal raphe nucleus (DRN) compared to 5-HT(1A/1B)+/+ mice; (iii) elevated basal dialysate levels of 5-HT in the DRN and frontal cortex; (iv) an exaggerated response to acute paroxetine administration in microdialysis experiments, and (v) increased basal core body temperature. These findings suggest that the deletion of both autoreceptors induces a strong anxious-like behavioral state associated with increased 5-HT neurotransmission. Interestingly, 5-HT(1A/1B)-/- mice are still sensitive to the acute administration of diazepam. Moreover, while deletion of both receptors impacted on the response to acute SSRI treatment in the forced swim test, anxiolytic-like effects of a chronic SSRI treatment were still observed in 5-HT(1A/1B)-/- mice. Thus, the 5-HT(1A/1B)-/- mouse model could be of great interest to unveil the mechanisms of action of the anxiolytic effects of SSRIs.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6	21408181	211	Expeimentalparadigm: 5-Choice serial reaction time task  /n  Model Generation: We used male wildtype and NK1R-/- mice (25–40 g and 6–8 weeks of age at the start of each experiment) from a colony based at UCL. Both genotypes derived from a 129/Sv x C57BL/6 genetic background, crossed with an outbred MF1 strain (Harlan OLAC, Bicester, UK), for one generation, many generations ago [7].  /n  Rescue: -  /n  Model Summary: In addition to locomotor hyperactivity, NK1R-/- mice express inattentiveness, perseveration and impulsivity in the 5-CSRTT, thereby matching core criteria for a model of ADHD. Because d-amphetamine reduced perseveration in NK1R-/- mice, this action does not require functional NK1R. However, the lack of any improvement of omissions and premature responses in NK1R-/- mice given d-amphetamine suggests that beneficial effects of this psychostimulant in other rodent models, and ADHD patients, need functional NK1R. Finally, our results reveal experimental variables (stimulus parameters, stress and time of day) that could influence translational studies.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Schizophrenia	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	21414604	212	Expeimentalparadigm: Operant lever press training  /n  Model Generation: The human D2 receptor open reading frame was cloned into the pMM400 plasmid (Mayford et al., 1996) modified to carry the human growth hormone poly adenylation sequence instead of the described SV40 poly A. The NotI fragment was isolated and used to generate transgenic mice by injection into pronuclei of one-cell C57Bl/6-CBA(J) F2 oocytes, which were transferred the next day via the oviduct into pseudopregnant foster females. Transgenic founder animals were identified by Southern blots using a probe specific for the tetO promoter sequence. Progeny of founder animals were crossed with mice expressing the tTA transgene under the control of the CamKIIα promoter (Mayford et al., 1996; line B). Offspring were genotyped by independent Southern blots for tTA and tetO. For regulating tetO-driven gene expression, mice were fed doxycycline-supplemented chow (41 mg/kg, Mutual Pharmaceutical).  /n  Rescue: -  /n  Model Summary: The reluctance of D2R-OE mice to work is due neither to intolerance for low rates of reward, decreased reactivity to reward, nor increased sensitivity to satiety or fatigue but to a difference in willingness to work for reward. As in patients with schizophrenia, this deficit was not ameliorated by D2R blockade, suggesting that reversal of the motivational deficit by switching off the transgene results from molecular changes downstream of D2R overexpression.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Atp1a3	ATP1A3	protein-coding	Mus musculus	ENSMUSG00000040907	Atpa-2	232975	Bipolar Disorder	7 A3|7 13.73 cM	Mutated	129P2/OlaHsd;Black Swiss	21418141	213	Expeimentalparadigm: Elevated plus maze//Novel object recognition//Preference for sociability and social novelty//Tail suspension test//Sucrose preference test  /n  Model Generation: Mice heterozygous for a point mutation in Atp1a3 intron 4 (Atp1a3tm1Ling or Atp1a3+/-) with a 129P2/OlaHsd × Black Swiss F2 genetic background were previously generated by Moseley et al. (2007) and obtained from Professor Jerry Lingrel (University of Cincinnati). The α3 isoform-deficient mice were generated from gene targeting that produced a single base pair mutation in intron 4 adjacent to the exon–intron splice site. This mutation results in aberrant splicing of the α3 gene, adding an additional 126 bp to the RNA transcript. This mutant transcript does not express the α3 isoform protein product because no band except the predicted 110 kDa product was observed by Western blot, the size of the protein expected for the α subunit (Kaplan, 2002). When bred to homozygosity for the mutant allele, pups died shortly after birth, but mice heterozygous for the α3 gene are viable and fertile.  /n  Rescue: -  /n  Model Summary: Here, we show that Na(+) ,K(+) -ATPase α3 heterozygous mice (Atp1a3(+/-) ), with 15% reduced neuronal Na(+) ,K(+) -ATPase activity, are vulnerable to develop increased depression-like endophenotypes in a chronic variable stress (CVS) paradigm compared to wild-type littermates (Atp1a3(+/+) ). In Atp1a3(+/+) mice CVS did not decrease Na(+) ,K(+) -ATPase activity, however led to despair-like behavior in the tail suspension test (TST), anhedonia in a sucrose preference test and a minimal decrease in sociability, whereas in Atp1a3(+/-) mice CVS decreased neuronal Na(+) ,K(+) -ATPase activity to 33% of wild-type levels, induced despair-like behavior in the TST, anhedonia in a sucrose preference test, anxiety in the elevated plus maze, a memory deficit in a novel object recognition task and sociability deficits in a social interaction test. We found that a mutation that decreases neuronal Na(+) ,K(+) -ATPase activity interacts with stress to exacerbate depression. Furthermore, we observed an interesting correlation between Na(+) ,K(+) -ATPase activity and mood that may relate to both unipolar depression and bipolar disorder. Pharmaceuticals that increase Na(+) ,K(+) -ATPase activity or block endogenous Na(+) , K(+) -ATPase inhibition may provide effective treatment for depressive disorders and preclude depression in susceptible individuals.	nucleotide binding,amyloid-beta binding,transporter activity,P-type sodium:potassium-exchanging transporter activity,ATP binding,P-type potassium transmembrane transporter activity,ATP hydrolysis activity,ATPase-coupled cation transmembrane transporter activity,D1 dopamine receptor binding,heparan sulfate proteoglycan binding,metal ion binding,chaperone binding,P-type sodium:potassium-exchanging transporter activity involved in regulation of cardiac muscle cell membrane potential	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Manic Episodes	13 C1|13 40.1 cM	Knockdown	129Sv/J;C57BL/6J	21421642	214	Expeimentalparadigm: Mouse behavioral pattern monitor//Lowa gambling task  /n  Model Generation: Female DAT KD and WT littermate mice (n=15 per group) were trained in the mouse IGT. The mice were generated by inserting modified embryonic stem cells of the 129Sv/J mouse strain in C57BL/6J blastocysts. Alteration of these stem cells was detailed by<U+00A0>Zhuang et al. (2001). DAT heterozygous breeders were sent to our laboratory from Columbia University.  /n  Rescue: -  /n  Model Summary: Increased risk-taking behavior in dopamine transporter knockdown mice: further support for a mouse model of mania	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6	21423165	215	Expeimentalparadigm: Grooming behaviour//In situ hybridization//Motor and Anxiety-like behaviours//Open field test//Dark-Light test//Three-chamber social test//Dyadic social interaction//Sociability test//Rotarod//Morris water maze  /n  Model Generation: Shank3 mutant mice were generated by homologous recombination in R1 embryonic stem cells and implanted in C57 blastocysts using standard procedures. One targeting vector (Shank3A) was designed to replace exon 4–7 (containing the ankyrin repeat domains) and another vector (Shank3B) was designed to replace exon 13–16 (containing the PDZ domain) of the Shank3 gene with a NEO cassette. Genotypes were determined by PCR of mouse tail DNA.  /n  Rescue: -  /n  Model Summary: Here we show that mice with Shank3 gene deletions exhibit self-injurious repetitive grooming and deficits in social interaction. Cellular, electrophysiological and biochemical analyses uncovered defects at striatal synapses and cortico-striatal circuits in Shank3 mutant mice. Our findings demonstrate a critical role for SHANK3 in the normal development of neuronal connectivity and establish causality between a disruption in the Shank3 gene and the genesis of autistic-like behaviours in mice.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Bipolar Disorder	5 C3.3|5 40.63 cM	Mutated	BALB/cJ	21430648	216	Expeimentalparadigm: Elevated plus maze//Dark-light box test//Forced swim test//Learned helplessness  /n  Model Generation: ClockΔ19 mice were created by N-ethyl-N-nitrosourea mutagenesis on a BALB/cJ background and produce a dominant-negative CLOCK protein as described previously (King et al, 1997; Vitaterna et al, 2006). Male Clock mutant (ClkΔ19/ClkΔ19) and wild-type (+/+) littermate controls, 8–10 weeks old, were utilized in all studies.  /n  Rescue: -  /n  Model Summary: Here we find that ClockΔ19 mice have an increase in dopaminergic activity in the ventral tegmental area (VTA), and that lithium treatment selectively reduces the firing rate in the mutant mice with no effect on activity in wild-type mice. Furthermore, lithium treatment reduces nucleus accumbens (NAc) dopamine levels selectively in the mutant mice. The increased dopaminergic activity in the Clock mutants is associated with cell volume changes in dopamine neurons, which are also rescued by lithium treatment. To determine the role of dopaminergic activity and morphological changes in dopamine neurons in manic-like behavior, we manipulated the excitability of these neurons by overexpressing an inwardly rectifying potassium channel subunit (Kir2.1) selectively in the VTA of ClockΔ19 mice and wild-type mice using viral-mediated gene transfer. Introduction of this channel mimics the effects of lithium treatment on the firing rate of dopamine neurons in ClockΔ19 mice and leads to a similar change in dopamine cell volume. Furthermore, reduction of dopaminergic firing rates in ClockΔ19 animals results in a normalization of locomotor- and anxiety-related behavior that is very similar to lithium treatment; however, it is not sufficient to reverse depression-related behavior.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
Pdgfrb	PDGFRB	protein-coding	Mus musculus	ENSMUSG00000024620	CD140b|PDGFR-1|Pdgfr	18596	Autism Spectrum Disorder	18 E1|18 34.41 cM	Conditional Knockout	C57BL/6J	21437241	217	Expeimentalparadigm: Hot plate test//Food search test//Social interaction test//Contextual and cued fear conditioning//Prepulse inhibitionForced swim test  /n  Model Generation: The Cre/loxP system was used to develop conditional PDGFR-β KO mutants. A previously established mutant mouse line was used, in which exons 4–7 of PDGFR-β, which encode the extracellular domain of the PDGFR-β protein, were flanked by 2 loxP sequences (floxed) positioned in introns 3 and 7 [33]. After Cre-mediated recombination, deletion of the loxP-flanking region and resulting frame shift mutation in the adjoining 3′ region occurred in PDGFR-β. To obtain conditional PDGFR-β KO, we then crossed mutant mice harboring the PDGFR-β floxed allele and those expressing Cre recombinase under the control of the nestin promoter and enhancer (nestin-Cre mouse, The Jackson Laboratory, Bar Harbor, ME, USA) as previously described [26], [34]. Before this cross, both mutant mice harboring floxed PDGFR-β and +nestin-Cre+ were outbred to the mice of C57BL/6J (B6/J) strain for 14 generations to replace the genetic background of our mutant mice with that of the B6/J strain.  /n  Rescue: -  /n  Model Summary: Here we generated novel mutant mice (PDGFR-β KO) in which PDGFR-β was conditionally deleted in CNS neurons using the Cre/loxP system. Mice without the Cre transgene but with floxed PDGFR-β were used as controls. Both groups of mice reached adulthood without any apparent anatomical defects. These mice were further examined by conducting several behavioral tests for spatial memory, social interaction, conditioning, prepulse inhibition, and forced swimming. The test results indicated that the PDGFR-β KO mice show deficits in all of these areas.	nucleotide binding,protein kinase activity,protein tyrosine kinase activity,transmembrane receptor protein tyrosine kinase activity,platelet-derived growth factor receptor activity,platelet-derived growth factor beta-receptor activity,signaling receptor binding,platelet-derived growth factor receptor binding,protein binding,ATP binding,kinase activity,transferase activity,growth factor binding,enzyme binding,protein kinase binding,vascular endothelial growth factor binding,phosphatidylinositol 3-kinase binding,platelet-derived growth factor binding	Ani
Git1	GIT1	protein-coding	Mus musculus	ENSMUSG00000011877	Cat-1|p95Cat	216963	Attention-Deficit/Hyperactivity Disorder	11|11 B5	Knockout	C57BL/6	21499268	218	Expeimentalparadigm: Open field test//Morris water maze  /n  Model Generation: A mouse embryonic stem cell clone containing a gene trap insertion in the Git1 gene (FHCRC-GT-S10-12C1) was obtained from the Fred Hutchinson Cancer Research Center. Cultured embryonic cells were microinjected into C57BL/6 blastocysts (the Jackson Laboratory) and implanted into pseudopregnant ICR females (Charles River Laboratories) to generate chimeras. Chimeras were identified by agouti coat color and validated by genomic PCR. Chimeric mice were crossed with C57BL/6 and 129/SV/Jae (the Jackson Laboratory) in parallel for breeding.  /n  Rescue: Indeed, amphetamine rapidly suppressed hyperactivity in Git1-/- mice, restoring locomotor activity to near that of saline-treated (control) WT mice (Fig. 1h,i). In contrast to Git1-/- mice, amphetamine-treated WT mice showed markedly enhanced locomotor activity. These findings are analogous to the reported effects of psychostimulants on WT and ADHD model mice27,28,29. Methylphenidate, another stimulant medication, similarly alleviated hyperactivity in Git1-/- mice, whereas it induced hyperactivity in WT mice (Supplementary Fig. 7). Treatment of Git1+/- mice with amphetamine markedly increased locomotor activity (Supplementary Fig. 5b), which is consistent with the absence of hyperactivity in these mice (Supplementary Fig. 5a).  /n  Model Summary: Here we report a previously unidentified association between G protein-coupled receptor kinase-interacting protein-1 (GIT1) and ADHD in humans. An intronic single-nucleotide polymorphism in GIT1, the minor allele of which causes reduced GIT1 expression, shows a strong association with ADHD susceptibility in humans. Git1-deficient mice show ADHD-like phenotypes, with traits including hyperactivity, enhanced electroencephalogram theta rhythms and impaired learning and memory. Hyperactivity in Git1(-/-) mice is reversed by amphetamine and methylphenidate, psychostimulants commonly used to treat ADHD. In addition, amphetamine normalizes enhanced theta rhythms and impaired memory. GIT1 deficiency in mice leads to decreases in ras-related C3 botulinum toxin substrate-1 (RAC1) signaling and inhibitory presynaptic input; furthermore, it shifts the neuronal excitation-inhibition balance in postsynaptic neurons toward excitation.	GTPase activator activity,protein binding,protein phosphatase binding,small GTPase binding,identical protein binding,gamma-tubulin binding,protein-containing complex binding,metal ion binding,scaffold protein binding,structural constituent of postsynaptic specialization,protein tyrosine kinase binding	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Intellectual Disability	X A7.1|X 34.83 cM	Conditional Knockout	C57BL/6	21516088	219	Expeimentalparadigm: DNMP-RAM test  /n  Model Generation: We performed all procedures involving live animals according to protocols approved by the University of New Mexico Animal Care and Use Committee. We generated the inducible conditional mutant and restoration mice by breeding Nes-CreERT2+/+: R26R-YFP+/+ homozygote male mice24 with female Fmr1loxP/y mice23 and female Fmr1loxP-Neo/yNes-CreERT2+/-:R26R-YF-/- mice24, respectively We genotyped the mice as previously described 23–24,48. Tamoxifen (Sigma-Aldrich) was performed based on a published procedure 24.  /n  Rescue: Conversely, restoration of Fmrp expression specifically in aNSCs rescues these learning deficits in Fmrp-deficient mice.  /n  Model Summary: Here we show that ablation of Fmrp in aNSCs by inducible gene recombination leads to reduced hippocampal neurogenesis in vitro and in vivo, as well as markedly impairing hippocampus-dependent learning in mice.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Hcrtr1	HCRTR1	protein-coding	Mus musculus	ENSMUSG00000028778	Ox1r|ox-1-R|ox1-R	230777	Narcolepsy	4|4 D2.2	Double Knockout	C57BL/6;129/SvEv	21533254	220	Expeimentalparadigm: Ambulation//Running wheel//Nesting behaviors  /n  Model Generation: DKO mice were originally created by cross breeding heterozygous progeny of homozygous single receptor knockouts (OX1RKO×OX2RKO).<U+00A0>  /n  Rescue: Neostigmine increased the number of arrests in DKO mice without altering arrest lifetimes but did not provoke arrests in WT mice. Co-injection of atropine abolished this effect.<U+00A0>  /n  Model Summary: DKO mice exhibit fragmented rest states and behavioral arrests which are similar to narcolepsy symptoms observed in orexin deficient mice	G protein-coupled receptor activity,protein binding,orexin receptor activity,peptide hormone binding	Ani
Hcrtr2	HCRTR2	protein-coding	Mus musculus	ENSMUSG00000032360	OX2R|OX2aR|OX2bR|OXR2|mOX2aR|mOX2bR|mOXR2	387285	Narcolepsy	9|9 D	Double Knockout	C57BL/6;129/SvEv	21533254	221	Expeimentalparadigm: Ambulation//Running wheel//Nesting behaviors  /n  Model Generation: DKO mice were originally created by cross breeding heterozygous progeny of homozygous single receptor knockouts (OX1RKO×OX2RKO).<U+00A0>  /n  Rescue: Neostigmine increased the number of arrests in DKO mice without altering arrest lifetimes but did not provoke arrests in WT mice. Co-injection of atropine abolished this effect.<U+00A0>  /n  Model Summary: DKO mice exhibit fragmented rest states and behavioral arrests which are similar to narcolepsy symptoms observed in orexin deficient mice	G protein-coupled receptor activity,protein binding,orexin receptor activity,peptide hormone binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6J	21558424	222	Expeimentalparadigm: Sociability test//Ultrasonic vocalizations//Open field test//Novelty object recognition test//Homing box//Prepulse inhibition//Morris water maze//Social transmission of food preference//Probe tests for acquisition testing  /n  Model Generation: We generated Shank3 mutant mice using a conventional gene-targeting approach (32) where exons 4–9 of the Shank3 gene were deleted (Fig. 1A, B and C and Supplementary Material, Fig. S1A1 and A2). The naturally occurring Disc1 (Disrupted in Schizophrenia 1) mutation in the 129SvEv line of ES cells was segregated from Shank3e4–9 at the beginning of backcrossing to avoid any possible confounding effects in our experiments (Supplementary Material, Fig. S1A3) (33–35). All Shank3 mice used in the experiments had been backcrossed for more than seven generations onto a C57BL/6J background.  /n  Rescue: -  /n  Model Summary: To evaluate the role of Shank3 in vivo, we disrupted major isoforms of the gene in mice by deleting exons 4-9. Isoform-specific Shank3(e4-9) homozygous mutant mice display abnormal social behaviors, communication patterns, repetitive behaviors and learning and memory. Shank3(e4-9) male mice display more severe impairments than females in motor coordination. Shank3(e4-9) mice have reduced levels of Homer1b/c, GKAP and GluA1 at the PSD, and show attenuated activity-dependent redistribution of GluA1-containing AMPA receptors. Subtle morphological alterations in dendritic spines are also observed. Although synaptic transmission is normal in CA1 hippocampus, long-term potentiation is deficient in Shank3(e4-9) mice.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Oprm1	OPRM1	protein-coding	Mus musculus	ENSMUSG00000000766	M-OR-1|MOP-R|MOR-1|MOR-1O|Oprm|mor|muOR	18390	Anxiety Disorder	10 A1|10 1.85 cM	Knockout	C57BL/6J	21703297	223	Expeimentalparadigm: Social interaction test//Chronic social defeat stress procedure  /n  Model Generation: We used congenic homozygote MOR-KO mice and wild-type mice that were generated by heterozygote-heterozygote crosses of MOR-KO mice on C57BL/6J backgrounds (Hall et al., 2003; Sora et al., 1997).  A 595-bp genomic hybridization probe recognizing the 5′ flanking region of the μ receptor’s first exon from the 129/SvEv mouse strain was amplified using 30 cycles of PCR, 1 μg of genomic DNA, and oligonucleotides 5′- ATTGCATATGGTTAGTTGAGTCGGAAGAGTGTTGAGGTAT-3′ and 5′-TGAATGCTTGCTGCGGACTCGGTAGGCTGTA ACTGAGAGC-3′ based on reported sequences (35) and was subcloned into pCRII (Invitrogen) to produce pCRIIm1204-1756. The insert from pCRIIm1204-1756 was radiolabeled by random priming and was used to identify a 16.5-kb μ opiate receptor genomic fragment from a λ-FIX II genomic library prepared from the 129 mouse strain (Stratagene) (Fig. 1A). The 16.5-kb fragment containing 8.3 kb of the 5′ flanking sequence, the 561-bp first exon, and 7.7 kb of first intronic sequences from the mouse μ opiate receptor gene (35) was subcloned into pBluescript (pBS) (Stratagene) to produce pBSμ16.5. A μ receptor targeting vector was constructed using a 3.2-kb EcoRV–BglII 5′ fragment and a 5.1-kb EcoRI 3′ fragment subcloned into pPGKneo (36) (Fig. 1B). The final construct, designated pmKO2, contained the herpes simplex virus thymidine kinase (tk) gene driven by the MC1 polyoma enhancer at the 3′ end of the EcoRI 3′ fragment. To identify homologous recombinants, 3′ and 5′ hybridization probes were prepared by subcloning 183 bp of the 5′ EcoRV fragment and 420 bp of the 3′ EcoRI fragments from pBSμ16.5 into pBS to produce pBSμ5′183 and pBSμ3′420, respectively (Fig. 1C). Twenty five micrograms of pmKO2 DNA was linearized with BamHI and transfected by electroporation into 107 AB1 ES cells derived from 129/SvEv mice (36) (kindly supplied by Allan Bradley, Baylor College of Medicine, Houston). AB1 ES cells were cultured on mitotically inactive SNL76/7 feeder cells clonally derived from STO cells stably expressing leukemia inhibitory factor and neomycin resistance genes in DMEM containing 15% fetal bovine serum (HyClone) and 0.1 mM β-mercaptoethanol (37). ES cells were selected for homologous recombination by culture in medium containing 500 μg/ml G418 and 2 μM gancyclovir (a generous gift of Syntex, Palo Alto, CA) on days 2–7 after transfection. G418- and gancyclovir-resistant colonies were picked on day 8. BamHI digests of DNA prepared from 800 resistant clones were screened by Southern blot analyses using the insert from pBSμ5′-183 radiolabeled by random priming as hybridization probes. Six positive ES cell lines from the doubly resistant colonies displayed the ≈20-kb BamHI fragment anticipated of homologous recombinants and readily distinguishable from the 5-kb fragment obtained from wild-type DNA. Chimeric mice were generated by injecting 15–20 homologous, recombinant ES cells into blastocysts harvested from C57BL/6J mice and by implanting the blastocysts into the uteri of pseudopregnant CD-1 mice (Charles River Breeding Laboratories) 2.5 days postcoitus (38). Blastocysts injected with four of the six homologous, recombinant ES cell lines yielded chimeric animals, as assessed by coat color. Southern blot analyses of DNA extracted from tail tip specimens of the offspring of the chimeras revealed that germ line transmission was achieved from two ES cell lines, 1H8 and 5A20 (Fig. 1D). Fifty-four percent of 103 offspring of matings between chimera from the 1H8 cell line and C57BL/6J females revealed disrupted μ receptor alleles, and F2 homozygote, heterozygote, and wild-type offspring of F1 × F1 intercrosses were used for further biochemical and behavioral testing.  /n  Rescue: -  /n  Model Summary: Substantial evidence exists that opioid systems are involved in stress response and that changes in opioid systems in response to stressors affect both reward and analgesia. Reportedly, mice suffering chronic social defeat stress subsequently show aversion to social contact with unfamiliar mice. To further examine the role of opioid systems in stress response, the behavioral and neurochemical effects of chronic social defeat stress (psychosocial stress) were evaluated in μ-opioid-receptor knockout (MOR-KO) mice. Aversion to social contact was induced by chronic social defeat stress in wild-type mice but was reduced in MOR-KO mice. Moreover, basal expression of brain-derived neurotrophic factor (BDNF) mRNA in MOR-KO mice hippocampi was significantly lower than in wild-type mice. Psychosocial stress significantly decreased BDNF mRNA expression in wild-type mice but did not affect BDNF expression in MOR-KO mice; no difference in basal levels of plasma corticosterone was observed.	G-protein alpha-subunit binding,G protein-coupled receptor activity,beta-endorphin receptor activity,G protein-coupled opioid receptor activity,voltage-gated calcium channel activity,protein binding,protein C-terminus binding,protein domain specific binding,filamin binding,G-protein beta-subunit binding,morphine receptor activity,peptide binding,neuropeptide binding	Ani
Gnb5	GNB5	protein-coding	Mus musculus	ENSMUSG00000032192	GBS|Gbeta5|Hg2e|flr	14697	Attention-Deficit/Hyperactivity Disorder	9 D|9 42.3 cM	Knockout	C57BL/6	21766168	224	Expeimentalparadigm: Open field test//Thigmotaxis//Motor coordination test//Hot plate paw lick test  /n  Model Generation: The Gβ5-/-mice were generated previously and were back-crossed with C57/Bl6 mice for six generations.  /n  Rescue: -  /n  Model Summary: Elimination of Gβ5-RGS complexes led to a striking level of hyperactivity that far exceeds activity levels previously observed in animal models. This hyperactivity was accompanied by motor learning deficits and paradoxical behavioral sensitization to a novel environment. Neurochemical studies indicated that Gβ5-RGS-deficient mice had higher sensitivity of inhibitory GPCR signaling and deficits in basal levels, release, and reuptake of dopamine. Surprisingly, pharmacological treatment with monoamine reuptake inhibitors failed to alter hyperactivity. In contrast, blockade of NMDA receptors reversed the expression of hyperactivity in Gβ5-RGS-deficient mice.	GTPase activator activity,protein binding,signaling receptor complex adaptor activity,G-protein gamma-subunit binding,GTPase activating protein binding,chaperone binding	Ani
Gnao1	GNAO1	protein-coding	Mus musculus	ENSMUSG00000031748	Galphao|Gnao|Hg1g|alphaO	14681	Aggressive Behaviors	8 C5|8 45.94 cM	Conditional Knockout	C57BL/6	21768373	225	Expeimentalparadigm: Resident–intruder test//Male mounting behavior//Maternal aggression//Food localization//Olfactory habituation–dishabituation assay//Pup retrieval assay  /n  Model Generation: Gnao1-deficient mice were generated by disrupting the Gnao1 gene in a three-step process. First, in ES cells, loxP recombination sites were introduced into the introns that flank exons 5 and 6 of the Gnao1 gene (floxing) by homologous recombination. Electroporation and isolation of the neomycin-resistant cell clones were performed as outlined in ref. 1. Second, mice born from blastocysts that had received the targeted ES cells were used for breeding mice homozygous for the Gnao1 gene with floxed exons 5 and 6 (Gnao1fx/fx mice). Third, Gnao1fx/fx mice were crossed to mice carrying a transgene directing the expression of Cre recombinase under the control of the olfactory marker protein (OMP) promotor (OMP-Cre mice; B6;129P2-Omptm4(cre)Mom/MomJ). OMP is an abundant cytosolic protein expressed in all mature olfactory sensory neurons and vomeronasal sensory neurons (VSNs). Additional breeding established offspring that were homozygous for the floxed Gnao1 alleles and heterozygous for Cre and OMP (Gαo-/- OMP-Cre+/-). In these mice, cre-mediated Gnao1 deletion was restricted to OMP-positive cells.  /n  Rescue: -  /n  Model Summary: We have used gene targeting to examine the role of the G protein Gαo, encoded by the gene Gnao1, in vomeronasal function. We used the Cre-loxP system to delete Gαo in those cells that express olfactory marker protein, which includes all vomeronasal sensory neurons of the basal layer of the VNO sensory epithelium. Using electrophysiology and calcium imaging, we show that the conditional null mice exhibit strikingly reduced sensory responses in V2R receptor-expressing vomeronasal sensory neurons to specific molecular cues, including MHC1 antigens, major urinary proteins, and exocrine gland-secreting peptide. Gαo is also vital for vomeronasal sensing of two N-formylated mitochondrially encoded peptides derived from NADH dehydrogenase 1. Furthermore, we show that Gαo is an essential requirement for the display of male-male territorial aggression as well as maternal aggression in mice. Finally, we show that Gαo-dependent maternal aggression can be induced by major urinary proteins.	nucleotide binding,G protein-coupled receptor binding,GTPase activity,signaling receptor binding,protein binding,GTP binding,guanyl nucleotide binding,G-protein beta/gamma-subunit complex binding,G protein-coupled serotonin receptor binding,mu-type opioid receptor binding,GTPase activating protein binding,metal ion binding,corticotropin-releasing hormone receptor 1 binding	Ani
Gsk3b	GSK3B	protein-coding	Mus musculus	ENSMUSG00000022812	7330414F15Rik|8430431H08Rik|GSK-3|GSK-3beta|GSK3	56637	Bipolar Disorder	16|16 B3	Transgene	C57B6/129	21821916	226	Expeimentalparadigm: Forced swim test//Hole board exploratory behavior//Elevated zero maze  /n  Model Generation: The Gsk3b transgene was generated with Xenopus Gsk3b (93% identical to mouse and human Gsk3b and 97% similar to mouse and human Gsk3b; ref. 27), provided by David Kimelman (University of Washington, Seattle, Washington, USA), and driven by the mouse prion promoter (MoPrP.Xho; gift of David Borchelt, Johns Hopkins University, Baltimore, Maryland, USA) (39, 60). A 6X-his tag was added to the C terminus to distinguish endogenous from transgenic GSK-3β. Linearized plasmid was purified and injected into C57B6/129 heterozygous blastocysts by the University of Pennsylvania Transgenic and Chimeric Mouse Facility for generation of mice. Two founders were used to establish distinct lines, PrpGsk3bL56 and PrpGsk3bL64, which were backcrossed into the C57/B6 strain for more than 10 generations. Both transgenic lines had normal litter sizes, and the transgene was transmitted in normal Mendelian fashion. Tissue from 3-month-old mice of each line was harvested for molecular analysis. Several brain regions were microdissected, and transgene expression was confirmed for both lines by RT-PCR. Transgenic protein expression was assessed by Western blot for the C-terminal his tag and for GSK-3β. Inositol levels were similar in the cortex, striatum, and hippocampus of WT, PrpGsk3bL56, and PrpGsk3bL64 mice (Supplemental Methods, Supplemental Results, and Supplemental Figure 3).  /n  Rescue: -  /n  Model Summary: Here, we show what we believe to be a new link between GSK-3 and the β-arrestin-2 complex in mice and propose an integrated mechanism that accounts for the effects of lithium on multiple behaviors. GSK-3β (Gsk3b) overexpression reversed behavioral defects observed in lithium-treated mice and similar behaviors observed in Gsk3b+/- mice.	nucleotide binding,protease binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,integrin binding,protein binding,ATP binding,beta-catenin binding,kinase activity,transferase activity,protein kinase binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding,dynactin binding,ionotropic glutamate receptor binding,tau protein binding,tau-protein kinase activity,NF-kappaB binding,RNA polymerase II-specific DNA-binding transcription factor binding,dynein complex binding,protein serine kinase activity,protein serine/threonine kinase binding	Ani
Maoa	MAOA	protein-coding	Mus musculus	ENSMUSG00000025037	1110061B18Rik	17161	Aggressive Behaviors	X A1.2|X 11.78 cM	Knockout	129S6	21832987	227	Expeimentalparadigm: Open field//Elevated plus-maze//Light–dark box//Marble burying//Water mist-induced grooming//Social interaction//Resident–intruder aggression  /n  Model Generation: The MAO-ANeo construct was specifically designed to harbor a floxed neomycin selection cassette (NeoR) in intron-12 of the Maoa gene and a loxP sequence in intron-11. This particular configuration was devised to generate a hypomorphic variant in which either the NeoR cassette or exon-12 (which encodes for the active site of the enzyme) may be removed upon recombination with Cre sequences. The full details of the generation of MAO-ANeo mice are presented under Supplementary Materials and Methods. Briefly, an MAO-ANeo targeting vector was derived from the plasmid pPGKneo-I—containing the NeoR cassette with a phosphoglycerate kinase-1 (PGK1) promoter—and a 9-kb BamHI MAO-A clone (Figure 1a). The MAO-ANeo targeting vector was electroporated into embryonic stem cells as described and incubated in the culture medium with G418 for neomycin-resistance selection. Two independent neomycin-resistant homologous recombinant clones were selected among the embryonic stem cell lines and used to generate two lines of 129S6 mice. The presence of loxP sequences was then ascertained by genomic DNA PCR and the selected line of MAO-ANeo mice was then expanded into a stable colony. Throughout the study MAO-ANeo mice were compared with WT littermates as well as age-matched MAO-A KO mice on 129S6 genetic background. In particular, for MAO-A KO mice, we used MAO-AA863T KO mice, which show a spontaneous point nonsense mutation strikingly similar to that featured in Brunner syndrome (Brunner et al, 1993). Each line was bred with homogenotypic pairs and backcrossed to 129S6 every three generations.  /n  Rescue: -  /n  Model Summary: Here we report the generation of MAO-A(Neo) mice, a novel line of hypomorphic MAO-A mutants featuring the insertion of a floxed neomycin-resistance cassette in intron-12 of the Maoa gene. This construct resulted in a chimeric, non-functional variant of the Maoa-Neo transcript, with a truncated C-terminus, likely due to aberrant splicing; these deficits notwithstanding, small amounts of functional Maoa transcript were found in the brain of MAO-A(Neo) mice. In the prefrontal cortex and amygdala, MAO-A(Neo) mice showed low, yet detectable, MAO-A catalytic activity, as well as 5-HT levels equivalent to WT littermates; conversely, the hippocampus and midbrain of MAO-A(Neo) mice featured a neurochemical profile akin to MAO-A-knockout (KO) mice, with undetectable MAO-A activity and high 5-HT concentrations. MAO-A(Neo) mice showed significant increases in dendritic length in the pyramidal neurons of orbitofrontal cortex, but not basolateral amygdala, in comparison with WT littermates; by contrast, the orbitofrontal cortex of MAO-A KO mice showed significant reductions in basilar dendritic length, as well as a profound increase in apical dendritic length. MAO-A(Neo) mice showed a unique set of behavioral abnormalities, encompassing reduced open-field locomotion, perseverative responses, such as marble burying and water mist-induced grooming, and a lack of anxiety-like behaviors in the elevated plus-maze and light-dark box paradigms. Notably, whereas MAO-A(Neo) and KO mice showed significant reductions in social interaction, only the latter genotype showed increases in resident-intruder aggression.	protein binding,primary amine oxidase activity,oxidoreductase activity,flavin adenine dinucleotide binding,serotonin binding,tryptamine:oxygen oxidoreductase (deaminating) activity,aminoacetone:oxygen oxidoreductase(deaminating) activity,aliphatic amine oxidase activity,phenethylamine:oxygen oxidoreductase (deaminating) activity,monoamine oxidase activity	Ani
Gucy2c	GUCY2C	protein-coding	Mus musculus	ENSMUSG00000042638	GC-C|Gcc	14917	Attention-Deficit/Hyperactivity Disorder	6 G1|6 66.67 cM	Knockout	C57BL/6	21835979	228	Expeimentalparadigm: Locomotion test//Olfactory habituation test//Go no-go task  /n  Model Generation: Wild-type mice were of strain C57BL/6 (VitalRiver Laboratory Animal Inc., Beijing). The methods of generating GC-C KO mice are described in details in a previous study (17). Briefly, GC-C KO mice were produced by gene targeting in E14TG2A embryonic stem cells.  /n  Rescue: -  /n  Model Summary: Here, we report that these neurons in mice selectively express guanylyl cyclase-C (GC-C), a membrane receptor previously thought to be expressed mainly in the intestine. GC-C activation potentiates the excitatory responses mediated by glutamate and acetylcholine receptors via the activity of guanosine 3',5'-monophosphate-dependent protein kinase (PKG). Mice in which GC-C has been knocked out exhibit hyperactivity and attention deficits.	nucleotide binding,peptide receptor activity,guanylate cyclase activity,protein kinase activity,ATP binding,GTP binding,toxic substance binding,lyase activity,phosphorus-oxygen lyase activity,natriuretic peptide receptor activity,peptide hormone binding	Ani
Mapk1	MAPK1	protein-coding	Mus musculus	ENSMUSG00000063358	9030612K14Rik|ERK|Erk2|MAPK2|PRKM2|Prkm1|p41mapk|p42mapk	26413	Autism Spectrum Disorder	16 A3|16 10.53 cM	Conditional Knockout	C57BL/6J	21849556	229	Expeimentalparadigm: Open field test//Elevated plus maze//Maternal behavior test//Pup exchange test//Resident-intruder test//Social recognition test//Sociability test in the open field chamber//Sociability and social novelty test in a three-room chamber//Olfactory//Novelty object recognition test//Nest building test//Fear conditioning test  /n  Model Generation: The Erk2 gene was isolated from a 129X1/SvJ mouse genomic library. To generate the Erk2(floxN) allele, we constructed a targeting vector from 16.8 kb of Erk2 DNA (from the Apa1 site in intron 1 to the Taq1 site in intron 6) (Fig. 1A). For positive selection, a floxed (flanked by loxP sites) Pgk-neo cassette was inserted in the opposite direction into the EcoRI site in intron 1. A third loxP site, KpnI, and SapI sites were inserted into the BglII site in intron 3 (Fig. 1A). Targeted insertion of the plasmid by homologous recombination was performed in 129 derived embryonic stem cells (E14), and derived germline targeted offspring (Erk2+/flox(Neo+) mice) were obtained. While the expression of ERK2 in Erk2flox(Neo+)/flox(Neo+) mice was reduced owing to the presence of the Pgk-neo cassette (Satoh et al., 2007), it resumed normal levels after excision of the neo cassette by in vivo crossing with transgenic mice expressing cre recombinase (EIIA-cre mice) to obtain mice carrying the Erk (flox(Neo-)) allele (Erk2+/flox(Neo-) mice) or the Erk2 (Δflox) allele (Erk2+/Δflox mice). The disruption of the Erk2 gene locus was confirmed by Southern blot analysis of genomic DNA from adult mice (Fig. 1B,C). In the genotyping PCR, the primers used for detection of the Erk2(flox) and Erk2 wild-type alleles were mE2-F3 (5′-GATCTGATGCTTGCCAAAGCC-3′) and mE2-R4 (5′-TGTAAAGTAGCAGCAGATGC-3′) (Fig. 1D). Erk2+/flox(Neo-) mice were backcrossed with C57BL/6J mice for >10 generations. We crossed these mice with nestin promoter-driven cre transgenic mice (Vernay et al., 2005), which were maintained on the same background (C57BL/6J).  /n  Rescue: -  /n  Model Summary: Here we show that ERK2 play a critical role in regulating social behaviors as well as cognitive and emotional behaviors in mice. To study the brain function of ERK2, we used a conditional, region-specific, genetic approach to target Erk2 using the Cre/loxP strategy with a nestin promoter-driven cre transgenic mouse line to induce recombination in the CNS. The resulting Erk2 conditional knock-out (CKO) mice, in which Erk2 was abrogated specifically in the CNS, were viable and fertile with a normal appearance. These mice, however, exhibited marked anomalies in multiple aspects of social behaviors related to facets of autism-spectrum disorders: elevated aggressive behaviors, deficits in maternal nurturing, poor nest-building, and lower levels of social familiarity and social interaction. Erk2 CKO mice also exhibited decreased anxiety-related behaviors and impaired long-term memory. Pharmacological inhibition of ERK1 phosphorylation in Erk2 CKO mice did not affect the impairments in social behaviors and learning disabilities, indicating that ERK2, but not ERK1 plays a critical role in these behaviors.	nucleotide binding,phosphotyrosine residue binding,double-stranded DNA binding,protein kinase activity,protein serine/threonine kinase activity,MAP kinase activity,MAP kinase kinase activity,protein binding,ATP binding,RNA polymerase II CTD heptapeptide repeat kinase activity,kinase activity,transferase activity,protein kinase binding,phosphatase binding,mitogen-activated protein kinase kinase kinase binding,identical protein binding	Ani
Dcdc2a	DCDC2	protein-coding	Mus musculus	ENSMUSG00000035910	AW492955|Dcdc2|RU2	195208	Developmental Dyslexia	13|13 A3.1	Knockout	129SJ;C57BL/6J<U+00A0>	21883923	230	Expeimentalparadigm: Hebb-Williams maze//Novel Object Recognition//Elevated plus maze  /n  Model Generation: Embryonic stem cells harboring a floxed allele of exon two of<U+00A0>Dcdc2<U+00A0>were produced by electroporating mouse embryonic stem (ES) cells (129S6/SvEvTac) with a homologous recombination targeting construct containing an engineered floxed-exon2 and drug selection cassette flanked by Flippase Recognition Target (FRT) recombination sites. ES clones were drug selected with positive and negative selection and screened by PCR for correctly targeted ES cell clones. A single positive clone was expanded and used for embryo re-aggregation to produce five chimeric mice. Three of these mice were shown to germline transmit the targeted allele to offspring in a cross with C57BL6/J mice. The PGK-neo drug selection cassette in the targeting construct was then removed by crossing these mice with 129S4/SvJaeSor-Gt(ROSA)26Sortm1(FLP1)Dym/J mice (Jackson Laboratory, Bar Harbor, ME, USA). These offspring were used to produce a colony of homozygous<U+00A0>Dcdc2flox2/flox2<U+00A0>mice. In order to generate<U+00A0>Dcdc2del2/del2<U+00A0>mice with a deletion of exon 2 we crossed<U+00A0>Dcdc2flox2/flox2<U+00A0>mice with Hrpt-Cre mice, C57Bl6-Hprttm1(cre)Mnn/J mice (UCHC, 129S1/Sv-Hprttm1(cre)Mnn/J backcrossed to C57BL6 for 10 generations).  /n  Rescue: -  /n  Model Summary: These behavioral deficits occur in the absence of neuronal migration disruption in the mutant mice, and may be comorbid with an anxiety phenotype.	molecular_function,kinesin binding	Ani
Crhr1	CRHR1	protein-coding	Mus musculus	ENSMUSG00000018634	CRF1R|CRFR1|Crhr	12921	Alcohol Use Disorder	11 E1|11 67.77 cM	Knockout	129X1/SvJ;C57BL/6<U+00A0>	21895713	231	Expeimentalparadigm: Drinking in the dark  /n  Model Generation: We electroporated RW-4 ES cells (Genome Systems) derived from a 129/SvJ embryo with linearized targeting vector (20 μg). We screened the G418/ganciclovir-resistant clones using Southern-blot analysis of<U+00A0>EcoRI-digested DNA to identify ES-cell homologous recombinants. A 5′ probe located upstream of the targeting vector that flanks the 5′-homology region was used to detect 13.5-kb and 12.1-kb<U+00A0>EcoRI fragments in wild-type and mutant alleles, respectively. A 3′ probe detected the expected<U+00A0>SphI fragments of 10.5 and 7.1 kb in the wild-type and mutated alleles, respectively. The targeting frequency was<U+00A0>～20%. We injected heterozygous ES-cell clones into C57BL/6J blastocysts, which produced three chimaeric founder animals from one clone. Chimaeras were bred to C57BL/6J mice to generate offspring harbouring the mutant allele. We performed Southern-blot analyses using tail DNA digested with<U+00A0>EcoR1 or<U+00A0>SphI to determine germline transmission of the mutant allele.  /n  Rescue: -  /n  Model Summary: Our results confirm that CRFR1 plays a key role in binge drinking and identify CRF as the ligand critically involved in excessive alcohol consumption.	G-protein alpha-subunit binding,transmembrane signaling receptor activity,G protein-coupled receptor activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,peptide binding,corticotropin-releasing hormone receptor activity,protein-containing complex binding,corticotropin-releasing hormone binding	Ani
Pdyn	PDYN	protein-coding	Mus musculus	ENSMUSG00000027400	Dyn	18610	Alcohol Use Disorder	2 F1|2 63.19 cM	Knockout	C57BL/6	21966993	232	Expeimentalparadigm: Ethanol-conditioned place preference//Two-bottle choice paradigm  /n  Model Generation: The generation of mice lacking the pre-PDYN gene has been described elsewhere (Sharifi et al. 2001).  /n  Rescue: -  /n  Model Summary: The purpose of this study was to examine the role of the prodynorphin gene in alcohol sensitivity, preference and vulnerability to alcohol consumption. Handling-induced convulsion (HIC) associated to alcohol, alcohol-induced loss of righting reflex (LORR), hypothermic effects in response to acute ethanol challenge, blood ethanol levels (BELs), conditioned place preference, voluntary ethanol consumption and preference, tyrosine hydroxylase (TH), dopamine transporter (DAT) and proenkephalin (PENK) gene expression, and μ-, δ- and κ-opioid agonist-stimulated [S(35) ]- guanosine 5'-triphosphate-binding autoradiography were studied in prodynorphin knockout (PDYN KO) and wild-type (WT) mice. There were no differences in HIC, LORR or the decrease in body temperature in response to acute ethanol challenge between PDYN KO and WT mice. PDYN KO mice presented higher BEL, higher ethanol-conditioned place preference and more ethanol consumption and preference in a two-bottle choice paradigm than WT mice.	opioid peptide activity,neuropeptide hormone activity,opioid receptor binding	Ani
Ube3a	UBE3A	protein-coding	Mus musculus	ENSMUSG00000025326	4732496B02|5830462N02Rik|A130086L21Rik|Hpve6a	22215	Autism Spectrum Disorder	7 B5|7 33.95 cM	Gene Editing(BAC recombineering)	FVB	21974935	233	Expeimentalparadigm: Three-chamber social test//Grooming//Vocalizations  /n  Model Generation: Using BAC recombineering techniques, we inserted a 162-kb segment of mouse chromosome 7, containing the entire 78-kb exon-intron coding sequence of Ube3a as well as its 63-kb 5′ and 21-kb 3′ sequences, into FVB embryos to generate transgenic mice (fig. S1). A 3×FLAG tag followed by two stop codons was inserted in-frame after exon 12 to generate two independent founder mice. Transgenic founder offspring were then crossed to produce Ube3a 1× or 2× transgenic mice.  /n  Rescue: -  /n  Model Summary: A common CNV that occurs in 1 to 3% of those with autism--maternal 15q11-13 duplication (dup15) and triplication (isodicentric extranumerary chromosome, idic15)--affects several genes that have been suggested to underlie autism behavioral traits. To test this, we tripled the dosage of one of these genes, the ubiquitin protein ligase Ube3a, which is expressed solely from the maternal allele in mature neurons, and reconstituted the three core autism traits in mice: defective social interaction, impaired communication, and increased repetitive stereotypic behavior. The penetrance of these autism traits depended on Ube3a gene copy number.	transcription coactivator activity,ubiquitin-protein transferase activity,protein binding,transferase activity,metal ion binding,ubiquitin protein ligase activity	Ani
Bax	BAX	protein-coding	Mus musculus	ENSMUSG00000003873	-	12028	Aggressive Behaviors	7 B3|7 29.32 cM	Knockout	C57Bl/6J	22034980	234	Expeimentalparadigm: Olfactory preference//Social recognition//Social approach//Resident-intruder test  /n  Model Generation: Consequently, we generated a Bax-deficient mouse model to address these issues and identify the most critical developmental roles of Bax. A Bax targeting vector substituted PGK-Neo for exons 2 through 5, deleting BH1 and BH2 and the capacity for a functional protein (Fig. 1A). Two of 89 G418-resistant clones had undergone homologous recombination in RW-4 embryonic stem (ES) cells ( 12 ). The disrupted B a x allele was ultimately transmitted through the germ line, as confirmed by Southern (DNA) analysis ( 13 ). Heterozygous mice appeared normal, and matings resulted in the expected Mendelian frequency of Bax ~/_ mice that grew to adulthood and were externally indistinguishable from wild-type (WT) mice. Immunohlots confirmed the loss of BAX in tissues from Bax _ / ~ mice (Fig. IB). The amounts of the death-repressing molecules BCL2 and BCLxL were comparable in the Bax ~/_ and WT mice.  /n  Rescue: -  /n  Model Summary: Here we examined the effects of Bax gene deletion on social behaviors (olfactory preference, social recognition, social approach and aggression) and the neural processing of olfactory cues. Bax deletion eliminated the normal sex difference in olfactory preference behavior. In the social recognition test, both genotypes discriminated a novel conspecific, but wild-type males and Bax(-/-) animals of both sexes spent much more time than wild-type females investigating stimulus animals. Similarly, Bax(-/-) mice were more sociable than wild-type mice in a social approach test. Bax deletion had no effect on aggression in a resident/intruder paradigm where males, regardless of genotype, exhibited a shorter latency to attack. Thus, the prevention of neuronal cell death by Bax gene deletion results in greater sociability as well as the elimination of sex differences in some social behaviors. To examine olfactory processing of socially relevant cues, we counted c-Fos-immunoreactive (Fos-ir) cells in several nodes of the accessory olfactory pathway after exposure to male-soiled or control bedding. In both genotypes, exposure to male-soiled bedding increased Fos-ir cells in the posterodorsal medial amygdala, principal nucleus of the bed nucleus of the stria terminalis and medial preoptic nucleus (MPN), and the response in the MPN was greater in females than in males. However, a reduction in Fos-ir cells was seen in the anteroventral periventricular nucleus of Bax(-/-) mice.	protein binding,lipid binding,channel activity,Hsp70 protein binding,heat shock protein binding,identical protein binding,protein homodimerization activity,protein-containing complex binding,protein heterodimerization activity,chaperone binding,BH domain binding,BH3 domain binding	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Autism Spectrum Disorder	X A7.1|X 34.83 cM	Knockout	FVB	22067669	235	Expeimentalparadigm: Open field test//Contextual test//Cued test//Auditory startle test//Prepulse inhibition  /n  Model Generation: Male Fmr1 WT (stock No. 4828) and Fmr1 KO (stock No. 4624) mice were on the congenic FVB mouse background and obtained from The Jackson Laboratory (Bar Harbor, Me., USA).  /n  Rescue: Our recent work revealed that THIP (gaboxadol), a GABA(A) receptor agonist, can restore principal neuron excitability deficits in the Fmr1 KO amygdala, suggesting that THIP may also restore some of the key behavioral abnormalities in Fmr1 KO mice. Here, we reveal that THIP significantly attenuated hyperactivity in Fmr1 KO mice, and reduced prepulse inhibition in a volume-dependent manner.  /n  Model Summary: In conclusion, we have demonstrated that Fmr1 KO mice have behavioral deficits in numerous behavioral paradigms, and that administration of the tonic GABAA receptor agonist THIP can ameliorate some of these core defects.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Crhr1	CRHR1	protein-coding	Mus musculus	ENSMUSG00000018634	CRF1R|CRFR1|Crhr	12921	Alcohol Use Disorder	11 E1|11 67.77 cM	Conditional Knockout	129S2/Sv;C57BL/6J	22113086	236	Expeimentalparadigm: Two-bottle choice paradigm//Stress-induced alcohol drinking  /n  Model Generation: For conditional inactivation of Crhr1 in the central nervous system, transgenic mice expressing the Cre recombinase under the control of the rat Nestin (Nes) promoter and enhancer (Tronche<U+00A0>et al, 1999) were bred to homozygous Crhr1loxP/loxP<U+00A0>mice. The resulting heterozygous F1<U+00A0>offspring (Crhr1+/loxP) were either positive or negative for Nes–Cre. From matings of Crhr1+/loxP<U+00A0>with Crhr1+/loxP<U+00A0>Nes–Cre mice we obtained F2<U+00A0>animals of the desired genotypes (Crhr1loxP/loxP<U+00A0>Nes–Cre (Crhr1NestinCre) and Crhr1loxP/loxP), which were then inter-crossed to obtain sufficient numbers of F3<U+00A0>animals. Crhr1loxP/loxP<U+00A0>mice were used as control littermates for conditional CRH1R mice  /n  Rescue: -  /n  Model Summary: Brain-Specific Inactivation of the Crhr1 Gene Inhibits Post-Dependent and Stress-Induced Alcohol Intake, but Does Not Affect Relapse-Like Drinking	G-protein alpha-subunit binding,transmembrane signaling receptor activity,G protein-coupled receptor activity,protein binding,G protein-coupled peptide receptor activity,corticotrophin-releasing factor receptor activity,peptide hormone binding,peptide binding,corticotropin-releasing hormone receptor activity,protein-containing complex binding,corticotropin-releasing hormone binding	Ani
Mecp2	MECP2	protein-coding	Mus musculus	ENSMUSG00000031393	1500041B07Rik|D630021H01Rik|Mbd5|WBP10	17257	Autism Spectrum Disorder	X A7.3|X 37.63 cM	Knockin	C57BL/6J	22119903	237	Expeimentalparadigm: Phenotypic scoring//Locomotor assay//Accelerating rotarod//Elevated zero//Fear conditioning test//Open field test  /n  Model Generation: The targeting construct used for homologous recombination in ES cells was cloned in two arms by PCR amplification of sv129 genomic DNA. The 5′ arm was PCR amplified with primers 5′-AGGAGGTAGGTGGCATCCTT-3′ and 5′-CGTTTGATCACCATGACCTG-3′while the 3′ arm was PCR amplified with 5′-GAAATGGCTTCCCAAAAAGG-3′ and 5′-AAAACGGCACCCAAAGTG-3′ primers. Novel restriction sites at the ends of each arm were created using nested primers for cloning into a vector containing a floxed Neomycin cassette (Neo) and a diphtheria toxin-A negative-selection cassette. MeCP2 Threonine 158 was mutated to Alanine using QuickChange (Stratagene) site-directed mutagenesis. A single nucleotide at codon T160 also underwent site-directed mutagenesis for a silent mutation to introduce a novel BstEII restriction site in order to identify correctly targeted ES cells. The targeting construct was confirmed by sequencing, linearized using NotI and subsequently electroporated into sv129 mouse ES cells. Two MeCP2 T158A ES cell clones and two loxP ES cell clones were independently injected into C57BL/6 blastocysts and subsequently implanted into pseudopregnant females. The resulting chimeric offspring were mated with C57BL/6 EIIa-Cre mice for embryonic deletion of the Neo cassette, and the agouti offspring were screened by PCR genotyping to confirm germ line transmission of the T158A allele or loxP allele.  /n  Rescue: -  /n  Model Summary: One of the most common MeCP2 mutations associated with RTT occurs at threonine 158, converting it to methionine (T158M) or alanine (T158A). To understand the role of T158 mutations in the pathogenesis of RTT, we generated knockin mice that recapitulate the MeCP2 T158A mutation. We found a causal role for T158A mutation in the development of RTT-like phenotypes, including developmental regression, motor dysfunction, and learning and memory deficits.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,transcription factor binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Map6	MAP6	protein-coding	Mus musculus	ENSMUSG00000055407	2810411E12Rik|Map-6|Mtap6|STOP	17760	Cognitive Disorders	7|7 E1	Knockout	C57BL6;129 SvPas	22146001	238	Expeimentalparadigm: Locomotion test//Coat state//Splash test//Anhedonia test//Tail suspension test//Forced swim test//Elevated plus maze//Open field test// Light-dark box test//Marble burying test//Spontaneous alternation//Novel object recognition test//Morris water maze  /n  Model Generation: Stable tubule only polypeptide deficient mice were obtained by putting the lacZ gene in the place of the exon 1 of STOP gene (MAP6,<U+00A0>Denarier<U+00A0>et<U+00A0>al.<U+00A0>1998), present in all characterized STOP isoforms (A-, E-, F-, N- and O-STOP,<U+00A0>Aguezzoul<U+00A0>et<U+00A0>al.<U+00A0>2003;<U+00A0>Galiano<U+00A0>et<U+00A0>al.<U+00A0>2004). Thus, the exon 1 deletion results in the absence of any detectable STOP isoforms in STOP Knockout mice  /n  Rescue: -  /n  Model Summary: The deletion of STOP/MAP6 protein in mice triggers highly altered mood and impaired cognitive performances	calmodulin binding,microtubule binding	Ani
Grin2b	GRIN2B	protein-coding	Mus musculus	ENSMUSG00000030209	GluN2B|GluRepsilon2|NR2B|Nmdar2b	14812	Obsessive Compulsive Disorder	6 G1|6 66.38 cM	Conditional Knockout	2BΔCtx	22153375	239	Expeimentalparadigm: Suckling response//Exploration preference//Return to social huddle//Locomotor activity  /n  Model Generation: Cortical GluN2B KO was accomplished by crossing animals containing a loxP flanked exon 5 (Brigman et al., 2010) with mice expressing Cre-recombinase under the cortex specific Nex locus (Goebbels et al., 2006). GluN2B flox/+; Nex-Cre/+ mice were crossed with GluN2B flox/+ or GluN2B flox/flox mice to obtain GluN2B flox/flox; Nex-Cre/+ mice, which are referred to as 2BΔCtx mice. Mice that were GluN2B flox/+ and GluN2B flox/flox but WT at the Nex locus served as controls.  /n  Rescue: -  /n  Model Summary: We generated a mouse in which we genetically replaced GluN2B with GluN2A (2B→2A). Although this manipulation restored NMDAR-mediated currents at glutamatergic synapses, it did not rescue GluN2B loss of function. Protein translation-dependent homeostatic synaptic plasticity is occluded in the absence of GluN2B, and AMPA receptor contribution is enriched at excitatory cortical synapses. Our experiments indicate that specificity of GluN2B-mediated signaling is due to its unique interaction with the protein effector alpha calcium-calmodulin kinase II and the regulation of the mTOR pathway. Homozygous 2B→2A mice exhibited high rates of lethality, suppressed feeding, and depressed social exploratory behavior.	ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,interleukin-1 receptor binding,ion channel activity,extracellularly glutamate-gated ion channel activity,cation channel activity,calcium channel activity,protein binding,beta-catenin binding,zinc ion binding,ligand-gated ion channel activity,glycine binding,glutamate binding,glutamate-gated calcium ion channel activity,D2 dopamine receptor binding,ionotropic glutamate receptor binding,small molecule binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,metal ion binding,cell adhesion molecule binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
RGD1307443	KIAA0319	protein-coding	Rattus norvegicus	ENSRNOG00000018141	-	361244	Developmental Dyslexia	17p11	Knockdown(RNAi)	Wistar;Sprague-Dawley	22326444	240	Expeimentalparadigm: Startle response paradigm//Water escape//Morris water maze//Radial arm water maze  /n  Model Generation: All surgeries were performed on embryonic day 15 (E15). In all<U+00A0>Kiaa0319<U+00A0>RNAi treatments, plasmids encoding short hairpin RNA pU6shRNA-Kiaa0319<U+00A0>(Kiaa0319<U+00A0>shRNA) were transfected into the fetal ventricular zone by<U+00A0>in utero<U+00A0>electroporation, following externalization of the uterine horns.  /n  Rescue: -  /n  Model Summary: Taken together, these results suggest that<U+00A0>Kiaa0319<U+00A0>plays a role in neuronal migration during embryonic development, and that early interference with this gene results in an array of behavioral deficits including impairments in rapid auditory processing and simple spatial learning.	NA	Ani
Ext1	EXT1	protein-coding	Mus musculus	ENSMUSG00000061731	-	14042	Autism Spectrum Disorder	15 C|15 20.0 cM	Conditional Knockout	C57BL/6	22411800	241	Expeimentalparadigm: Reflexes//Olfaction test//Visual placing test//Hot plate test//Cage-top hang test//Rotarod//Open field test//Separation–reunion test//Resident–intruder test.//Social dominant tube test//Ultrasonic vocalization//Hole board test//Novel object recognition test//Social memory test//Elevated plus maze//Light-dark box test  /n  Model Generation: Mice carrying the loxP-modified<U+00A0>Ext1<U+00A0>allele (Ext1flox) were created and maintained on a C57BL/6 background as described previously (8). CaMKII-Cre transgenic mice (line 2834) (27) were obtained from Bernhard Lüscher (Pennsylvania State University, University Park, PA) and backcrossed to C57BL/6 mice for more than eight generations before use in this study. Conditional<U+00A0>Ext1-knockout mice specific for postnatal neurons (CaMKII-Cre;Ext1flox/flox), designated Ext1CKO<U+00A0>mice in this paper, were generated by crossing these two lines according to a standard breeding scheme  /n  Rescue: -  /n  Model Summary: Remarkably, these mutant mice recapitulate almost the full range of autistic symptoms, including impairments in social interaction, expression of stereotyped, repetitive behavior, and impairments in ultrasonic vocalization, as well as some associated features.<U+00A0>	acetylglucosaminyltransferase activity,glucuronosyltransferase activity,transferase activity,glycosyltransferase activity,protein homodimerization activity,metal ion binding,protein heterodimerization activity,glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity,N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Schizophrenia	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	22414818	242	Expeimentalparadigm: Taste-reactivity testing//Preference assessment//Operant procedures//Matching in concurrent schedules  /n  Model Generation: The human D2 receptor open reading frame was cloned into the pMM400 plasmid (Mayford et al., 1996) modified to carry the human growth hormone poly adenylation sequence instead of the described SV40 poly A. The NotI fragment was isolated and used to generate transgenic mice by injection into pronuclei of one-cell C57Bl/6-CBA(J) F2 oocytes, which were transferred the next day via the oviduct into pseudopregnant foster females. Transgenic founder animals were identified by Southern blots using a probe specific for the tetO promoter sequence. Progeny of founder animals were crossed with mice expressing the tTA transgene under the control of the CamKIIα promoter (Mayford et al., 1996; line B). Offspring were genotyped by independent Southern blots for tTA and tetO. For regulating tetO-driven gene expression, mice were fed doxycycline-supplemented chow (40 mg/kg, Mutual Pharmaceutical).  /n  Rescue: -  /n  Model Summary: We previously showed that mice that selectively and reversibly overexpress striatal D2 receptors (D2R-OE) model the negative symptoms of schizophrenia. Specifically, D2R-OE mice display a deficit in incentive motivation. The present studies investigated the basis for this deficit. First, we assessed whether hedonic reaction to reward is intact in D2R-OE mice. We assessed licking behavior and video-scored positive hedonic facial reactions to increasing concentrations of sucrose in control and D2R-OE mice. We found no difference between D2R-OE mice and controls in hedonic reactions. To further understand the basis of the motivational deficit, mice were given a choice between pressing a lever for access to a preferred reward (evaporated milk) or consuming a freely available less preferred reward (home-cage chow). D2R-OE mice pressed less for the preferred milk and consumed more of the freely available less preferred chow, indicating that striatal overexpression of postsynaptic D2Rs can alter cost/benefit computations, leading to a motivational deficit.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
adgrl3.1	LPHN3	protein-coding	Zebrafish	ENSDARG00000061121	lphn3|lphn3.1|si:ch211-209p5.2|wu:fj36g07	560631	Attention-Deficit/Hyperactivity Disorder	-	Knockdown	NA	22508465	243	Expeimentalparadigm: Analysis of locomotor behavior  /n  Model Generation: We therefore chose to disrupt the function of lphn3.1, the LPHN3 homolog with strongest embryonic expression. lphn3.1 consists of 19 exons (Supplementary Figure S4B) and codes for a protein with a similar predicted structure as human LPHN3 (Supplementary Figure S4A). We used two splice-blocking MO to knockdown lphn3.1 activity during development. Lphn3-MO1 targeted the exon2/intron2 boundary, and Lphn3-MO2 the exon6/intron6 boundary, regions where lphn3.1 and lphn3.2 sequences differed significantly (Supplementary Figure S4B, H). Injection of either of these MOs resulted in the absence of wild-type lphn3.1 transcripts in 2<U+2009>d.p.f. embryos (Supplementary Figure S4D, E, G). At later stages, (6<U+2009>d.p.f.) the expression of lphn3.1 recovered (Supplementary Figure S4F, G), indicating that morpholino injection causes a transient downregulation of Lphn3.1 activity during development.  /n  Rescue: This behavioral phenotype can be rescued by MPH and ATO, drugs that are effective in treating ADHD.  /n  Model Summary: Linkage analysis followed by fine-mapping identified variation in the gene coding for Latrophilin 3 (LPHN3), a putative adhesion-G protein-coupled receptor, as a risk factor for ADHD. In order to validate the link between LPHN3 and ADHD, and to understand the function of LPHN3 in the etiology of the disease, we examined its ortholog lphn3.1 during zebrafish development. Loss of lphn3.1 function causes a reduction and misplacement of dopamine-positive neurons in the ventral diencephalon and a hyperactive/impulsive motor phenotype.	transmembrane signaling receptor activity,G protein-coupled receptor activity,carbohydrate binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6	22573675	244	Expeimentalparadigm: Ultrasonic vocalizations//Reciprocal social interactions//Elevated plus-maze//Three-chambered social approach task//Neurological reflexes test//Grip strength//Wire hang//Open-field exploratory activity//Automated three-chambered social approach task//Male–female social interaction test//Female urinary pheromone-elicited scent marking and ultrasonic vocalizations//Juvenile reciprocal social interaction//Olfactory habituation//dishabituation test//Acoustic startle threshold and prepulse inhibition of acoustic startle//Hot-plate and tail flick pain sensitivity tests//Repetitive self-grooming//Elevated plus-maze//ight-dark exploration tests//Morris water maze//Contextual and cued fear conditioning//Novel object recognition//Rotarod motor learning  /n  Model Generation: Mice with mutations in the gene coding for the Shank3 protein were generated at the Mount Sinai School of Medicine as previously described (Bozdagi et al., 2010). The mouse used in the present study was the same as the one described in the study by Bozdagi et al. (2010). Briefly, Bruce4 C57BL/6 embryonic stem cells were used to generate a mouse line with a deletion of the ankryin repeat region of the Shank3 gene. Two loxP sites were inserted before exon 4 and after exon 9, to encompass the region that encodes the ankyrin repeats, with the selection cassette, flanked by FRT sites, excised by FLP recombinase. For mice used in the present behavioral studies, the floxed allele was excised by a ubiquitously expressed Cre and a line maintained with a deletion of exons 4 through 9. This strategy resulted in constitutive deletion of the Shank3α isoform. Shank3 wild-type (+/+) and heterozygote (+/-) breeding pairs were imported from Mount Sinai to NIMH, where three cohorts of offspring were generated and behaviorally tested in Bethesda, Maryland.  /n  Rescue: -  /n  Model Summary: Here, we report the physiological and behavioral consequences of null and heterozygous mutations in the ankyrin repeat domain in Shank3 mice. Both homozygous and heterozygous mice showed reduced glutamatergic transmission and long-term potentiation in the hippocampus with more severe deficits detected in the homozygous mice. Three independent cohorts were evaluated for magnitude and replicability of behavioral endophenotypes relevant to autism and Phelan-McDermid syndrome. Mild social impairments were detected, primarily in juveniles during reciprocal interactions, while all genotypes displayed normal adult sociability on the three-chambered task. Impaired novel object recognition and rotarod performance were consistent across cohorts of null mutants. Repetitive self-grooming, reduced ultrasonic vocalizations, and deficits in reversal of water maze learning were detected only in some cohorts, emphasizing the importance of replication analyses.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Adgrl3	ADGRL3	protein-coding	Mus musculus	ENSMUSG00000037605	5430402I23Rik|CIRL-3|D130075K09Rik|Gm1379|LEC3|Lphn3|mKIAA0768	319387	Attention-Deficit/Hyperactivity Disorder	5|5 D- E1	Mutated	129S4/SvJae;C57BL/6	22575564	245	Expeimentalparadigm: Open field test  /n  Model Generation: We utilized gene trap clone FHCRC-GT-S17-5H1 generated with the ROSAFARY vector (Chen et al., 2004) to generate mutant mice; 129S4/SvJae and C57 mix  /n  Rescue: -  /n  Model Summary: Initial characterization of mice null for Lphn3, a gene implicated in ADHD and addiction	transmembrane signaling receptor activity,G protein-coupled receptor activity,calcium ion binding,protein binding,carbohydrate binding,metal ion binding	Ani
Dgkb	DGKB	protein-coding	Mus musculus	ENSMUSG00000036095	6430574F24|90kda|C630029D13Rik|DAGK2|DGK|DGK-beta|mKIAA0718	217480	Attention-Deficit/Hyperactivity Disorder	12|12 A3	Knockout	C57BL/6J	22590645	246	Expeimentalparadigm: Open field test//object recognition test  /n  Model Generation: Pregnant mice (day 14) (C57BL/6JJmsSlc) for the primary culture were obtained from Japan SLC Inc. (Hamamatsu, Japan). DGKβ KO mice were produced using the Sleeping Beauty transposon system.  /n  Rescue: -  /n  Model Summary: These findings suggest that DGKβ KO mice showed attention-deficit and hyperactive phenotype, similar to ADHD. Furthermore, the hyporesponsiveness of DGKβ KO mice to MPH was due to dysregulation of ERK phosphorylation, and that DGKβ has a pivotal involvement in ERK regulation in the striatum.	nucleotide binding,NAD+ kinase activity,diacylglycerol kinase activity,calcium ion binding,ATP binding,lipid binding,kinase activity,transferase activity,metal ion binding	Ani
Crtc1	CRTC1	protein-coding	Mus musculus	ENSMUSG00000003575	Mect1|TORC-1|TORC1|mKIAA0616	382056	Aggressive Behaviors	8|8 B3.3	Knockout	C57BL/6N	22592058	247	Expeimentalparadigm: Locomotion test  /n  Model Generation: Crtc1–/– Males and Lactating Females Exhibit Enhanced Aggressive Behavior As previously described (24), Crtc1–/– mice are viable, fertile, and show neither obvious developmental defects nor gross neurological alterations. Like Altarejos et al.7, we obtained the mouse embryonic stem cell line XK522 containing an insertional gene trap in the Crtc1 gene from BayGenomics. We verified by PCR the presence of the gene trap vector pGT0lxf and determined that it was inserted within the fourth intron of the Crtc1 gene (Fig. 1a). We then injected embryonic cells into C57BL/6N blastocysts to generate chimeric mice. We backcrossed heterozygous mice with C57BL/6N mice for six generations and then intercrossed them to obtain homozygous Crtc1-/- mice and wild-type littermates. We genotyped Crtc1-mutant mice by PCR amplification of wild-type and mutant alleles (Fig. 1b). Crtc1 messenger RNA and protein were undetectable in the brains of Crtc1-/- mice, thus confirming the efficiency of the trapping vector (Fig. 1c,d).  /n  Rescue: -  /n  Model Summary: We found that mice lacking CRTC1 associate neurobehavioral endophenotypes related to mood disorders. Crtc1(-/-) mice exhibit impulsive aggressiveness, social withdrawal, and decreased sexual motivation, together with increased behavioral despair, anhedonia, and anxiety-related behavior in the novelty-induced hypophagia test. They also present psychomotor retardation as well as increased emotional response to stressful events. Crtc1(-/-) mice have a blunted response to the antidepressant fluoxetine in behavioral despair paradigms, whereas fluoxetine normalizes their aggressiveness and their behavioral response in the novelty-induced hypophagia test. Crtc1(-/-) mice strikingly show, in addition to a reduced dopamine and serotonin turnover in the prefrontal cortex, a concomitant decreased expression of several susceptibility genes involved in neuroplasticity, including Bdnf, its receptor TrkB, the nuclear receptors Nr4a1-3, and several other CREB-regulated genes.	protein binding,cAMP response element binding protein binding	Ani
Oxt	OXT	protein-coding	Mus musculus	ENSMUSG00000027301	OT|Oxy	18429	Aggressive Behaviors	2 F1|2 63.24 cM	Knockout	C57BL/6J	22609339	248	Expeimentalparadigm: Resident–intruder test  /n  Model Generation: Oxtr wild type (Oxtr +/+), Oxtr-/-, and Oxtr FB/FB mice were generated as described previously with Oxtr-/- mice and their controls being approximately 88% C57BL/6J and Oxtr FB/FB mice and their controls being approximately 81% C57BL/6J (Lee et al., 2008a, Macbeth et al., 2010). Oxtr-/- and their controls were generated by mating heterozygotes. Mating an Oxtr flox/flox male with an Oxtr +/flox female generated Oxtr FB/FB mice and their controls.  /n  Rescue: -  /n  Model Summary: To explore this, we examined aggression in two lines of Oxtr mice, a total knockout (Oxtr-/-), in which the Oxtr gene is absent from the time of conception, and a predominantly forebrain specific knockout (Oxtr FB/FB), in which the Oxtr gene is not excised until approximately 21-28days postnatally. Aggression was measured in males from both lines, as well as control littermates, using a resident-intruder behavioral test. Consistent with previous reports, male Oxtr-/- mice had elevated levels of aggression relative to controls. Oxtr FB/FB mice on the other hand displayed levels of aggression similar to control animals. In addition, following a resident-intruder test, Oxtr+/+ mice that displayed aggression had less c-fos immunoreactivity in the ventral portion of the lateral septum than those that did not. Further, Oxtr-/- mice had increased c-fos immunoreactivity in the medial amygdala relative to controls.	hormone activity,neuropeptide hormone activity,neurohypophyseal hormone activity,oxytocin receptor binding	Ani
Shank2	SHANK2	protein-coding	Mus musculus	ENSMUSG00000037541	ProSAP1|mKIAA1022	210274	Autism Spectrum Disorder	7|7 F5	Knockout	C57BL/6	22699619	249	Expeimentalparadigm: Righting reflex//Preference for home cage odour//Light–dark anxiety test//Open field//Y-maze//Three-chamber test//Self-directed and digging behaviours//Resident–intruder test//Male–female interactions//Buried-food finding test//Object recognition//Rotarod test//Analyses of audio recordings  /n  Model Generation: Two mouse C57BL/6 genomic XbaI DNA fragments coding for exon VI and VII of the ProSAP1/Shank2 PDZ domain were subcloned from a bacterial artificial chromosome (pBelo-BAC II 21259) yielding a 16.3-kilobase (kb) chromosomal DNA fragment. For target vector construction, the long arm, coding for exon VI, was cloned as an EcoRI–XbaI fragment (7.7 kb) into pBluescript II SK vector (Thermo Scientific) followed by an XbaI–XhoI fragment (1.1 kb) coding for exon VII in which a loxP sequence was integrated into the unique SphI site. The frt PGK neo frt loxP cassette was cloned into the XhoI site followed by the short arm (2.8 kb) as an XhoI–SphI fragment. The linearized targeting construct was electroporated into recombinant inbred embryonic stem cells (RI-ES cells) (passage 15 (129/SV×129/SV-CP)) at 25μF and 400V (Gene Pulser; Bio-Rad). After electroporation, cells were plated onto culture dishes (100mm diameter) containing a gamma-irradiated monolayer of G418-resistant PMEF cells. Thirty-two hours later, 350μg of G418 (Invitrogen) per millilitre and 0.2μM 2′-deoxy-2′-fluoro-β-D-arabinofuranosyl-5-iodouracil (Moravek Biochemicals and Radiochemicals) were added to the culture medium. The medium was replaced every day, and colonies were picked and analysed 8 days after plating. Cells were expanded in HEPES-buffered Dulbecco’s modified Eagle’s medium supplemented with 15% fetal bovine serum (Thermo Scientific), 1,000U of recombinant leukaemia inhibitory factor (Millipore) per millilitre, non-essential amino acids, L-glutamine, β-mercaptoethanol and antibiotics (penicillin 100Uml-1, and streptomycin 100μgml-1). For electroporation, 2×107 cells were re-suspended in 20mM HEPES (pH 7.4), 173mM NaCl, 5mM KCl, 0.7mM Na2HPO4, 6mM dextrose and 0.1mM β-mercaptoethanol. Homologous recombination was tested by Southern blot analysis. Embryonic stem cells were transiently transfected with a FRT-recombinase plasmid to delete the selection cassette, leaving a single frt site. Correctly targeted embryonic stem cells were microinjected into 3.5-day-old B6D2F1 blastocysts and transferred to the uteri of 2.5 day pseudopregnant CD1 females. Pregnant mice carried pups to term and born chimaeras were identified by agouti coat colour contribution. For the germ-line transmission, male chimaeras were crossed to C57BL/6 female mice. Heterozygous offsprings (ProSAP1/Shank2+/frt) were confirmed by Southern blot analysis and further tested by PCR for the presence of the targeted allele. Cre-mediated excision was performed in vivo by cross-breeding mice harbouring a CMV promoter driven Cre transgene resulting in heterozygous ProSAP1/Shank2-deficient mice (ProSAP1/Shank+/-). ProSAP2/Shank3 mutants were generated by Genoway (Lyon, France) and raised on a C57BL/6 background.  /n  Rescue: -  /n  Model Summary: Here we demonstrate that genetic deletion of ProSAP1/Shank2 results in an early, brain-region-specific upregulation of ionotropic glutamate receptors at the synapse and increased levels of ProSAP2/Shank3. Moreover, ProSAP1/Shank2(-/-) mutants exhibit fewer dendritic spines and show reduced basal synaptic transmission, a reduced frequency of miniature excitatory postsynaptic currents and enhanced N-methyl-d-aspartate receptor-mediated excitatory currents at the physiological level. Mutants are extremely hyperactive and display profound autistic-like behavioural alterations including repetitive grooming as well as abnormalities in vocal and social behaviours.	protein C-terminus binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,structural constituent of postsynaptic density	Ani
Tsc1	TSC1	protein-coding	Mus musculus	ENSMUSG00000026812	-	64930	Autism Spectrum Disorder	2|2 A3	Knockout(Mutated)	C57Bl/6J;129 SvJae;BALB/cJ	22763451	250	Expeimentalparadigm: Social interaction//Gait analysis//Open field test//Olfaction//Grooming//T maze//Ultrasonic vocalizations//Rotarod  /n  Model Generation: L7cre;<U+00A0>Tsc1flox/flox<U+00A0>(mutant)animals were generated by crossing<U+00A0>L7/Pcp2-Cre<U+00A0>(L7Cre) transgenic mice11<U+00A0>with floxed<U+00A0>Tsc1<U+00A0>mice (Tsc1flox/flox)10<U+00A0>to yield<U+00A0>L7Cre;Tsc1<U+00A0>flox/+<U+00A0>progeny. These progeny were then crossed with one another or with<U+00A0>Tsc1flox/flox<U+00A0>animals to yield litters consisting of control (Tsc1+/+<U+00A0>(WT),<U+00A0>Tsc1flox/+,<U+00A0>L7Cre;Tsc+/+<U+00A0>(L7Cre), or<U+00A0>Tsc1flox/flox(Flox)) mice, heterozygous (L7Cre;Tsc1flox/+<U+00A0>(het)) mice, or mutant (L7Cre;Tsc1flox/flox<U+00A0>(mutant)) mice. Only male animals were used for behavioral experiments except for ultrasonic vocalizations where both male and female pups were utilized in the analysis. Mice were of mixed genetic backgrounds (C57Bl/6J, 129 SvJae, BALB/cJ).  /n  Rescue: Treatment of mutant mice with the mTOR inhibitor, rapamycin, prevented the pathological and behavioural deficits.<U+00A0>  /n  Model Summary: Here we show that both heterozygous and homozygous loss of Tsc1 in mouse cerebellar PCs results in autistic-like behaviours, including abnormal social interaction, repetitive behaviour and vocalizations, in addition to decreased PC excitability.<U+00A0>	protein binding,Hsp70 protein binding,GTPase activating protein binding,ATPase inhibitor activity,protein-containing complex binding,protein N-terminus binding,chaperone binding,Hsp90 protein binding	Ani
Taar1	TAAR1	protein-coding	Mus musculus	ENSMUSG00000056379	Tar1|Trar1|taR-1	111174	Attention-Deficit/Hyperactivity Disorder	10|10 A4	Overexpression	C57BL/6J	22763617	251	Expeimentalparadigm: Rotarod test//Locomotion test  /n  Model Generation: To explore the physiological roles of TAAR1, a mouse line with elevated Taar1 brain-expression was engineered. For this, a Thy-1.2 expression cassette was used to drive strong constitutive expression of Taar1 in neurons of adult C57BL/6J mice, as previously documented (Caroni, 1997; Luthi et al, 1997; Richards et al, 2003; Ittner and Gotz, 2007). Two lines of transgenic mice, B6-Tg(Taar1)19 and B6-Tg(Taar1)27, were created. Quantitative PCR analyses from selected punched brain areas (data not shown) and in situ hybridization (see Supplementary Figure S1 online) confirmed generalized brain overexpression of Taar1 in both lines, contrasting with the absence of detectable expression in the WT littermates.  /n  Rescue: Attenuating TAAR1 activity with the selective partial agonist RO5073012 restored the stimulating effects of amphetamine on locomotion.  /n  Model Summary: Taar1 transgenic mice were hyposensitive to the psychostimulant effects of amphetamine, as it produced only a weak locomotor activation and failed to alter catecholamine release in the Acb.	trace-amine receptor activity,G protein-coupled receptor activity,G protein-coupled amine receptor activity	Ani
Nlgn2	NLGN2	protein-coding	Mus musculus	ENSMUSG00000051790	NL2|NLG2	216856	Autism Spectrum Disorder	11|11 B3	Knockout	C57BL/6NCrl;129S6/SvEvTac;129S2/SvPasCrlf<U+00A0>	22820233	252	Expeimentalparadigm: Ultrasonic vocalizations//Rotarod//Open field test//Three chamber test//Elevated plus maze//Light-dark box test//Olfactory//Startle response and prepulse inhibition//Hotplate test  /n  Model Generation: Nlgn2+/-<U+00A0>breeders on a mixed background of C57BL/6NCrl, 129S6/SvEvTac, and 129S2/SvPasCrlf were kindly contributed by Frédérique Varoqueaux and Nils Brose [46]. The<U+00A0>Nlgn2<U+00A0>mutant line was generated as previously described [46]. In brief, exon sequences covering the translational start site and at least 380 bp of 5′ coding sequence were deleted by homologous recombination in embryonic material.We used a heterozygous breeding strategy to generate offspring of all three genotypes.<U+00A0>  /n  Rescue: -  /n  Model Summary: Reduced breeding efficiency and high reactivity to handling was observed in<U+00A0>Nlgn2-/-<U+00A0>mice, resulting in low numbers of adult mice available for behavioral assessment. Consistent with previous findings,<U+00A0>Nlgn2-/-<U+00A0>mice displayed normal social behaviors, concomitant with reduced exploratory activity, impaired rotarod performance, and delays on several developmental milestones. No spontaneous stereotypies or repetitive behaviors were detected. Acoustic, tactile, and olfactory sensory information processing as well as sensorimotor gating were not affected.<U+00A0>Nlgn2-/-<U+00A0>pups isolated from mother and littermates emitted fewer ultrasonic vocalizations and spent less time calling than<U+00A0>Nlgn2+/+<U+00A0>littermate controls.	protein binding,signaling receptor activity,neurexin family protein binding,identical protein binding,cell adhesion molecule binding	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Aggressive Behaviors	10|10 D2	Knockout	C57BL/6	22832966	253	Expeimentalparadigm: Open field test//Elevated plus maze//Marble burying test//Novelty suppressed feeding//Forced swim test//Tail suspension test//Resident–intruder test  /n  Model Generation: To obtain Tph2 gene-deleted mice on a pure genetic background, heterozygous Tph2-deficient animals on C57Bl/6 background (6th generation)8 were bred for further four generations to C57Bl/6 mice (Charles River, Sulzfeld, Germany). All experiments have been performed in adult (18–22 weeks old) F10 C57Bl/6 Tph2-/-, Tph2+/- and wild-type (Tph2) male mice. To generate animals of the three above-mentioned genotypes Tph2+/++/- females were bred with Tph2-/- or Tph2 male mice. Genotyping was performed using PCR with primer TPH34 (5′-AGC TGA GGC AGA CAG AAA GG-3′), TPH54 (5′-CCA AAG AGC TAC TCG ACC TAC G-3′) and Neo3 (5′-CTG CGC TGA CAG CCG GAA CAC-3′). Mice were single housed starting at 10–12 weeks of age as Tph2+/+-/- males are highly aggressive and cannot be kept in groups. In order to avoid differences due to single-housing condition Tph2+/-and Tph2 were single housed as well at least 4 weeks before experiments.+/+  /n  Rescue: -  /n  Model Summary: In this study, we used Tph2-deficient (Tph2(-/-)) mice to evaluate the impact of serotonin depletion in the brain on mouse behavior. Tph2(-/-) mice exhibited increased depression-like behavior in the forced swim test but not in the tail suspension test. In addition, they showed decreased anxiety-like behavior in three different paradigms: elevated plus maze, marble burying and novelty-suppressed feeding tests. These phenotypes were accompanied by strong aggressiveness observed in the resident-intruder paradigm. Despite carrying only one copy of the gene, heterozygous Tph2(+/-) mice showed only 10% reduction in brain serotonin, which was not sufficient to modulate behavior in the tested paradigms. Our findings provide unequivocal evidence on the pivotal role of central serotonin in anxiety and aggression.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Sparc	SPARC	protein-coding	Mus musculus	ENSMUSG00000018593	BM-40|ON	20692	Major Depressive Disorder	11 B1.3|11 33.04 cM	Mutated	B6;129S-Sparctm1Hwe/J	22950524	254	Expeimentalparadigm: Elevated plus maze//Open field test//Light-dark box test//Novel object recognition//Tail suspension test//Forced swimming test  /n  Model Generation: B6;129S-Sparctm1Hwe/J mice were obtained from the Jackson Laboratory (Bar Harbor, Maine, USA) and bred in the animal house of the Leloir Institute Foundation. In all experiments, littermates from heterozygous breeding were used. All animals were genotyped by polymerase chain reaction as recommended by the supplier (Jackson Laboratory), using mouse tail genomic DNA as template. Specific primers were as follows: sense, 5′-TTCTTCCTTGCAACCCTCTC-3′; wildtype (WT) reverse, 5′-TGTGGAGCTTCCTCTGTCCT-3′; and KO reverse, 5′-GGGGTTTGCTCGACATTG-3′.  /n  Rescue: -  /n  Model Summary: To further characterize the role of SPARC in the brain, we analyzed the hippocampal-dependent adult behavior of SPARC KO mice. We found that SPARC KO mice show increased levels of anxiety-related behaviors and reduced levels of depression-related behaviors. The antidepressant-like phenotype could be rescued by adenoviral vector-mediated expression of SPARC in the adult hippocampus, but anxiety-related behavior persisted in these mice. To identify the cellular mechanisms underlying these behavioral alterations, we analyzed neuronal activity and neurogenesis in the dentate gyrus (DG). SPARC KO mice have increased levels of neuronal activity, evidenced as more neurons that express c-Fos after a footshock. SPARC also affects cell proliferation in the subgranular zone of the DG, although it does not affect maturation and survival of new neurons. SPARC expression in the adult DG does not revert the proliferation phenotype in KO mice, but our results suggest a role of SPARC in limiting the survival of new neurons in the DG.	extracellular matrix structural constituent,calcium ion binding,protein binding,collagen binding,ion binding,protein folding chaperone,metal ion binding,extracellular matrix binding	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Attention-Deficit/Hyperactivity Disorder	11 B5|11 46.18 cM	Knockout	C57BL/6J	22951260	255	Expeimentalparadigm: Grooming behavior  /n  Model Generation: SERT+/- and BDNF+/- mice and their wild type  C57BL/6J counterparts (n = 9 per group), originally obtained from Jackson Laboratory (Bar Harbor, ME).  /n  Rescue: -  /n  Model Summary: Overall, SERT(+/-) mice displayed a general increase in grooming behavior, as indicated by more grooming bouts and more transitions between specific grooming stages. SERT(+/-) mice also aborted more grooming bouts, but showed generally unaltered activity levels in the observation chamber. In contrast, BDNF(+/-) mice displayed a global reduction in grooming activity, with fewer bouts and transitions between specific grooming stages, altered grooming syntax, as well as hypolocomotion and increased turning behavior.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Attention-Deficit/Hyperactivity Disorder	2 E3|2 56.63 cM	Knockout	C57BL/6J	22951260	256	Expeimentalparadigm: Grooming behavior  /n  Model Generation: SERT+/- and BDNF+/- mice and their wild type C57BL/6J counterparts (n = 9 per group), originally obtained from Jackson Laboratory (Bar Harbor, ME).  /n  Rescue: -  /n  Model Summary: -	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Autism Spectrum Disorder	X A7.1|X 34.83 cM	Knockout	C57BL/6J	23011134	257	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: Male fmr1-/- mice (FVB.129P2-Fmr1tm1Cgr/J) and wild-type control mice (FVB.129P2-Pde6bTyr+c-ch/AntJ) from Jackson Laboratories (Bar Harbor, ME), aged between 6 to 10 weeks, or adult male fmr1-/- mice on C57BL/6J background (Fmr1 KO2) were used for the biochemical studies.  /n  Rescue: Pharmacological enhancement of 2-arachidonoyl-sn-glycerol signalling normalizes this synaptic defect and corrects behavioural abnormalities in fragile X mental retardation protein-deficient mice.  /n  Model Summary: When bred on a C57BL/6 background, fmr1-/- mice display a behavioural phenotype that is characterized by elevated motor activity in an open field (Fig. 6a,b) and decreased aversion to the open arms of an elevated plus maze34 (Fig. 6c,d).	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Npas4	NPAS4	protein-coding	Mus musculus	ENSMUSG00000045903	LE-PAS|Nxf	225872	Autism Spectrum Disorder	19|19 A	Knockout	C57BL/6J	23029555	258	Expeimentalparadigm: Elevated zero maze//Open field test//6-trial social test//Tube dominance//Two-day social test//Spontaneous alternation//Place and reversal learning//Novel object recognition test//Test of sensorimotor gating//Pre-pulse inhibition  /n  Model Generation: Behavioral testing was conducted on a total of 97 Npas4 mice. This line has been described previously [3]. Male Npas4 wild-type (WT), heterozygotes (HET), and knockout (KO) mice were obtained by HETxHET breeding at the Stanford Behavioral and Functional Neuroscience core facility (USA).  /n  Rescue: -  /n  Model Summary: We hypothesized that alterations in the inhibitory pathways induced by the absence of Npas4 play a major role in the expression of the symptoms observed in psychiatric disorders. To test this hypothesis we tested mice lacking the transcription factor (Npas4 knock-out mice (Npas4-KO)) in a battery of behavioral assays focusing on general activity, social behaviors, and cognitive functions. Npas4-KO mice are hyperactive in a novel environment, spend less time exploring an unfamiliar ovariectomized female, spend more time avoiding an unfamiliar male during a first encounter, show higher social dominance than their WT littermates, and display pre-pulse inhibition, working memory, long-term memory, and cognitive flexibility deficits. Our results suggest that Npas4 may play a major role in the regulation of cognitive and social functions in the brain with possible implications for developmental disorders such as schizophrenia and autism.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,protein binding,protein-containing complex binding,protein heterodimerization activity,protein dimerization activity	Ani
Rictor	RICTOR	protein-coding	Mus musculus	ENSMUSG00000050310	4921505C17Rik|6030405M08Rik|AVO3|D530039E11Rik	78757	Attention-Deficit/Hyperactivity Disorder	15|15 A1	Conditional Knockout	C57BL/6	23049074	259	Expeimentalparadigm: Elevated zero maze test//Open field test//Wheel running//Homecage activity test//Marble burying  /n  Model Generation: Mice expressing floxed Rictor alleles were a gift from Dr Mark Magnuson (Vanderbilt University, Nashville, TN) (15). Homozygous Rictor-floxed animals were maintained for over 2 years on a C57/BL6 genetic background and bred without difficulty. Emx1-Cre mice maintained on a C57/BL6 background were obtained from Jackson Laboratories (Strain #005628, Bar Harbor, ME). Rictor CKO mice are homozygous for the Rictor-floxed allele and heterozygous for Emx1Cre.  /n  Rescue: -  /n  Model Summary: Rictor CKO mice have small brains and bodies, normal lifespan and are fertile. Cortical layering is normal, but neurons are smaller than those in control brains. Seizures were not observed, although excessive slow activity was seen on electroencephalography. Rictor CKO mice are hyperactive and have reduced anxiety-like behavior. Finally, there is decreased white matter and increased levels of monoamine neurotransmitters in the cerebral cortex.	protein binding,protein kinase binding,ribosome binding,protein serine/threonine kinase activator activity,molecular adaptor activity	Ani
rgs4	RGS4	protein-coding	Zebrafish	ENSDARG00000070047	cb436|sb:cb436|wu:fc06d08	569876	Schizophrenia	-	Knockdown(MO)	Tübingen	23052218	260	Expeimentalparadigm: Touch and escape responses//Tactile stimuli  /n  Model Generation: The open reading frame of zebrafish rgs4 was PCR amplified with high fidelity Pfu polymerase (Fermentas) and primers (5′-AAGGATCCGGATCCATGTGTAAAGGGCTTGCTGCTC-3′ and 5′-TAATCGATATCGATAGGCATAACTAGGCAAACACTGAC-3′) which were designed according to the zebrafish genome database (http://www.ensembl.org, version Zv6) (GenBank Accession Number BC154780.1). rgs4 MO1 and MO2 binding sequences were inserted upstream of an enhanced green fluorescent protein reporter in the pCS2 vector to create a 5′rgs4-EGFP construct to evaluate the specificity and efficiency of morpholinos. The open reading frame of mouse Rgs4 was amplified with primers (5′-ATCGATATGTGCAAAGGACTTGCAGGTCTGC-3′ and 5′-ATCGATTTAGGCACACTGGGAGACCAGGGAAG-3′) which were designed according to the NCBI database (GenBank Accession Number NM_009062.3).  /n  Rescue: Rgs4 knockdown also attenuated the level of phosphorylated-Akt1, and injection of constitutively-activated AKT1 rescued the motility defects and axonal phenotypes in the spinal cord but not in the hindbrain and trigeminal neurons.  /n  Model Summary: We have isolated zebrafish rgs4 and shown that it is transcribed in the developing nervous system. Rgs4 knockdown did not affect neuron number and patterning but resulted in locomotion defects and aberrant development of axons.	GTPase activator activity	Ani
Tsc2	TSC2	protein-coding	Mus musculus	ENSMUSG00000002496	Nafld|Tcs2	22084	Autism Spectrum Disorder	17 A3.3|17 12.41 cM	Conditional Knockout	129X1/SvJ;C57BL/6J<U+00A0>	23123587	261	Expeimentalparadigm: Nest building test//Response to social cues//Marble burying test//Open field test//Buried food//Social behavior//Inkblot//Rotarod//Light-dark box test//Water maze//Reverse water maze//Vision water maze  /n  Model Generation: Mice were on a combined 129X1/SvJ and C57BL/6J background. Generation of the<U+00A0>Tsc2+/flox<U+00A0>and<U+00A0>Tsc2+/KO<U+00A0>mice has been previously described (Way et al., 2009). The expression of<U+00A0>Cre recombinase<U+00A0>was controlled by the Pcp2<U+00A0>Purkinje cell<U+00A0>protein specific promoter as previously described (Barski et al., 2000).  /n  Rescue: Importantly, social behavior deficits were prevented with<U+00A0>rapamycin<U+00A0>treatment.<U+00A0>  /n  Model Summary: Using the three chambered apparatus to asses social behavior, we found that Tsc2f/<U+2212>;Cre mice showed behavioral deficits, exhibiting no preference between a stranger mouse and an inanimate object, or between a novel and a familiar mouse. We also detected social deficits in Tsc2f/f;Cre mice, suggesting that Purkinje cell pathology is sufficient to induce ASD-like behavior.<U+00A0>	GTPase activator activity,protein binding,phosphatase binding,small GTPase binding,protein homodimerization activity,protein-containing complex binding,protein N-terminus binding,Hsp90 protein binding,14-3-3 protein binding	Ani
Eif4ebp2	EIF4EBP2	protein-coding	Mus musculus	ENSMUSG00000020091	2810011I19Rik|4E-BP2|PHAS-II	13688	Autism Spectrum Disorder	10 B4|10 32.21 cM	Knockout	C57Bl/6J<U+00A0>	23172145	262	Expeimentalparadigm: Three-chamber test//Preference for social novelty tests//Homecage social interaction test//Reciprocal social interaction test//Self-grooming test//Marble burying task//Isolation induced USVs//Elevated plus maze//Contextual fear conditioning test  /n  Model Generation: WT mice are littermates of the corresponding genotype KO or knock-in mice. For all experiments littermates from heterozygote crossings were used. Mice were backcrossed for more than 10 generations to C57Bl/6J mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: 4E-BP2-KO mice exhibit an increased ratio of excitatory to inhibitory synaptic inputs and autistic-like behaviors: social interaction deficits, altered communication and repetitive/stereotyped behaviors.<U+00A0>	protein binding,eukaryotic initiation factor 4E binding,translation repressor activity	Ani
Grin2b	GRIN2B	protein-coding	Mus musculus	ENSMUSG00000030209	GluN2B|GluRepsilon2|NR2B|Nmdar2b	14812	Obsessive Compulsive Disorder	6 G1|6 66.38 cM	Targeted	C57BL/6J	23201971	263	Expeimentalparadigm: Open field test//Elevated plus maze//Rotarod//Fear conditioning test//Visual discrimination//Reversal learning  /n  Model Generation: The exonic sequence coding for the C-terminal domains (CTDs) of the GluN2A and GlunN2B subunits were swapped into the reciprocal genomic loci, in separate knockin mouse lines, without altering the genomic structure of either the GluN2A or GluN2B genes. This was enabled by the fact that almost the entirety of the GluN2A and GluN2B cytoplasmic domains are encoded by the terminal exons of the GluN2A and GluN2B genes, respectively. The initial amino acid sequence encoded by the GluN2A and GluN2B terminal exons are identical (starting with the exonic DNA sequence coding for the “GIYSCI…” amino acid motif see Fig. 1), facilitating the engineering of functional chimeric proteins. The targeting vectors were used to target the GluN2A or GluN2B loci in 129/OlaHsd mouse embryonic stem (ES) cells, originating from the 129P2 mouse strain using standard methods. ES cell colonies were screened by long-range PCR. GluN2A2B(CTR) targeted colonies were screened using primers AGAATTCCTGCAGCCCGGGGGATC and TTCGTCTGAAGCAGCCCCAAGATC, which anneal to the Neo cassette and a region of the 3′UTR that lies beyond the 3′ terminus of the GluN2B-2A(CTR) targeting vector. Potential GluN2B2A(CTR) targeted colonies were screened using primers ACGAGATCAGCAGCCTCTGTTCCAC and GAGGCGGGGCGACCAGGAAGGC, which anneal to the Neo cassette and a region of the 3′UTR that lies beyond the 3′ terminus of the GluN2A-2B(CTR) targeting vector. Blastocyst injection of targeted clones was performed as described in53. F1 progeny were back-crossed onto C57Bl/6J mice to establish working colonies.  /n  Rescue: -  /n  Model Summary: To identify shared ancestral functions and diversified subunit-specific functions, we exchanged the exons encoding the GluN2A (also known as Grin2a) and GluN2B (also known as Grin2b) CTDs in two knock-in mice and analyzed the mice's biochemistry, synaptic physiology, and multiple learned and innate behaviors. The eight behaviors were genetically separated into four groups, including one group comprising three types of learning linked to conserved GluN2A/B regions. In contrast, the remaining five behaviors exhibited subunit-specific regulation. GluN2A/B CTD diversification conferred differential binding to cytoplasmic MAGUK proteins and differential forms of long-term potentiation. These data indicate that vertebrate behavior and synaptic signaling acquired increased complexity from the duplication and diversification of ancestral GluN2 genes.	ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,interleukin-1 receptor binding,ion channel activity,extracellularly glutamate-gated ion channel activity,cation channel activity,calcium channel activity,protein binding,beta-catenin binding,zinc ion binding,ligand-gated ion channel activity,glycine binding,glutamate binding,glutamate-gated calcium ion channel activity,D2 dopamine receptor binding,ionotropic glutamate receptor binding,small molecule binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,metal ion binding,cell adhesion molecule binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Cdkl5	CDKL5	protein-coding	Mus musculus	ENSMUSG00000031292	Stk9	382253	Autism Spectrum Disorder	X F4|X 73.95 cM	Knockout	C57BL/6<U+00A0>	23236174	264	Expeimentalparadigm: Locomotor assay//Rotarod//Zero maze//Three-chamber test//Sniffing a novel object//nesting behavior//Fear conditioning  /n  Model Generation: To mimic the effects of this splice site mutation, we deleted mouse<U+00A0>Cdkl5<U+00A0>exon 6 through homologous-mediated recombination in ES cells (Fig. 1A). Deletion of<U+00A0>Cdkl5<U+00A0>exon 6 leads to a similar shift in the reading frame and premature truncation within the N-terminal kinase domain (Fig. 1<U+00A0>A<U+00A0>and<U+00A0>B).<U+00A0>Experimental mice have been backcrossed onto the C57BL/6 background for at least six generations.  /n  Rescue: -  /n  Model Summary: Here we report the development of a unique knockout mouse model of CDKL5-related disorders and demonstrate that mice lacking CDKL5 show autistic-like deficits in social interaction, as well as impairments in motor control and fear memory.<U+00A0>	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ATP binding,kinase activity,transferase activity,small GTPase binding	Ani
Syn1	SYN1	protein-coding	Mus musculus	ENSMUSG00000037217	Syn-1|Syn1-S	20964	Autism Spectrum Disorder	X A1.3|X 16.37 cM	Knockout	C57BL/6J	23280234	265	Expeimentalparadigm: Open field test//Light-dark test//Test for sociability and social novelty preference//Social recognition test//Tube test for social dominance//Resident-intruder test//Social transfer of food preference test//Buried food olfactory test//Marble burying test //Self-grooming behavior  /n  Model Generation: Previously generated SynI-/-, SynII-/- and SynIII-/- mice [19], [23], [24] were backcrossed to a C57BL/6J background (Charles River Laboratories, Calco, Italy) through at least ten generations.  /n  Rescue: -  /n  Model Summary: Here, we studied social interaction and novelty, social recognition and social dominance, social transmission of food preference and social memory in groups of male SynI(-/-), SynII(-/-) and SynIII(-/-) mice before and after the appearance of the epileptic phenotype and compared their performances with control mice. We found that deletion of Syn isoforms widely impairs social behaviors and repetitive behaviors, resulting in ASD-related phenotypes. SynI or SynIII deletion altered social behavior, whereas SynII deletion extensively impaired various aspects of social behavior and memory, altered exploration of a novel environment and increased self-grooming. Social impairments of SynI(-/-) and SynII(-/-) mice were evident also before the onset of seizures.	protein kinase binding,identical protein binding,calcium-dependent protein binding	Ani
Syn2	SYN2	protein-coding	Mus musculus	ENSMUSG00000009394	2900074L19Rik	20965	Autism Spectrum Disorder	6 E3|6 53.2 cM	Knockout	C57BL/6J	23280234	266	Expeimentalparadigm: Open field test//Light-dark test//Test for sociability and social novelty preference//Social recognition test//Tube test for social dominance//Resident-intruder test//Social transfer of food preference test//Buried food olfactory test//Marble burying test //Self-grooming behavior  /n  Model Generation: Previously generated SynI-/-, SynII-/- and SynIII-/- mice [19], [23], [24] were backcrossed to a C57BL/7J background (Charles River Laboratories, Calco, Italy) through at least ten generations.  /n  Rescue: -  /n  Model Summary: Here, we studied social interaction and novelty, social recognition and social dominance, social transmission of food preference and social memory in groups of male SynI(-/-), SynII(-/-) and SynIII(-/-) mice before and after the appearance of the epileptic phenotype and compared their performances with control mice. We found that deletion of Syn isoforms widely impairs social behaviors and repetitive behaviors, resulting in ASD-related phenotypes. SynI or SynIII deletion altered social behavior, whereas SynII deletion extensively impaired various aspects of social behavior and memory, altered exploration of a novel environment and increased self-grooming. Social impairments of SynI(-/-) and SynII(-/-) mice were evident also before the onset of seizures.	protein binding,ATP binding,identical protein binding,calcium-dependent protein binding	Ani
Syn3	SYN3	protein-coding	Mus musculus	ENSMUSG00000059602	-	27204	Autism Spectrum Disorder	10|10 C1	Knockout	C57BL/6J	23280234	267	Expeimentalparadigm: Open field test//Light-dark test//Test for sociability and social novelty preference//Social recognition test//Tube test for social dominance//Resident-intruder test//Social transfer of food preference test//Buried food olfactory test//Marble burying test //Self-grooming behavior  /n  Model Generation: Previously generated SynI-/-, SynII-/- and SynIII-/- mice [19], [23], [24] were backcrossed to a C57BL/8J background (Charles River Laboratories, Calco, Italy) through at least ten generations.  /n  Rescue: -  /n  Model Summary: Here, we studied social interaction and novelty, social recognition and social dominance, social transmission of food preference and social memory in groups of male SynI(-/-), SynII(-/-) and SynIII(-/-) mice before and after the appearance of the epileptic phenotype and compared their performances with control mice. We found that deletion of Syn isoforms widely impairs social behaviors and repetitive behaviors, resulting in ASD-related phenotypes. SynI or SynIII deletion altered social behavior, whereas SynII deletion extensively impaired various aspects of social behavior and memory, altered exploration of a novel environment and increased self-grooming. Social impairments of SynI(-/-) and SynII(-/-) mice were evident also before the onset of seizures.	nucleotide binding,ATP binding	Ani
Hcrtr2	HCRTR2	protein-coding	Rattus norvegicus	ENSRNOG00000011251	ox-2-R|ox2-R|ox2r	25605	Narcolepsy	8q24	Knockdown	Sprague Dawley	23282008	268	Expeimentalparadigm: Sleep recordings  /n  Model Generation: A pool of 3 siRNAs (equal concentration) was used. All of them were designed individually to target OxR2 (OxR2-siRNA).<U+00A0>Adult Sprague Dawley male rats (300-350g; Charles River Laboratories, Wilmington, MA) were housed under a 12:12 h light-dark cycle (lights on: 0700 hr; lights off: 1900 hr) at 22±1°C.  /n  Rescue: -  /n  Model Summary: Knockdown of orexin type 2 receptor in the lateral pontomesencephalic tegmentum of rats increases REM sleep	G protein-coupled receptor activity,orexin receptor activity,peptide hormone binding	Ani
Csnk2a2	CSNK2A2	protein-coding	Mus musculus	ENSMUSG00000046707	1110035J23Rik|CK2	13000	Attention-Deficit/Hyperactivity Disorder	8 C5- D1|8 47.12 cM	Knockout	Gensat Drd1a-Cre;Drd-Cre;Drd1a-EGFP	23290496	269	Expeimentalparadigm: Locomotion test//Rotarod//Novelty suppressed feeding test//Modified novel object//Pole test  /n  Model Generation: We generated the floxed CK2α and CK2α’ lines and crossed these with the Gensat Drd1a-Cre, Drd-Cre and Drd1a-EGFP mice.  /n  Rescue: Altered behavioral phenotypes in Drd1a-Cre-CK2α knockout mice are attenuated by the D1 receptor antagonist SCH23390.  /n  Model Summary: The D1-MSN knockout mice exhibited distinct behavioral phenotypes including novelty-induced hyperlocomotion and exploratory behavior, defective motor control, and motor learning. All of these behavioral traits are indicative of dysregulated dopamine signaling and the underlying mechanism appears to be an alteration of D1R signaling.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,protein binding,ATP binding,kinase activity,transferase activity,protein N-terminus binding	Ani
Scn1a	SCN1A	protein-coding	Rattus norvegicus	ENSRNOG00000053122	-	81574	Cognitive Disorders	3q21	Knockdown	Sprague Dawley	23318929	270	Expeimentalparadigm: Novelty object recognition  /n  Model Generation: siRNA constructs were obtained from Invitrogen (Stealth RNAi, Life Technologies Co., Carlsbad, CA). A negative control siRNA construct (Stealth RNAi Negative Control #12935300, Invitrogen) was used for control groups, and Alexa555-conjugated<U+00A0>Scn1a<U+00A0>and control siRNA constructs were used for tracking siRNA delivery. Before administering siRNA constructs<U+00A0>in vivo, three siRNA sequences were initially screened<U+00A0>in vitro<U+00A0>for efficient knockdown of<U+00A0>Scn1a<U+00A0>expression.  /n  Rescue: -  /n  Model Summary: Focal Scn1a knockdown induces cognitive impairment without seizures	voltage-gated ion channel activity,voltage-gated sodium channel activity,sodium ion binding,voltage-gated ion channel activity involved in regulation of presynaptic membrane potential	Ani
prickle1a	PRICKLE1	protein-coding	Zebrafish	ENSDARG00000040649	fk71b09|pk1|prickle1|wu:fk71b09	368249	Neurodevelopmental Disorders	-	Knockdown(MO)	NA	23324328	271	Expeimentalparadigm: Vision startle response assay  /n  Model Generation: Control MO, 5′-CCTCTTACCTCAGTTACAATTTATA-3′; pk1a-MO, 5′-CAGCTCCATCACTAACACCCCCTCA-3′ and pk1a second MO, 5′-GCCCACCGTGATTCTCCAGCTCCAT-3′ were purchased from Gene Tools. The second pk1a-MO completely overlaps with pk1a RNA sequence so was not used for rescue studies. HA-Ub expression construct was a gift from Douglas Houston (University of Iowa, Iowa City, IA). The myc-pk1a wild-type form was cloned from 8–12 somite stage cDNA library with GeneAmp highfidelity polymerase (Applied Biosystems, Life Technologies, Carlsbad, CA). PCR primers for cloning pk1a were: (forward) 5′-ATGGAGCTGGAGAATCACGGTGG-3′ and (reverse) 5′-AATTCCCTCTCAAAGTGGGC-3′. PCR products were cloned into PCR8/GW/TOPO entry vector and recombined with the destination vector with an N-terminal 6× myc (from Nathan Lawson’s Lab at University of Massachusetts Medical School, Worcester, MA). TA cloning and LR recombination kits were purchased from Life Technologies (Carlsbad, CA). The myc-pk1a mutant forms were generated by site-directed mutagenesis as described (Tao et al., 2011). In vitro transcription was performed to make synthetic RNAs using the mMessage mMachine in vitro transcription kit (Ambion, Life Technologies, Carlsbad, CA). Microinjections were done at the 1–2 cell stage by injecting into the yolk. Needles for injections were calibrated after each injection set. The injection volume varied between 2.0 nl/pump and 3.0 nl/pump. For the motility assay and the retina axon outgrowth analyses, 1.0 ng and 2.0–3.0 ng pk1a-MO was injected into the embryos, respectively. For the vision assay, 1.0 ng crx-MO was used. RNA injection doses were 40 pg and 80 pg wild-type pk1a for rescue experiments and 250 pg wild-type and mutant forms for biochemical analyses.  /n  Rescue: -  /n  Model Summary: To address the mechanism underlying epileptogenesis, we used zebrafish to characterize Pk1a function and epilepsy-related mutant forms. We show that knockdown of pk1a activity sensitizes zebrafish larva to a convulsant drug. To model defects in the central nervous system, we used the retina and found that pk1a knockdown induces neurite outgrowth defects; yet visual function is maintained.	protein binding,zinc ion binding,metal ion binding	Ani
Esr1	ESR1	protein-coding	Mus musculus	ENSMUSG00000019768	ER|ER-alpha|ERa|ERalpha|ESR|Estr|Estra|Nr3a1	13982	Aggressive Behaviors	10 A1|10 2.03 cM	Conditional Knockdown	ICR/JCL	23347260	272	Expeimentalparadigm: Sexual behavior test//Aggressive behavior test  /n  Model Generation: we generated an adeno-associated virus vector expressing a small hairpin RNA targeting ERα to site-specifically knockdown ERα expression. Adeno-associated virus (AAV) vectors expressing a small hairpin RNA against either the sequence specific for the ERα gene (AAV-shERα: 5′-GATCCCCGGCATGGAGCATCTCTACACTTCCTGTCATGTAGAGATGCTCCATGCCTTTTTTGGAAT-3′ and 5′-CTAGATTCCAAAAAAGGCATGGAGCATCTCTACATGACAGGAAGTGTAGAGATGCTCCATGCCGGG-3′) or the sequence specific for luciferase (LUC) as control (AAV-shLUC: 5′-GATCCCCCCGCTGGAGAGCAACTGCATCTTCCTGTCAATGCAGTTGCTCTCCAGCGGTTTTTGGAA-3′ and 5′-CTAGTTCCAAAAACCGCTGGAGAGCAACTGCATGAGCAACTGCATTGACAGGAAGATGCAGTTGCTCTCCAGCGGGGG-3′) were used. The nucleotides specific for ERα or LUC are underlined. These vectors also express enhanced green fluorescent protein (GFP) as a reporter to visually detect transduced neurons. The complete details of the small hairpin RNAs used in this study are described in Musatov et al. (2006).  /n  Rescue: -  /n  Model Summary: As an aromatised metabolite of testosterone, estradiol-induced activation of estrogen receptor α (ERα) may be crucial for the induction of these behaviors in male mice. However, the importance of ERα expressed in different nuclei for this facilitatory action of testosterone has not been determined. To investigate this issue, we generated an adeno-associated virus vector expressing a small hairpin RNA targeting ERα to site-specifically knockdown ERα expression. We stereotaxically injected either a control or ERα targeting vector into the medial amygdala, medial pre-optic area (MPOA), or ventromedial nucleus of the hypothalamus (VMN) in gonadally intact male mice. Two weeks after injection, all mice were tested biweekly for sexual and aggressive behavior, alternating between behavior tests each week. We found that suppressing ERα in the MPOA reduced sexual but not aggressive behavior, whereas in the VMN it reduced both behaviors. Knockdown of ERα in the medial amygdala did not alter either behavior. Additionally, it was found that ERα knockdown in the MPOA caused a parallel reduction in the number of neuronal nitric oxide synthase-expressing cells.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,TFIIB-class transcription factor binding,transcription coregulator binding,transcription corepressor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,beta-catenin binding,transcription factor binding,zinc ion binding,lipid binding,TBP-class protein binding,enzyme binding,protein kinase binding,nuclear estrogen receptor activity,nuclear estrogen receptor binding,type 1 metabotropic glutamate receptor binding,estrogen response element binding,phosphatidylinositol 3-kinase regulatory subunit binding,hormone binding,identical protein binding,sequence-specific DNA binding,protein-containing complex binding,metal ion binding,ATPase binding,sequence-specific double-stranded DNA binding,promoter-specific chromatin binding	Ani
RGD1307443	KIAA0319	protein-coding	Rattus norvegicus	ENSRNOG00000018141	-	361244	Developmental Dyslexia	17p11	Knockdown(RNAi)	Wistar	23395846	273	Expeimentalparadigm: Anesthetized Recordings//Awake Recordings  /n  Model Generation: Transfection of<U+00A0>in utero<U+00A0>RNAi of dyx1c1 was performed by JB at the University of Connecticut. In all Dyx1c1 treatments, plasmids encoding short hairpin (pU6DyxHPB) RNA (Dyx1c1 RNAi) and plasmids encoding eGFP (green fluorescent protein) were co-transfected into the ventricular zone (VZ) by<U+00A0>in utero<U+00A0>electroporation. Sham subjects received transfection only with plasmids (pCAGGS-RFP) encoding mRFP (red fluorescent protein). Transfection occurred around E14 in time–mated dams.  /n  Rescue: -  /n  Model Summary: These results provide the first evidence that decreased expression of the dyslexia-associated gene<U+00A0>Kiaa0319<U+00A0>can alter cortical responses and impair phoneme processing in auditory cortex.	NA	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6J;129Sv/J	23397052	274	Expeimentalparadigm: Cliff avoidance//Measurement of ataxia and stereotypy//Prepulse inhibition  /n  Model Generation: Targeted Disruption of the Murine DAT Gene. DAT knockout mice were produced by standard techniques. Thirteen- and 15-kb DAT genomic fragments were isolated from a λ-FIX II genomic library (Stratagene) prepared from the 129SvEv mouse strain, and a targeting vector constructed by using a 5.0-kb BamHI–SmaI 5′ fragment and a 5.5-kb SpeI–BamHI 3′ fragment subcloned into pPGKneo. The final construct, designated pDATKO, contains the herpes simplex virus thymidine kinase (TK) gene driven by the MC1 polyoma enhancer at the 3′ end of a SpeI–BamHI 3′ fragment.  /n  Rescue: -  /n  Model Summary: DAT-KO mice exhibited a profound CAR impairment compared to wild-type (WT) mice. As expected, DAT-KO mice showed PPI deficits compared to WT mice. Furthermore, the DAT-KO mice with the most impaired CAR exhibited the most severe PPI deficits. Treatment with methylphenidate or nisoxetine ameliorated CAR impairments in DAT-KO mice.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Celf6	CELF6	protein-coding	Mus musculus	ENSMUSG00000032297	6330569O16Rik|Brunol6	76183	Autism Spectrum Disorder	9|9 B	Knockout	C57BL/6J<U+00A0>	23407934	275	Expeimentalparadigm: Ultrasonic pup vocalization//Locomotor activity//Exploration test//Morris water maze//Social approach test//Acoustic startle and prepulse inhibition//Elevated plus maze  /n  Model Generation: Long and short arms with LoxP sites flanking exon 4 of<U+00A0>Celf6<U+00A0>were cloned by PCR adjacent to an Frt flanked neomycin-resistance cassette gene. B6(Cg)-Tyrc-2j/j-derived ES cells were electroporated using standard methods, and neomycin-resistant colonies were screened by PCR and southern blot for proper integration. Positive colonies were injected into C57BL/6J mouse blastocysts, and chimeric mice were bred to germline Flpe expressing C57BL/6J mice to remove neomycin selection cassette, then actin-Cre C57BL/6J mice to create germline deletions of<U+00A0>Celf6.  /n  Rescue: -  /n  Model Summary: The Disruption of<U+00A0>Celf6, a Gene Identified by Translational Profiling of Serotonergic Neurons, Results in Autism-Related Behaviors	nucleic acid binding,RNA binding,mRNA binding	Ani
Ghrl	GHRL	protein-coding	Mus musculus	ENSMUSG00000064177	2210006E23Rik|Ghr|MTLRP|MTLRPAP|m46	58991	Alcohol Use Disorder	6 E3|6 52.84 cM	Knockout	NA	23428971	276	Expeimentalparadigm: Ethanol-induced conditioned place preference//Ethanol-induced locomotor activity//Two-bottle choice paradigm  /n  Model Generation: Ghrelin Knockout mice (Institut de Génétique et de Biologie Moléculaire et Cellulaire “IGBMC”, France) and their WT littermates as well as regular C57BL/6 (23–30<U+00A0>g) were group-housed (5 per cage) at a room temperature of approximately 22<U+00A0>°C with a 12<U+00A0>h/12<U+00A0>h light/dark cycle (light on at 6am) and allowed to adapt to this environment for a period of 7 days before the experiments began.<U+00A0>  /n  Rescue: -  /n  Model Summary: Taken together, these results suggest that ghrelin neurotransmission is necessary for the stimulatory effect of ethanol to occur, whereas lack of ghrelin leads to changes that reduce the voluntary intake as well as conditioned reward by ethanol.	G protein-coupled receptor binding,hormone activity,growth hormone-releasing hormone activity,protein tyrosine kinase activator activity,ghrelin receptor binding	Ani
Nlgn2	NLGN2	protein-coding	Mus musculus	ENSMUSG00000051790	NL2|NLG2	216856	Aggressive Behaviors	11|11 B3	Overexpression	Wistar	23451101	277	Expeimentalparadigm: Open field test//Novel object//Sociability//Social memory test//Resident-intruder test//Bedding preference test  /n  Model Generation: All experimental animals were the male offspring of Wistar rats obtained from (Charles River Laboratories, France). At the age of 12 weeks, animals were subjected to surgeries for the viral overexpression of nlgn2 in the dorsal hippocampus, wherein an adeno-associated AAV1/2 vector (http://www.genedetect.com) containing a CAG-HA-tagged-nlgn2-WPRE-BGH-polyA- expression cassette was used. Control animals were injected with an empty construct (AAV1/2-CAG-Null/Empty-WPRE-BGH-polyA). All viral constructs used were designed and produced by GeneDetect, New Zealand. The vector incorporated the following regulatory elements: rAAV2 inverted terminal repeat (ITR) sequences, a scaffold attachment region (SAR) element, the hybrid chicken B‐actin/CMV enhancer (CAG) promoter region, a cis‐acting woodchuck post‐transcriptional regulatory element (WPRE) and a bovine growth hormone polyadenylation signal sequence (bgh‐polyA). The mouse pCAG-HA-tagged-Nlgn2 plasmid was kindly provided by Prof. Dr. Peter Scheiffele, University of Basel, Switzerland. For the empty vector, the same backbone without the cDNA was used. Initially, animals were anaesthetized with an intraperitoneal injection of ketamine (100 mg/kg body weight) and xylazine (10 mg/kg body weight) and installed in a stereotactic frame to avoid any head movements during the surgical procedure. A total of 2 μl of either nlgn2-OE or empty vector (titres: Nlgn2-OE: 1.4×1012 genomic particles/ml; empty: 1.3×1012 genomic particles/ml) was bilaterally injected (two injection sites per side, 1 μl each) in the dorsal hippocampus using automated syringe pumps with a flow rate of 0.2 μl/min. The injectors were left in site for additional 5 minutes after the actual injection. To target the dorsal area of the hippocampus following coordinates were used: 3.5 mm posterior to bregma, 1.5 mm and 3.5 mm from midline, 3.5 mm ventral from skull. After removing the injectors, animals were injected with an antisedant (0.1 mg/kg body weight, Antisedan, Pfizer). All rats were treated with paracetamol (500 mg/700 ml H2O, Dafalgan, Bristol-Myers Squibb, Agen, France) via the drinking water for 7 days after the surgery. The animals were allowed to recover for 5 weeks from surgery before the behavioral testing was started.  /n  Rescue: -  /n  Model Summary: In our study, we focused on the role of nlgn2 in the dorsal hippocampus in the regulation of emotional and social behaviors. To this purpose, we injected an AAV construct overexpressing nlgn2 in the hippocampus of rats and investigated the effects on behavior and on markers for the E/I ratio. We could show an increase in GAD65, a GABA-synthesizing protein in neuronal terminals, and furthermore, reduced exploration of novel stimuli and less offensive behavior. Our data suggest nlgn2 in the hippocampus to be strongly implicated in maintaining the E/I balance in the brain and thereby modulating social and emotional behavior.	protein binding,signaling receptor activity,neurexin family protein binding,identical protein binding,cell adhesion molecule binding	Ani
Pafah1b1	PAFAH1B1	protein-coding	Mus musculus	ENSMUSG00000020745	LIS-1|Lis1|MMS10-U|Mdsh|Ms10u|Pafaha	18472	Autism Spectrum Disorder	11 B5|11 45.76 cM	Conditional Knockout	CamKII-Cre;Lis1flox	23483716	278	Expeimentalparadigm: Three-chamber test//Marble burying test//Olfactory  /n  Model Generation: A 129/Sv phage contig was cloned and confirmed to be Pafah1b1 by sequence analysis and chromosomal location by FISH (ref. 38). Two different targeting constructs were made to inactivate Pafah1b1. A 3.0-kb HindIII fragment from within intron 5 to the middle of exon 6 was inserted into the EcoRI and Asp718 sites of pPNT-loxP, a modified version of pPNT (ref. 39) that contained a loxP site at the 3′ end of the PGKneo gene38. An 10-kb EcoRV fragment extending from the middle of intron 7 to beyond exon 9 was inserted in the XhoI site of the vector to generate Pafah1b1ex6neo–8 (Pafah1b1-neo) after targeting. For the second construct, a 5.0-kb XbaI fragment, from within intron 2, was inserted into the XbaI sites of pPNT-loxP-Lis5′ . A loxP site, associated with a novel BamHI site to allow monitoring the retention of this loxP site, was created from the following primer sequences: 5′-GATCCTAATAACTTCGTATAGCATACATTATA CGAAGTTATGTCGACTCGAGATCGATGGCGCGCCG-3′ and 5′-GATCCGGCGCGCCATCGATCTCGAGTCGACATAA CTTCGTATAATGTATGCTATACGAAGTTATTAG-3′. This loxP-BamHI site was inserted into the XhoI site of pPNT-loxP-Lis5′ to make pPNT-floxneo-Lis5′ . The loxP-BamHI site was also inserted near the Kpn I site within intron 6 of Pafah1b1. An 11.5-kb XbaI-Sal I fragment, containing this loxP-BamHI site, and extending from the middle of intron 2 to beyond exon 7, was inserted in the XhoI site of pPNT-floxneo-Lis5′ to generate Pafah1b1loxPex3–6 (Pafah1b1-loxP). These vectors were linearized with NotI and transfected into TC1 embryonic stem cells as described27,40. Targeting of Pafah1b1 -neo was identified in 10 of 1300 clones after BamHI digestion with the flanking probe A (Fig. 1b, wild-type allele 20 kb, targeted allele 14 kb). An internal probe B ( Fig. 1a) was used with several restriction enzymes to confirm correct targeting in these clones (data not shown). Targeting of Pafah1b1 -loxP was identified in over 100 of 1200 clones after BamHI digestion with the flanking probe C (Fig. 1d, wild-type allele 20 kb, targeted allele 18 kb). An internal probe D (Fig. 1d) was used with several restriction endonucleases to confirm correct targeting in these clones (data not shown). Two of the targeted ES cell clones for each allele were injected into C57BL/6J blastocysts. Germline transmission was obtained with both clones, and we established the Pafah1b1 mutant alleles in a mixed (129SvEv × NIH Black Swiss) background. Genotyping was performed by Southern blot, using probe B and BamHI/EcoRV digestion for Pafah1b1-neo ( Fig. 1c) and probe D and BamHI digestion for Pafah1b1 -loxP (Fig. 1f). To make an inactive Pafah1b1 allele from the Pafah1b1- loxP allele, Pafah1b1-loxP male heterozygotes were mated with homozygous EIIa-Cre transgenic female mice (in an FVB/n background), which express Cre in unfertilized oocytes26. The resulting offspring were genotyped with probe D and SacI digestion (Fig. 1g), creating animals with the Cre-deleted allele, designated Pafah1b1delex3–6 (Pafah1b1-del).  /n  Rescue: -  /n  Model Summary: Recently, LIS1 was implicated as an important protein-network interaction node with high-risk autism spectrum disorder genes expressed in the synapse. How LIS1 might participate in this disorder has not been investigated. We examined the role of LIS1 in synaptogenesis of post-migrational neurons and social behaviour in mice. Two-photon imaging of actin-rich dendritic filopodia and spines in vivo showed significant reductions in elimination and turnover rates of dendritic protrusions of layer V pyramidal neurons in adolescent Lis1+/- mice. Lis1+/- filopodia on immature hippocampal neurons in vitro exhibited reduced density, length and RhoA dependent impaired dynamics compared to Lis1. Moreover, Lis1+/++/- adolescent mice exhibited deficits in social interaction. Lis1 inactivation restricted to the postnatal hippocampus resulted in similar deficits in dendritic protrusion density and social interactions. Thus, LIS1 plays prominently in dendritic filopodia dynamics and spine turnover implicating reduced dendritic spine plasticity as contributing to developmental autistic-like behaviour.	protein binding,microtubule binding,identical protein binding,protein-containing complex binding,dynein intermediate chain binding,microtubule plus-end binding,phosphoprotein binding,dynein complex binding	Ani
Snap25	SNAP25	protein-coding	Mus musculus	ENSMUSG00000027273	Bdr|GENA70|SNAP-25|SUP|sp	20614	Attention-Deficit/Hyperactivity Disorder	2 F3|2 67.56 cM	Knockin	C57BL/6J	23497716	279	Expeimentalparadigm: T-maze//Light-dark box test//Open field test//Elevated plus maze//Hot plate test//Social interaction test//Rotarod//Startle response and prepulse inhibition//Porsolt forced swim test//Y-maze  /n  Model Generation: Arc-dVenus transgenic mice have been described in previous studies [36,46]. SNAP-25 KI mice were bred onto a C57BL/6N background, and Arc-dVenus transgenic mice were maintained in the C57BL/6J background. SNAP-25 KI mice were crossed to Arc-dVenus mice, and the resulting F1 mice were intercrossed to generate F2 offspring (SNAP-25 KI/Arc-dVenus: SNAP-25 wild/Arc-dVenus).  /n  Rescue: Chronic treatments with the antiepileptic drug valproate abolished the iDG phenotype and the working memory deficit in mutants.  /n  Model Summary: SNAP-25 KI mice and other mice possessing the iDG phenotype, i.e., alpha-calcium/calmodulin-dependent protein kinase II heterozygous mice, Schnurri-2 knockout mice, and mice treated with the antidepressant fluoxetine, showed similar molecular expression patterns, with over 100 genes similarly altered. A working memory deficit was also identified in mutant mice during a spontaneous forced alternation task using a modified T-maze, a behavioral task known to be dependent on hippocampal function.	SNARE binding,voltage-gated potassium channel activity,SNAP receptor activity,protein binding,lipid binding,myosin binding,syntaxin-1 binding,protein domain specific binding,syntaxin binding,transmembrane transporter binding,protein N-terminus binding,calcium-dependent protein binding,molecular adaptor activity	Ani
Uba6	UBA6	protein-coding	Mus musculus	ENSMUSG00000035898	4930542H01|5730469D23Rik|E1-L2|Ube1l2	231380	Autism Spectrum Disorder	5|5 E1	Conditional Knockout	Nestin-Cre;C57BL/6	23499007	280	Expeimentalparadigm: Grip strength test//Rotarod//Open field test//Elevated plus maze//Nesting building test//Social interaction test//Object exploration//Startle response and prepulse inhibition//Force swim test//Y-maze//Fear conditioning test  /n  Model Generation: Conditional Uba6+/Flox mice were produced by Ingenious Technologies (Stony Brook NY) on a hybrid C57/B6 background, the Neo cassette removed by flip-recombinase, and were backcrossed 5 times to B6. Nestin-Cre mice were obtained from Jackson Laboratory. Behavioral studies, quantitative PCR, immunohistochemistry, and Golgi staining are described in Supplemental Methods. All behavioral experiments were blind to genotype.  /n  Rescue: -  /n  Model Summary: Uba6NKO mice display numerous behavioral phenotypes, including a dramatic reduction in social interactions, an absence of response to fear conditioning paradigms, and evidence of hyperactivity with increased metabolic rate. Defects in Uba6NKO mice in fear conditioning may reflect altered architecture or signaling in the basolateral amygdala, which has been previously linked with fear centers in the brain (Davis and Whalen, 2001). Unlike control mice, Uba6NKO mice fail to habituate in the open field test, traveling significantly farther than control mice with fewer ventures into the center of the field. Hyperkinetic and metabolic rate phenotypes were also seen in Ate1-/- mice (Brower and Varshavsky, 2009). Finally, neurons in both the amygdala and the CA3 region of the hippocampus display a reduction in the number of dendritic spines, indicative of defects in synaptic connectivity in Uba6NKO animals. While these results were obtained through an analysis of female mice, a limited analysis of male mice in both the contextual fear conditioning test and the open field test gave similar results (Figure S3), indicating that the major phenotypes are not sex specific.	nucleotide binding,ubiquitin activating enzyme activity,protein binding,ATP binding,ubiquitin-like modifier activating enzyme activity,ligase activity,FAT10 activating enzyme activity	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Autism Spectrum Disorder	X A7.1|X 34.83 cM	Knockout	C57BL/6J	23542787	281	Expeimentalparadigm: Object recognition task//Anxiety-like response//Nociceptive response//Audiogenic seizure sensitivity  /n  Model Generation: Fmr1 knockout mice in a FVB background (FVB.129P2-Pde6b Tyr+c-chFmr1tm1Cgr/J) and WT mice (FVB.129P2-Pde6b Tyr+c-ch/AntJ) were purchased from The Jackson Laboratory and crossed to obtain Fmr1-/y and WT littermates. Fmr1 knockout mice in a C57BL/6J congenic background (B6.129P2-Fmr1tm1Cgr/J)4 were obtained from the Baylor College of Medicine Mouse Facility. Double-mutant mice (Fmr1-/y Cnr1+/-) in a C57BL/6J background were initially generated by crossing homozygous female mice carrying the Fmr1 mutation (Fmr1-/-) with homozygous male mice carrying the Cnr1 mutation (Cnr1-/-). Subsequently, mice used for experimentation were derived from the crossing of female Fmr1+/- Cnr1 mice with male Fmr1+/++/y Cnr1+/- mice. All experimental mice were bred in house at the Barcelona Biomedical Research Park (PRBB) Animal Facility.  /n  Rescue: Taken together, our results reveal the involvement of the ECS in specific behavioral, synaptic and molecular manifestations of FXS. We demonstrate that pharmacological or genetic blockade of CB1R normalizes some traits of FXS, such as cognitive impairment, decreased nociceptive response, increased susceptibility to audiogenic seizures and overactivation of the mTOR pathway in the hippocampus. Moreover, CB2R has an important role in the regulation of anxiolytic-like behavior and increased susceptibility to audiogenic seizures.  /n  Model Summary: We found that CB1R blockade in male Fmr1 knockout (Fmr1(-/y)) mice through pharmacological and genetic approaches normalized cognitive impairment, nociceptive desensitization, susceptibility to audiogenic seizures, overactivated mTOR signaling and altered spine morphology.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Ar	AR	protein-coding	Mus musculus	ENSMUSG00000046532	Tfm	11835	Aggressive Behaviors	X C3|X 42.82 cM	Knockout	C57BL/6J;129SvEv	23583766	282	Expeimentalparadigm: Resident-intruder test//Olfactory preference  /n  Model Generation: ARNesCre mice were initially obtained in a mixed genetic background (C57BL6/J and 129SvEv), by crossing floxed AR mice and transgenic mice expressing Cre recombinase under the control of rat nestin (Nes), as previously described (Raskin et al., 2009). This mouse line was backcrossed for at least 9 generations onto the C57BL/6J strain.  /n  Rescue: -  /n  Model Summary: We used a conditional mouse line selectively lacking AR gene in the nervous system, backcrossed onto the C57BL/6J strain. Adult males were gonadectomized and supplemented with similar amounts of testosterone. When tested on two consecutive days in the resident intruder paradigm, fewer males of the mutant group exhibited aggressive behavior compared to their control littermates. In addition, a high latency to the first offensive attack was observed for the few animals that exhibited fighting behavior. This alteration was associated with a normal anogenital chemoinvestigation of intruder males. In olfactory discrimination tasks, sexual experience enhanced preference towards female-soiled bedding rather than male-soiled bedding and estrus females rather than intact males, regardless of genotype.	transcription cis-regulatory region binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,RNA polymerase II general transcription initiation factor binding,transcription coactivator binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,chromatin binding,DNA-binding transcription factor activity,nuclear receptor activity,signaling receptor binding,steroid binding,androgen binding,protein binding,beta-catenin binding,zinc ion binding,lipid binding,enzyme binding,protein domain specific binding,ribonucleotide binding,sequence-specific DNA binding,metal ion binding,nuclear androgen receptor binding,ATPase binding,molecular adaptor activity,RNA polymerase II-specific DNA-binding transcription factor binding,POU domain binding	Ani
Homer1	HOMER1	protein-coding	Rattus norvegicus	ENSRNOG00000047014	HOMER1F|Vesl-1	29546	Attention-Deficit/Hyperactivity Disorder	2q12	Knockin	NA	23587936	283	Expeimentalparadigm: Làt maze//Morris water maze  /n  Model Generation: In the current study, we constructed a lentiviral vector containing an artificial Homer 1a-specific miRNA. This was transduced into primary neuronal cells obtained from Sprague Dawley (SD) rat cortices. The effectiveness of the RNAi was validated by detecting the mRNA and protein expressions of Homer 1a.  /n  Rescue: Homer 1a mRNA and protein expression levels were significantly decreased in the striatum for the RNAi-MPH group compared with the NC-MPH group, but there were no significant differences in the hippocampus and the PFC (Fig. 4).  /n  Model Summary: Rats that were given Homer 1a RNAi exhibited increased locomotor activity and non-selective attention, and impaired learning and memory abilities, which is in line with the behavioral findings of animal models of ADHD. However, MPH ameliorated these abnormal behaviors.	signaling receptor binding,protein binding,type 5 metabotropic glutamate receptor binding,G protein-coupled glutamate receptor binding,identical protein binding,transmembrane transporter binding,protein-containing complex binding,molecular adaptor activity,scaffold protein binding,structural constituent of postsynapse	Ani
Dnaaf4	DNAAF4	protein-coding	Rattus norvegicus	ENSRNOG00000056654	Dyx1c1|Edem2|Ekn1	363096	Developmental Dyslexia	8q24	Knockdown(shRNA)	Wistar	23594585	284	Expeimentalparadigm: Auditory testing//Morris water maze//5-choice serial reaction time test  /n  Model Generation: All surgeries were performed on embryonic day 15.5 (E15.5). In all聽Dyx1c1聽shRNA treatments, plasmids encoding聽Dyx1c1聽short hairpin RNA (pU6DyxHPB) (1.5 渭g/渭L), 0.5 渭g/渭L piggyBac-encoded red fluorescent protein (RFP), and 1 渭g/渭L piggyBac transposase were co-transfected into the fetal ventricular zone.  /n  Rescue: -  /n  Model Summary: Combined results provide important information about the impact of<U+00A0>Dyx1c1<U+00A0>on behavioral functions that parallel domains known to be affected in language impaired populations, as well as information about widespread changes to the brain following early disruption of this candidate dyslexia susceptibility gene.	protein binding,nuclear estrogen receptor binding	Ani
P2rx4	P2RX4	protein-coding	Mus musculus	ENSMUSG00000029470	D5Ertd444e|P2X4	18438	Autism Spectrum Disorder	5 F|5 62.53 cM	Knockout	C57BL/6	23604007	285	Expeimentalparadigm: Open field test//Elevated plus maze//Light-dark box test//Maternal separation-induced ultrasonic vocalization//Sticky tape removal test//Acoustic startle reflex//Prepulse inhibition of the startle//Social interaction//Novel object recognition test//Olfactory discrimination  /n  Model Generation: We used 3- to 5-month-old experimentally naive male P2X4R KO, heterozygous (HZ), and wild-type (WT) mice from breeding colonies at the University of Southern California (USC) in all behavioral studies. Generation of this line was described elsewhere (Sim et al, 2006). In brief, breeding colonies were produced by re-derivation of frozen HZ embryos obtained from an original, previously established, P2X4R KO mouse colony designed on a C57BL/6 background (Sim et al, 2006). This procedure was performed by the USC Transgenic Core and resulted in seven HZ mice, which were backcrossed to C57BL/6J mice to produce the first generation of offspring at USC. HZ offspring are backcrossed every three generations to WT C57BL/6J mice (Jackson Laboratory; Bar Harbor, ME) and maintained on a C57BL/6 background. Mice from our fifth generation were used for this study.  /n  Rescue: -  /n  Model Summary: In this study, we examined the behavioral responses of P2X4R heterozygous (HZ) and knockout (KO) mice in a variety of testing paradigms designed to assess complementary aspects of sensory functions, emotional reactivity, and cognitive organization. P2X4R deficiency did not induce significant alterations of locomotor activity and anxiety-related indices in the novel open field and elevated plus-maze tests. Conversely, P2X4R KO mice displayed marked deficits in acoustic startle reflex amplitude, as well as significant sensorimotor gating impairments, as assessed by the prepulse inhibition of the startle. In addition, P2X4R KO mice displayed enhanced tactile sensitivity, as signified by a lower latency in the sticky-tape removal test. Moreover, both P2X4R HZ and KO mice showed significant reductions in social interaction and maternal separation-induced ultrasonic vocalizations in pups. Notably, brain regions of P2X4R KO mice exhibited significant brain-regional alterations in the subunit composition of glutamate ionotropic receptors. These results collectively document that P2X4-deficient mice exhibit a spectrum of phenotypic abnormalities partially akin to those observed in other murine models of autism-spectrum disorder.	purinergic nucleotide receptor activity,extracellularly ATP-gated cation channel activity,signaling receptor binding,ion channel activity,copper ion binding,ATP binding,zinc ion binding,identical protein binding,cadherin binding,ligand-gated calcium channel activity	Ani
Drd3	DRD3	protein-coding	Mus musculus	ENSMUSG00000022705	D3R	13490	Cocaine Addiction	16 B4|16 28.44 cM	Knockout	C57BL/6J	23643749	286	Expeimentalparadigm: Conditioned place preference  /n  Model Generation: Male wild-type (WT) and D3R knocKnockoutut (D3<U+2212>/<U+2212>) mice with C57BL/6J genetic backgrounds were bred at the National Institute on Drug Abuse (NIDA) from three D3+/<U+2212><U+00A0>breeding pairs purchased from the Jackson Laboratory (Bar Harbor, ME, USA). This strain of D3<U+2212>/<U+2212><U+00A0>mice expresses a truncated D3R, including the extracellular N-terminal, the first intracellular loop and part of the second intracellular loop (a total of 148 residues), while lacking the downstream sequences from the second intracellular loop (from residue 149)  /n  Rescue: -  /n  Model Summary: D3Rs play an important role in mediating cocaine’s rewarding effects	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,protein binding,protein domain specific binding,D1 dopamine receptor binding	Ani
Slc6a1	GAT1	protein-coding	Mus musculus	ENSMUSG00000030310	A730043E01|GABATHG|GABATR|GAT-1|Gabt|Gabt1|Gat1|XT-1|Xtrp1	232333	Attention-Deficit/Hyperactivity Disorder	6|6 E3	Knockout	C57BL/6J	23656791	287	Expeimentalparadigm: Modified incentive runway task//Incentive passive avoidance//Rotarod//Parallel bars test//Locomotion test  /n  Model Generation: GAT1 knockout mice were generated as previously described [29]. Heterozygotes (gat1+/-) from chimeric mice were crossed with wild-type mice (C57BL/6J) for seven generations prior to inter-breeding to generate animal subjects for behavioral experiments.  /n  Rescue: -  /n  Model Summary: In the current study, we found that the gat1-/- mice showed low levels of attentional focusing and increased impulsivity. In addition, the gat1-/- mice displayed ataxia characterized by defects in motor coordination and balance skills. The hyperactivity in the ko mice was reduced by both methylphenidate and amphetamine. Collectively, these results suggest that GAT1 ko mouse is a new animal model for ADHD studying and GAT1 may be a new target to treat ADHD.	amino acid:sodium symporter activity,gamma-aminobutyric acid:sodium:chloride symporter activity,gamma-aminobutyric acid transmembrane transporter activity,symporter activity,sodium:chloride symporter activity,identical protein binding,metal ion binding	Ani
Htr1a	HTR1A	protein-coding	Mus musculus	ENSMUSG00000021721	Gpcr18	15550	Aggressive Behaviors	13 D1|13 56.92 cM	Overexpression	C57BL/6J;CBA/J;129S6/SvEvTac	23678112	288	Expeimentalparadigm: Open field test//Elevated-plus maze//Resident-intruder test  /n  Model Generation: Slc6a4tTA mice (EM:04891) were produced by replacing portions of exon 2 of the serotonin transporter gene starting at the initiating ATG with the coding sequence of the tetracycline transactivator protein (tTA) followed by bGH polyA sequences and an FRT-flanked neomycin resistance cassette using gene targeting in W9.5 ES cells as previously described (Audero et al., 2008). Htr1atetO mice were produced by removing the loxP-flanked neomycin resistance transcriptional stop cassette from Htr1aSTOP-tetO knock-out mice (Gross et al., 2002) as previously described (Audero et al., 2008). The Htr1atetO allele carries a tetO-CMV promoter targeted to the 5′-UTR of the endogenous Htr1a gene that mediates tTA-dependent overexpression of the receptor. Htr1aRO and control littermates were produced by breeding +/+; Htr1atetO/Htr1atetO and Slc6a4tTA/+; Htr1atetO/Htr1atetO mice. All mice were maintained on a 129S6/SvEvTac;C57BL/6;CBA background and were derived from the same breeding colony as mice used in the study by Audero et al. (2008). The Htr1aRR line was produced by crossing a line carrying a Tph2-Htr1a transgene with Htr1aKO mice (Ramboz et al., 1998). Tph2-Htr1a mice were produced by pronuclear injection in [C57BL/6JxCBA/J]xC57BL/6J embryos of a circular mouse BAC (RP23–112F24; Chori-BACPAC Resources) containing 220 kb of the Tph2 gene in which Htr1a coding sequences followed by a bovine growth hormone polyadenylation sequence and an FRT-flanked kanamycin resistance marker (FLP deleted in bacteria before DNA injection) had been inserted at the start codon of the Tph2 gene. Founders carrying the transgene were identified and genotyped by PCR, crossed to Htr1aKO mice, and maintained on a mixed C57BL/6J;CBA/J;129S6/SvEvTac background. Expression levels in two independent founder lines (Tg10 and Tg24) were similar and a mixture of the two lines was used for all behavioral experiments. Htr1aRR and control littermates were produced by breeding +/+; Htr1aKO/Htr1aKO and Tph2-Htr1a/+; Htr1aKO/Htr1aKO mice.  /n  Rescue: -  /n  Model Summary: Here, we used two pharmacogenetic approaches in transgenic mice to selectively and reversibly reduce the firing of serotonin neurons in behaving animals. Conditional overexpression of the serotonin 1A receptor (Htr1a) in serotonin neurons showed that a chronic reduction in serotonin neuron firing was associated with heightened aggression. Overexpression of Htr1a in adulthood, but not during development, was sufficient to increase aggression. Rapid suppression of serotonin neuron firing by agonist treatment of mice expressing Htr1a exclusively in serotonin neurons also led to increased aggression.	G-protein alpha-subunit binding,G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,neurotransmitter receptor activity,serotonin binding,receptor-receptor interaction	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Attention-Deficit/Hyperactivity Disorder	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	23711983	289	Expeimentalparadigm: Dipper training//Lever pressing training//Fixed-interval training//Progressive ratio test  /n  Model Generation: Wild-type female congenic C57Bl/6j mice were used for behavioral experiments (postnatal ages 90 days). D2R knockout and their C57Bl/6j WT littermates (KO)19 were used for immunohistochemical experiments.  /n  Rescue: -  /n  Model Summary: Consistent with numerous studies showing that reduced D2R signaling impairs motivated behavior, our data show that postsynaptic D2R overexpression in the NAc specifically increases an animal's willingness to expend effort to obtain a goal. Taken together, these results provide insight into the potential impact of future therapeutic strategies that enhance D2R signaling in the NAc.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Rps6ka3	RPS6KA3	protein-coding	Mus musculus	ENSMUSG00000031309	MAPKAPK-1b|MPK-9|Rsk2|S6K-alpha3|p90RSK3|pp90RSK2	110651	Autism Spectrum Disorder	X F4|X 73.27 cM	Knockout	129Sv;C57BL/6	23742761	290	Expeimentalparadigm: Delay cued fear conditioning//Consolidation and reconsolidation of contextual fear memory  /n  Model Generation: The generation of Rsk2-null mice by homologous recombination has been described previously (Yang et al., 2004). The targeting vector was constructed by inserting a neomycin resistance gene, flanked by two loxP sites and followed by three stop codons (in the three forward reading frames) in exon 2 of Rsk2. The construct was linearised and electroporated into 129 × 1/SvJ embryonic stem (ES) cells and NeoR clones were selected. The ES cells carrying the correct mutation were injected into C57BL/6J blastocysts. The resulting mixed-background 129 × 1/SvJ × C57BL/6J mice carrying a targeted allele of Rsk2 were backcrossed six times with C57BL/6J mice, before the NeoR cassette was removed by crossing with a C57BL/6J/CMV-Cre transgenic line. The resulting mutant mice carried a single loxP followed by three stop codons within exon 2. Females heterozygous for the mutation have been backcrossed for at least 20 generations to C57BL/6 males to generate Rsk2-KO and WT littermate mice used for the present study.  /n  Rescue: -  /n  Model Summary: The Coffin-Lowry syndrome (CLS) is a syndromic form of intellectual disability caused by loss-of-function of the RSK2 serine/threonine kinase encoded by the rsk2 gene. Rsk2 knockout mice, a murine model of CLS, exhibit spatial learning and memory impairments, yet the underlying neural mechanisms are unknown. In the current study, we examined the performance of Rsk2 knockout mice in cued, trace and contextual fear memory paradigms and identified selective deficits in the consolidation and reconsolidation of hippocampal-dependent fear memories as task difficulty and hippocampal demand increase.	nucleotide binding,magnesium ion binding,protein kinase activity,protein serine/threonine kinase activity,ribosomal protein S6 kinase activity,protein binding,ATP binding,kinase activity,transferase activity,protein kinase binding,cysteine-type endopeptidase inhibitor activity involved in apoptotic process	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Obsessive Compulsive Disorder	4 D2.2|4 61.33 cM	Mutated	C57BL/6J	23744950	291	Expeimentalparadigm: Grooming//Open field test//Free-feeding behavioral task  /n  Model Generation: Forty-two mice (24 Sapap3 mutants and 18 wildtype littermates, male, 3–l9 months old, C57BL6/J background) were maintained under a 12 h light/dark cycle with ad libitum food and water.  /n  Rescue: Focused optogenetic stimulation of the lateral orbitofrontal cortex and its terminals in the striatum restored the behavioral response inhibition, restored the defective down-regulation, and compensated for impaired fast-spiking neuron striatal microcircuits.  /n  Model Summary: With a delay-conditioning task, we identified in the mutants a selective deficit in behavioral response inhibition and found this to be associated with defective down-regulation of striatal projection neuron activity.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Obsessive Compulsive Disorder	4 D2.2|4 61.33 cM	Knockout	C57BL/6	23754400	292	Expeimentalparadigm: Grooming  /n  Model Generation: Mice were housed in the University of Texas Southwestern Medical Center vivarium in a temperature-controlled environment (lights on: 0600–1800) with ad libitum access to water and stan_x0002_dard chow. Mice heterogyzous for synapse-associated protein 90/ postsynaptic density protein 95-associated protein 3 (SAPAP3) and melanocortin 4 receptor (MC4R)-null alleles were bred to generate the following experimental genotypes of littermate mice: wild-type (Mc4r+/+, Sapap3+/+), SAPAP3-null (Mc4r+/+, Sapap3-/-), MC4R-null (Mc4r-/-, Sapap3+/+), and double null(Mc4r-/-, Sapap3-/-). Additionally, mice heterozygous for Sapap3 (Mc4R+/+, Sapap3+/- and Mc4r-/-, Sapap3+/-) were also used for body weight studies. Floxed-MC4R (MC4Rlox/lox) mice were generated by inserting loxP sites to flank the single exon (5′loxP site into 5′UTR), provided by Brad Lowell (Beth IsraelDeaconess Medical Center). MC4Rlox/lox mice were bred to EIIA Cre mice to produce Mc4r null mice (Mc4rdelta/delta). Mc4rdelta/delta mice were obese, with increased linear length and lean mass, similar to what has been reported for Mc4r null mice and also for the loxtb-Mc4r mice. MC4Rlox/lox mice were crossed to Sapap3-/- mice to generate Mc4rf/f, Sapap3-/- breeding pairs. All mice are in C57BL6 background.  /n  Rescue: -  /n  Model Summary: Here, we show that both constitutive and induced genetic deletion of the gene encoding the melanocortin 4 receptor (MC4R), as well as pharmacologic inhibition of MC4R signaling, normalize compulsive grooming and striatal electrophysiologic impairments in synapse-associated protein 90/postsynaptic density protein 95-associated protein 3 (SAPAP3)-null mice, a model of human obsessive-compulsive disorder.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Mc4r	MC4R	protein-coding	Mus musculus	ENSMUSG00000047259	Mc4-r|Pkcp	17202	Obsessive Compulsive Disorder	18|18 E1	Knockout	C57BL/6	23754400	293	Expeimentalparadigm: Grooming  /n  Model Generation: Mice were housed in the University of Texas Southwestern Medical Center vivarium in a temperature-controlled environment (lights on: 0600–1800) with ad libitum access to water and stan_x0002_dard chow. Mice heterogyzous for synapse-associated protein 90/ postsynaptic density protein 95-associated protein 3 (SAPAP3) and melanocortin 4 receptor (MC4R)-null alleles were bred to generate the following experimental genotypes of littermate mice: wild-type (Mc4r+/+, Sapap3+/+), SAPAP3-null (Mc4r+/+, Sapap3-/-), MC4R-null (Mc4r-/-, Sapap3+/+), and double null(Mc4r-/-, Sapap3-/-). Additionally, mice heterozygous for Sapap3 (Mc4R+/+, Sapap3+/- and Mc4r-/-, Sapap3+/-) were also used for body weight studies. Floxed-MC4R (MC4Rlox/lox) mice were generated by inserting loxP sites to flank the single exon (5′loxP site into 5′UTR), provided by Brad Lowell (Beth IsraelDeaconess Medical Center). MC4Rlox/lox mice were bred to EIIA Cre mice to produce Mc4r null mice (Mc4rdelta/delta). Mc4rdelta/delta mice were obese, with increased linear length and lean mass, similar to what has been reported for Mc4r null mice and also for the loxtb-Mc4r mice. MC4Rlox/lox mice were crossed to Sapap3-/- mice to generate Mc4rf/f, Sapap3-/- breeding pairs. All mice are in C57BL6 background.  /n  Rescue: -  /n  Model Summary: Here, we show that both constitutive and induced genetic deletion of the gene encoding the melanocortin 4 receptor (MC4R), as well as pharmacologic inhibition of MC4R signaling, normalize compulsive grooming and striatal electrophysiologic impairments in synapse-associated protein 90/postsynaptic density protein 95-associated protein 3 (SAPAP3)-null mice, a model of human obsessive-compulsive disorder.	G protein-coupled receptor activity,melanocortin receptor activity,melanocyte-stimulating hormone receptor activity,protein binding,peptide hormone binding,ubiquitin protein ligase binding,hormone binding,neuropeptide binding	Ani
Slc6a4	SLC6A4	protein-coding	Rattus norvegicus	ENSRNOG00000003476	SERT	25553	Attention-Deficit/Hyperactivity Disorder	10q24	Knockdown	Wistar-Han	23769733	294	Expeimentalparadigm: Task for impulsivity//Circadian activity cycle  /n  Model Generation: Seventeen adult male Wistar rats (400 g; for housing conditions, see Supplementary Data) were randomly assigned to experimental groups: one group received bilateral inoculation of Lenti-SERT vectors (1 μl of a mix of the three LV-siSERTs) intended to abolish the genetic expression of SERT. Inoculations were made bilaterally at coordinates AP - 3.3, ML ± 2.2, DV - 4.0 from bregma [45]. The other group (controls) received a bilateral inoculation of heat-inactivated lentiviruses (1 μl) at the same coordinates (see Supplementary Data). After surgery, rats were single-housed and left undisturbed for at least one month prior to behavioural experiments.  /n  Rescue: -  /n  Model Summary: Results show that rats inoculated with Lenti-SERT vectors exhibited less pronounced circadian peaks of activity than controls. Moreover, Lenti-SERT compared to control rats exhibited a transient increase in choice for a delayed-larger reward over an immediate-small reward. This suggests that enhanced hippocampal serotonergic transmission produced a profile of restfulness and a decrease in cognitive impulsivity. This phenotype is consistent with available data both on 5-HT manipulations and hippocampal lesions. In conclusion, present findings may possibly disclose novel avenues towards the development of innovative therapeutical approaches for behavioural symptoms relevant to ADHD.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Gngt2	GNGT2	protein-coding	Mus musculus	ENSMUSG00000038811	Hg3i	14710	Aggressive Behaviors	11 D|11 59.01 cM	Knockout	FVB/N	23836683	295	Expeimentalparadigm: Maternal aggression//Social recognition//Cookie finding//Maternal behaviour and pup retrieval  /n  Model Generation: The Gγ8 locus was targeted by homologous recombination in 129/Sv-derived embryonic stem cells using standard methods. The targeting construct (Fig. 1A) was designed to delete the entire coding region of the gene and to replace it with a tetracycline transactivator (TTA) where the starting ATG of TTA exactly replaced that of Gγ8. Approximately 5% of neomycin resistant embryonic stem cell clones were appropriately targeted. One such clone was used to generate chimeric mice by morula-aggregation. For experiments, mice carrying the targeted Gγ8 allele were back-crossed into an FVB/N background for 10 generations to obtain the Gγ8-/- mutants and wild-type littermate controls.  /n  Rescue: -  /n  Model Summary: Here, we generated mice with a targeted deletion of the Gγ8 gene and investigated the behavioural effects and the physiological consequences of this mutation. Gγ8(-/-) mice show a normal development of the main olfactory epithelium; moreover, they do not display major deficits in odour perception. In contrast, the VNO undergoes a slow but remarkable loss of basal neurons starting from the fourth postnatal week, with a 40% reduction of cells at 2 months and 70% at 1 year. This loss is associated with a reduced early-gene expression in the posterior AOB of mice stimulated with pheromones. More interestingly, the Gγ8 deletion specifically leads to a reduced pheromone-mediated aggressiveness in both males and females, all other socio-sexual behaviours remaining unaltered. This study defines a specific role for Gγ8 in maintenance of the neuronal population of the VNO and in the mechanisms of pheromonal signalling that involve the aggressive behaviour towards conspecifics.	G-protein beta-subunit binding	Ani
App	APP	protein-coding	Mus musculus	ENSMUSG00000022892	Abeta|Abpp|Adap|Ag|Cvap|E030013M08Rik|betaApp	11820	Autism Spectrum Disorder	16 C3.3|16 46.92 cM	Overexpression	C57BL/6	23840007	296	Expeimentalparadigm: Open field test//Social interaction  /n  Model Generation: TgsAPPα mice were generated at the H. Lee Moffitt Cancer Center Animal Core Facility (Tampa, FL) by standard pronuclear injection using a 1.8 kb genomic fragment transcribing hsAPP-伪695 sub-cloned into a MoPrP.Xho vector (Bailey et al., 2012)  /n  Rescue: -  /n  Model Summary: Transgenic mice engineered to overexpress human sAPPα (TgsAPPα mice) displayed hypoactivity, impaired sociability, increased brain glial fibrillary acidic protein (GFAP) expression, and altered Notch1 and IL-6 levels.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,G protein-coupled receptor binding,chromatin binding,serine-type endopeptidase inhibitor activity,signaling receptor binding,frizzled binding,insulin receptor binding,integrin binding,protein binding,heparin binding,peptidase activator activity,enzyme binding,peptidase inhibitor activity,signaling receptor activator activity,acetylcholine receptor binding,apolipoprotein binding,chemoattractant activity,identical protein binding,protein homodimerization activity,ion binding,heparan sulfate proteoglycan binding,metal ion binding,ephrin receptor binding,transition metal ion binding,protein heterodimerization activity,protein dimerization activity,low-density lipoprotein particle receptor binding,RAGE receptor binding,chaperone binding,PTB domain binding,growth factor receptor binding	Ani
Nrxn1	NRXN1	protein-coding	Mus musculus	ENSMUSG00000024109	1700062G21Rik|9330127H16Rik|A230068P09Rik|mKIAA0578	18189	Autism Spectrum Disorder	17|17 E5	Knockout	C57BL/6J	23840597	297	Expeimentalparadigm: Homecage task//Open field test//Light-dark box//Elevated plus maze//Novel object discrimination//Morris water maze//Delayed matching-to-place//Three-chamber social approach task//Social investigation task//Grooming behaviours//Nesting behaviours//Buried food task  /n  Model Generation: α-Neurexin KO mice were generated by deleting the large first exons of the murine α-neurexin genes23, maintained on a mixed SV129/C57bl6 background, and genotyped by polymerase chain reaction13,46 (see Supplementary text and Fig. S1 for the structure of the KO vectors and the breeding and analysis strategies). Since these mice were previously maintained on a C57BL6/SV129 mixed genetic background, we subjected the line to 8 generations of backcrossing to C57BL/6J mice to transfer the knockout allele onto a standard C57BL/6J genetic background.  /n  Rescue: -  /n  Model Summary: In homozygous Nrxn1α KO mice, we observed altered social approach, reduced social investigation, and reduced locomotor activity in novel environments. In addition, male Nrxn1α KO mice demonstrated an increase in aggressive behaviours.	transmembrane signaling receptor activity,signaling receptor binding,type 1 fibroblast growth factor receptor binding,calcium channel regulator activity,calcium ion binding,protein binding,acetylcholine receptor binding,protein-containing complex binding,metal ion binding,calcium-dependent protein binding,cell adhesion molecule binding,neuroligin family protein binding	Ani
Cnr2	CNR2	protein-coding	Mus musculus	ENSMUSG00000062585	CB-2|CB2|CB2-R	12802	Alcohol Use Disorder	4|4 D3	Knockout	C57BL/6J;CD1	23855434	298	Expeimentalparadigm: Conditioned place preference//Voluntary ethanol consumption//Oral ethanol self administration//Two-bottle choice paradigm  /n  Model Generation: Male CB2KO mice on a C57BL/6J congenic background (kindly provided by Nancy E. Buckley, Cal State Polytechnic Univ., Pomona, CA, USA) were crossed with outbreed CD1 (Charles River, Lille France) background (Buckley<U+00A0>et<U+2009>al.<U+00A0>2000) for eight generations. CB2KO homozygote and their corresponding WT littermates (25–35<U+2009>g, 6–8 weeks) were used. In addition, CB2KO mice on a C57BL/6J congenic background (CNR2) and their corresponding WT controls were purchased from Jackson Laboratory (Bar Harbor, ME, USA) to replicate the ethanol self-administration procedure  /n  Rescue: -  /n  Model Summary: These results suggest that deletion of the CB2r gene increased preference for and vulnerability to ethanol consumption, at least in part, by increased ethanol-induced sensitivity of the TH and 渭-opioid receptor gene expressions in mesolimbic neurons.	G protein-coupled receptor activity,cannabinoid receptor activity	Ani
mecp2	MECP2	protein-coding	Zebrafish	ENSDARG00000014218	wu:fk96a04|zgc:111857	335250	Neurodevelopmental Disorders	-	Mutated(TILLING Mutant)	AB	23874272	299	Expeimentalparadigm: Motor behaviors  /n  Model Generation: AB adult, larva, and embryo zebrafish, from the University of Oregon Zebrafish Facility, were maintained at 28.5°C on a 14–10 h on/off light cycles at the Institut de Biologie de l'Ecole Normale Supérieure zebrafish facility. Embryos and larvae were grown accordingly to Westerfield (2000). All experimental procedures were performed at room temperature (21–23°C). Zebrafish mecp2Q63* mutation was generated through N-ethyl-N-nitrosourea (ENU)-mutagenesis and selected by TILLING as previously described (Draper et al., 2004). As ENU-mutagenesis generates random mutations throughout the genome, heterozygote mecp2 mutant fish were outcrossed several times in the AB background to remove off-target mutations. Mutant fish were identified by PCR using DNA extracted from fin clip (the primers 5′-AAAGGAAAGGCATGATGTGG-3′ and 5′-GTATCGCCAACCTTTTGGAA-3′ flank the position of the mutation), followed by sequencing. To keep the closest genetic background between different genotypes in the experiments, heterozygote mecp2 mutant embryos and larvae were generated by outcrossing homozygote mecp2 mutants with AB wild-type fish. Wild-type, heterozygote and homozygote mecp2 mutant fish are, respectively, labeled WT, Het, and Mut in the figures. Morphological assessment of aged-matched wild-type, homozygote and heterozygote mecp2 mutant embryos and larvae did not reveal any difference, indicating that the rate of development is similar in the three groups of embryos and larvae. Accordingly, we used hours post fertilization (hpf) and days post fertilization (dpf) to stage embryos and larvae, respectively.  /n  Rescue: -  /n  Model Summary: Here, we present the first mecp2-null allele mutation zebrafish model. Surprisingly and in contrast to MeCP2-null mouse models, mecp2-null zebrafish are viable and fertile. They present nonetheless clear behavioral alterations during their early development, including spontaneous and sensory-evoked motor anomalies, as well as defective thigmotaxis.	DNA binding,chromatin binding,DNA-binding transcription factor activity,methyl-CpG binding,double-stranded methylated DNA binding	Ani
Cnr1	CNR1	protein-coding	Mus musculus	ENSMUSG00000044288	CB-R|CB1|CB1A|CB1B|CB1R	12801	Aggressive Behaviors	4 A5|4 16.28 cM	Knockout	NA	23916480	300	Expeimentalparadigm: Delayed reinforcement task//Social encounters  /n  Model Generation: Mice lacking the CB1 receptor were obtained as described previously (Ledent et al., 1999). The CB1 gene was cloned from a 129/Sv mouse genomic library, and the single coding exon was mapped and sequenced (EMBL/GenBank ). A PGK-Neo cassette was inserted between Avr II and Sfi I sites located 1073 base pairs apart, replacing the first 233 codons of the gene. Homologous recombination in R1 cells and aggregation with CD1 eight–cell stage embryos were performed as described.  /n  Rescue: -  /n  Model Summary: This study examined the role of cannabinoid CB1 receptors (CB1r) in aggressive behavior. Social encounters took place in grouped and isolated mice lacking CB1r (CB1KO) and in wild-type (WT) littermates. Cognitive impulsivity was evaluated in the delayed reinforcement task (DRT). Gene expression analyses of monoaminooxidase-A (MAO-A), catechol-o-methyl-transferase (COMT), 5-hydroxytriptamine transporter (5-HTT) and 5-HT1B serotonergic receptor (5HT1Br) in the median and dorsal raphe nuclei (MnR and DR, respectively) and in the amygdala (AMY) were performed by real time-PCR. Double immunohistochemistry studies evaluated COMT and CB1r co-localization in the raphe nuclei and in the cortical (ACo), basomedian (BMA) and basolateral (BLA) amygdaloid nuclei. The behavioral effects of the CB1r agonist ACEA (1 and 2 mg/kg) on aggression were also evaluated in isolated OF1 mice. CB1KO mice housed in groups showed higher levels of offensive aggression. Isolation increased aggressive behavior only in WT.	G protein-coupled receptor activity,cannabinoid receptor activity,identical protein binding	Ani
Grm5	GRM5	protein-coding	Mus musculus	ENSMUSG00000049583	6430542K11Rik|Glu5R|Gprc1e|mGluR5|mGluR5b	108071	Attention-Deficit/Hyperactivity Disorder	7|7 D3	Knockout	C57BL/6J	23940572	301	Expeimentalparadigm: Elevated Plus maze test//Open field test//Acoustic startle and prepulse inhibition//Homecage//Rotarod Test//Parallel rod footslip test//Pavlovian conditioned fear test//Light-dark box test//Marble burying//Three Chamber Social Test  /n  Model Generation: mGluR5 floxed (mGluR5f/f) mice in a mixed 129 SVJ and C57BL/6 background (129/C57) were generated as described in Xu et al., (2009) [48]. NEX-Cre mice in a mixed 129 SVJ and C57BL/6 background were generated by knocking the Cre gene into the NEX locus [49]. NEX-Cre/+;mGluR5f/f males were mated with mGluR5f/f females to produce NEX-Cre/+;mGluR5f/f (Cx-mGlu5 KO) and +/+;mGluR5f/f; (control) mice. To minimize the effects of mixed genetic background, littermate controls were used for all experiments. Furthermore, 129 SVJ inbred mice are known for their high innate anxiety levels [50], [51]. Therefore, Cx-mGlu5 KO mice in the low anxiety C57BL/6 background (C57) were generated for use in selected experiments as follows: Mice from the original mGluR5f/f were back-crossed with C57BL/6 mice for eight generations. NEX-Cre/+ mice were backcrossed into C57BL/6 background for five generations. The congenic strains produced after back-crossing were crossed to generate NEX-Cre/+;mGluR5f/f and +/+; mGluR5f/f mice.  /n  Rescue: -  /n  Model Summary: These cortical glutamatergic mGluR5 knockout mice exhibit increased novelty-induced locomotion, and their locomotion can be further enhanced by treatment with the psychostimulant methylphenidate. Despite a modest reduction in repetitive behaviors, cortical glutamatergic mGluR5 knockout mice are normal in sensorimotor gating, anxiety, motor balance/learning and fear conditioning behaviors. These results show that mGluR5 signaling in cortical glutamatergic neurons is required for precisely modulating locomotor reactivity to a novel environment but not for sensorimotor gating, anxiety, motor coordination, several forms of learning or social interactions.	PLC activating G protein-coupled glutamate receptor activity,adenylate cyclase inhibiting G protein-coupled glutamate receptor activity,G protein-coupled receptor activity,protein binding,glutamate receptor activity,A2A adenosine receptor binding,identical protein binding,G protein-coupled receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,protein tyrosine kinase binding	Ani
DAT	SLC6A3	protein-coding	Drosophila melanogaster		CG8380|Dat|DmDAT|Dmel\CG8380|Fumin|dDAT|dat|fmn|fumin	36849	Autism Spectrum Disorder	53C7-53C8|2-80 cM	Knockout	Bloomington Indiana<U+00A0>(BI) 6326	23979605	302	Expeimentalparadigm: Locomotion test  /n  Model Generation: Drosophila<U+00A0>homozygotes for the DAT null allele<U+00A0>DATfmn<U+00A0>(dDAT KO)65<U+00A0>and flies harboring TH-Gal466<U+00A0>were outcrossed to a control line (Bloomington Indiana (BI) 6326) and selected by PCR or eye color. TH-GAL4 (Bl 8848) and M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP'} ZH-22A (Bl 24481) were obtained from the BI stock center and outcrossed to dDAT KO flies carrying the<U+00A0>white<U+00A0>(w1118) mutation (BI stock number 6236) for 5–10 generations. Transgenes (hDAT or hDAT T356M) were cloned into pBI-UASC67<U+00A0>and constructs were injected into embryos from M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP'}ZH-22A (Bl 24481). Initial potential transformants were isolated and selected.  /n  Rescue: -  /n  Model Summary: In<U+00A0>Drosophila melanogaster, expression of hDAT T356M in DA neurons lacking<U+00A0>Drosophila<U+00A0>DAT leads to hyperlocomotion, a trait associated with DA dysfunction and ASD. Taken together, our findings demonstrate that alterations in DA homeostasis, mediated by aberrant DAT function, may confer risk for ASD and related	dopamine:sodium symporter activity,cocaine binding	Ani
Ncam1	NCAM1	protein-coding	Mus musculus	ENSMUSG00000039542	CD56|E-NCAM|NCAM-1|Ncam	17967	Aggressive Behaviors	9 A5.3|9 26.83 cM	Conditional Knockout	C57BL/6J	24010949	303	Expeimentalparadigm: Elevated plus maze//Bedding preference test//Open field test//Resident-intruder test  /n  Model Generation: All experiments were conducted on age-matched (13–15 months) conditional NCAM-deficient male mice (NCAMff+, further referred to as “NCAM-cKO”) and their wild-type littermates (NCAMff-, further referred to as “WT”) derived from in-house breeding at the animal facility of the école Polytechnique Fédérale de Lausanne (EPFL). The generation of these conditional NCAM-deficient mice has been previously described (Bukalo et al., 2004). Briefly, homozygous NCAM-floxed females were bred with homozygous NCAM-floxed males expressing cre-recombinase under the control of the promoter of the α-subunit of the calcium–calmodulin-dependent protein kinase II (αCaMKII). The offspring were homozygous for the NCAM-floxed alleles, with approximately 50% carrying the αCaMKII-cre transgene; the remainder were wild-type littermates. All mice were backcrossed for more than 10 generations to the C57BL/6J background.  /n  Rescue: -  /n  Model Summary: In this study, we investigated the potential interplay of a forebrain-specific postnatal NCAM deletion and exposure to different lengths of repeated stress (i.e. subchronic: 14 days; chronic: 29 days) on aggressive and emotional behavior. Our results show that postnatal deletion of NCAM in the forebrain leads to increased aggression and altered emotionality depending on the duration of stress, whereas conditional NCAM knockout has no basal impact on these behaviors. These findings support the involvement of NCAM in the regulation of emotional and aggressive behaviors, suggesting that diminished NCAM expression might be a critical vulnerability factor for the development of these behavioral alterations under repeated exposure to stress.	protein binding,heparin binding,phosphatase binding,LRR domain binding	Ani
22q11.2	22q11.2	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Chromosome Engineering	C57BL/J46J;Df(16)A+/-	24027283	304	Expeimentalparadigm: Novel object recognition test//Latent inhibition assay  /n  Model Generation: Using chromosomal engineering23,24,25, we generated a mouse model carrying a hemizygous 1.3-Mb chromosomal deficiency (Df(16)A+/-), ranging from Dgcr2 to Hira (Supplementary Fig. 1), that spans a segment syntenic to the 1.5-Mb human 22q11.2 microdeletion and encompasses 27 genes. Almost all of the functional genes in the human segment are represented in the mouse segment, organized in a slightly different order. Df(16)A+/- mice did not show any gross anatomical brain abnormalities (data not shown), but they showed deficits in synaptic connectivity in the hippocampus that included a reduction in the number and size of dendritic spines, as well as a decrease in dendritic complexity of CA1 pyramidal neurons (J. Mukai, A. Dhilla, L.J. Drew, K.L.S., L. Cao, et al., unpublished data).  /n  Rescue: -  /n  Model Summary: We used a mouse model of the schizophrenia-predisposing 22q11.2 microdeletion to evaluate how this genetic lesion affects cortical neural circuits at the synaptic, cellular, and molecular levels. Guided by cognitive deficits, we demonstrated that mutant mice display robust deficits in high-frequency synaptic transmission and short-term plasticity (synaptic depression and potentiation), as well as alterations in long-term plasticity and dendritic spine stability. We confirmed the pronounced DiGeorge critical region 8 (Dgcr8)-dependent deficits in primary micro-RNA processing and identified additional changes in gene expression and RNA splicing that may underlie the effects of this mutation. Reduction in Dgcr8 levels appears to be a major driver of altered short-term synaptic plasticity in prefrontal cortex and working memory but not of long-term plasticity and cytoarchitecture.	NA	Ani
Dcx	DCX	protein-coding	Mus musculus	ENSMUSG00000031285	Dbct	13193	Aggressive Behaviors	X|X F2	Knockout	C57BL/6J	24073232	305	Expeimentalparadigm: Barnes circular maze//Fear conditioning test//Contextual and auditory-cue fear conditioning//Paired associate learning  /n  Model Generation: Dcx mutant mice were maintained on the C57BL/6J (B6) background following more than 10 generations of backcrosses. All animals were produced and genotyped as previously described [12]. Homozygote, hemizygote and heterozygote Dcx mutant mice were maintained on C57BL/6 and Sv129Pas backgrounds. Mice were genotyped at postnatal day 10 (P10) or at embryonic stages by either Southern blotting or polymerase chain reaction (PCR) following standard methods (50). The KO mice studied here were generally DcxY/- males on a defined background, generated in most cases with WT littermate controls by crossing heterozygote females with pure C57BL/6 or Sv129Pas males (Charles River, France). Such crosses were preferred because of the ease of generating WT littermate controls (50% of the litter), with heterozygotes (25%) and KO animals (25%) in the same litter.  /n  Rescue: -  /n  Model Summary: Dcx-KO mice also exhibit interneuron abnormalities. As well as the interest of testing their general neurocognitive profile, Dcx-KO mice also provide a relatively unique model to assess the effects of a disorganized CA3 region on learning and memory. Based on its prominent anatomical and physiological features, the CA3 region is believed to contribute to rapid encoding of novel information, formation and storage of arbitrary associations, novelty detection, and short-term memory. We report here that Dcx-KO adult males exhibit remarkably preserved hippocampal- and CA3-dependant cognitive processes using a large battery of classical hippocampus related tests such as the Barnes maze, contextual fear conditioning, paired associate learning and object recognition. In addition, we show that hippocampal adult neurogenesis, in terms of proliferation, survival and differentiation of granule cells, is also remarkably preserved in Dcx-KO mice. In contrast, following social deprivation, Dcx-KO mice exhibit impaired social interaction and reduced aggressive behaviors.	protein binding,microtubule binding,protein kinase binding	Ani
Grm2	GRM2	protein-coding	Mus musculus	ENSMUSG00000023192	4930441L02Rik|Gprc1b|mGluR2|mGluR7	108068	Alcohol Use Disorder	9|9 F1	Knockout	ICR;C57BL/6;	24082084	306	Expeimentalparadigm: Two-bottle choice paradigm  /n  Model Generation: DNA fragments containing mouse mGlu2 and mGlu3 receptor coding regions were isolated from a 129SVJ genomic library. In both cases, an expression cassette of the neomycin resistance gene (Neo) was inserted into the third exon (Figs.<U+00A0>1,<U+00A0>2). Since exon 3 encodes a large portion of the ligand-binding domain for both the mGlu2 and mGlu3 receptors, its disruption was anticipated to inactivate the resulting mutated receptors. Each targeting construct was injected into the R1 line of mouse embryonic stem cells. The homologous recombinants were confirmed by Southern hybridization analysis (data not shown) and these embryonic stem cells were injected into murine C57Bl/6 blastocysts. The resulting chimeric males were mated with ICR(CD-1) females. Male offspring carrying the null allele were backcrossed for three generations (N3) with ICR(CD-1) females.  /n  Rescue: -  /n  Model Summary: Our strategy led to the identification of<U+00A0>Grm2<U+00A0>as a locus influencing alcohol preference. Loss of metabotropic glutamate receptor 2 (mGluR2) function contributes to elevated alcohol consumption.	adenylate cyclase inhibiting G protein-coupled glutamate receptor activity,group II metabotropic glutamate receptor activity,G protein-coupled receptor activity,calcium channel regulator activity,scaffold protein binding	Ani
Fev	FEV	protein-coding	Mus musculus	ENSMUSG00000055197	Pet-1|Pet1|Pex1|mPet-1	260298	Posttraumatic Stress Disorder	1|1 C4	Knockout	C57BL/6J	24100022	307	Expeimentalparadigm: Open field test//Elevated plus maze//Light-dark box test//Pavlovian fear conditioning and extinction//Home cage activity//Forced swim test  /n  Model Generation: Mouse<U+00A0>Pet-1<U+00A0>genomic clones were obtained by screening a bacteriophage lambda library constructed with 129Sv DNA (Stratagene). Three overlapping clones were identified and the locus was partially sequenced. Comparison with the rat<U+00A0>Pet-1<U+00A0>cDNA sequence was used to deduce the intron-exon structure. Sequences upstream and downstream of the coding region were cloned into a targeting construct designed to remove the entire<U+00A0>Pet-1<U+00A0>protein coding sequence by homologous recombination using standard selection cassettes. Several rounds of electroporation and G418 selection were performed on R1 ES cells.  /n  Rescue: -  /n  Model Summary: Pet-1<U+00A0>Knockout mice exhibited increased acquisition and expression of fear, and elevated fear recovery following extinction, relative to wild-type (WT). BLA dendrites of<U+00A0>Pet-1<U+00A0>Knockout mice were significantly longer than in WT.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,double-stranded DNA binding,DNA-binding transcription factor activity,sequence-specific DNA binding,sequence-specific double-stranded DNA binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Manic Episodes	15|15 E3	Overexpression	FVB/N;C57BL/6J	24153177	308	Expeimentalparadigm: Open field//Home-cage activity//Tail suspension test//Startle response and prepulse inhibition//Circadian rhythms//Three-chamber test//Grooming//Ultrasonic vocalization  /n  Model Generation: To generate<U+00A0>Shank3<U+00A0>transgenic mice, we used a BAC clone (RP23-278D8) containing a segment of mouse chromosome 15. This BAC clone was modified by recombineering techniques46<U+00A0>to insert Kozak sequence (ACCATGG) followed by EGFP sequence (cloned from pEGFP-C1) at the first start codon of<U+00A0>Shank3<U+00A0>gene (exon 1). The modified BAC clone was double digested with NotI/SwaI, and the ~75 kb linearized segment with entire<U+00A0>Shank3<U+00A0>gene plus ~12 kb 5’ and ~2 kb 3’ was injected into the FVB/N embryos  /n  Rescue: The mood-stabilizing drug valproate, but not lithium, rescues the manic-like behavior of<U+00A0>Shank3<U+00A0>transgenic mice<U+00A0>  /n  Model Summary: SHANK3<U+00A0>overexpression causes manic-like behavior with unique pharmacogenetic properties	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
chd2	CHD2	protein-coding	Zebrafish	ENSDARG00000060687	si:ch211-196l7.5	569795	Neurodevelopmental Disorders	-	Knockdown(MO)	AB	24207121	309	Expeimentalparadigm: Motor behaviors  /n  Model Generation: To establish additional evidence of the implication of CHD2 in the development of epilepsy, we examined the functional consequence of CHD2 haploinsufficiency by knocking down chd2 in zebrafish by using targeted morpholino (MO) antisense oligomers.24In order to mimic loss-of-function mutations, we designed a MO (E2I2 MO, 5′-GATCAGACTGGCCTTTTTGTGTACC-3′) to target the splice donor site of exon 2 and interfere with normal pre-mRNA splicing of zebrafish chd2 (ENSDART00000127730). Targeting of the exon 2-intron 2 boundary should result in abnormal exon 2 splicing, leading to its complete or partial deletion together with its flanking introns. This should result in an mRNA shorter than the wild-type transcript (Figure 1). A control MO (randomized 25 N oligomer) was used as a negative control (ctrl MO). All MOs were designed and synthesized by GeneTools. Gene knockdowns were achieved through microinjection of MOs into 1- to 2-cell-stage embryos from the AB (wild-type) strain according to the method previously described.25 In order to mimic haploinsufficiency, we titrated the amount of E2I2 MO to 9 ng per injection so as to reduce correctly spliced chd2 mRNA levels by approximately 50%. The same amount of ctrl MO was injected into sibling control embryos. To evaluate the level of knockdown in zebrafish embryos and larvae, we performed qPCR on splice-blocked pre-mRNA.  /n  Rescue: -  /n  Model Summary: To explore the functional relevance of CHD2 haploinsufficiency in an in vivo model system, we knocked down chd2 in zebrafish by using targeted morpholino antisense oligomers. chd2-knockdown larvae exhibited altered locomotor activity, and the epileptic nature of this seizure-like behavior was confirmed by field-potential recordings that revealed epileptiform discharges similar to seizures in affected persons.	nucleotide binding,DNA binding,DNA helicase activity,chromatin binding,ATP binding,hydrolase activity,ATP hydrolysis activity,histone binding,ATP-dependent chromatin remodeler activity	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Conditional Knockout	129 s6 SvEv Tac;C57BL/6	24259569	310	Expeimentalparadigm: Elevated plus maze//Light-dark box test//Open field test//Locomotor//Grooming//Three-chamber test//Marble burying test//Rotarod//Social interaction with a juvenile//Nest building test//Morris water maze//Visible water maze//Paired-pulse inhibition//Startle threshold//Footshock sensitivity//Hot plate test  /n  Model Generation: The<U+00A0>Shank3<U+00A0>targeting construct was designed to delete exon 21 with Cre-mediated excision. To “flox” exon 21,<U+00A0>Shank3<U+00A0>bacterial artificial chromosome DNA clone (Geneservice) was modified using standard recombineering technology. The final targeting construct had two homology arms of 6.0 and 1.7 kb, respectively. To identify targeted ES cells by PCR screen, a PCR control vector was constructed, which retains the Neo cassette and the short homology arm present in the targeting vector and additional<U+00A0>Shank3<U+00A0>genomic sequence contiguous to the short arm. The targeting construct was electroporated into ES cells (129 s6 SvEv Tac background) and ES clones were selected for G418 resistance.The positive ES clones were then injected into blastocysts (C57BL/6 strain) to generate chimeras at the Transgenic Facility of Johns Hopkins University School of Medicine. The chimeric mice were bred with C57BL/6 mice to confirm germ-line transmission of floxed Shank3  /n  Rescue: -  /n  Model Summary: These mice exhibit a decrease in NMDA/AMPA excitatory postsynaptic current ratio in area CA1 of the hippocampus, reduced long-term potentiation in area CA1, and deficits in hippocampus-dependent spatial learning and memory. In addition, these mice also exhibit motor-coordination deficits, hypersensitivity to heat, novelty avoidance, altered locomotor response to novelty, and minimal social abnormalities.<U+00A0>	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Kcnma1	KCNMA1	protein-coding	Mus musculus	ENSMUSG00000063142	5730414M22Rik|BKCA alpha|BKCa|KCa1.1|MaxiK|Slo|Slo1|k(VCA)alpha|mSlo|mSlo1|slo-alpha	16531	Autism Spectrum Disorder	14|14 A3	Knockout	129Sv;C57BL/6	24303038	311	Expeimentalparadigm: Hearing measurements//Auditory brainstem responses//Grip force test//Cat walk//Open field test//Acoustic startle reflex//Prepulse inhibition//Y-maze//Water maze  /n  Model Generation: We used mice of the F1 generation of a hybrid SV129/C57BL6 line with deficient BK channel function. BK channel function was abolished by deleting the slo1 gene which encodes the pore forming channel protein (α-subunit; for details see [23]).  /n  Rescue: -  /n  Model Summary: In the present study we investigate the effects of functional BK channel deletion on cognition using a genetic mouse model with a knock-out of the gene for the pore forming α-subunit of the channel. We tested the F1 generation of a hybrid SV129/C57BL6 mouse line in which the slo1 gene was deleted in both parent strains. We first evaluated hearing and motor function to establish the suitability of this model for cognitive testing. Auditory brain stem responses to click stimuli showed no threshold differences between knockout mice and their wild-type littermates. Despite of muscular tremor, reduced grip force, and impaired gait, knockout mice exhibited normal locomotion. These findings allowed for testing of sensorimotor gating using the acoustic startle reflex, as well as of working memory, spatial learning and memory in the Y-maze and the Morris water maze, respectively. Prepulse inhibition on the first day of testing was normal, but the knockout mice did not improve over the days of testing as their wild-type littermates did. Spontaneous alternation in the y-maze was normal as well, suggesting that the BK channel knock-out does not impair working memory. In the Morris water maze knock-out mice showed significantly slower acquisition of the task, but normal memory once the task was learned.	actin binding,ion channel activity,voltage-gated ion channel activity,voltage-gated potassium channel activity,potassium channel activity,protein binding,calcium-activated potassium channel activity,identical protein binding,protein-containing complex binding,metal ion binding,large conductance calcium-activated potassium channel activity,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential	Ani
Elfn1	ELFN1	protein-coding	Mus musculus	ENSMUSG00000048988	A930017N06Rik|Ppp1r28	243312	Attention-Deficit/Hyperactivity Disorder	5|5 G2	Knockout	C57BL/6	24312227	312	Expeimentalparadigm: Wire hang test//Open field test  /n  Model Generation: Digoxigenin-labelled antisense cRNA probes for in situ hybridisation of Elfn1 were designed to encompass a section of coding sequence and 3′UTR >500bp in length. Briefly this involved TA cloning of PCR products into the TOPO vector (Invitrogen) and simultaneous synthesis and Dig-labelling of RNA transcripts from linearised vector using T7- or Sp6- RNA polymerase. Detailed information on probes is available upon request. In situ hybridisation was carried out on vibratome-sectioned C57Bl6 mouse brains (Jackson Laboratories).  /n  Rescue: -  /n  Model Summary: Elfn1 mutant mice exhibit seizures, subtle motor abnormalities, reduced thigmotaxis and hyperactivity. The hyperactivity is paradoxically reversible by treatment with the stimulant amphetamine, consistent with phenotypes observed in animals with habenular lesions. These analyses reveal a requirement for Elfn1 in brain function and are suggestive of possible relevance to the etiology and pathophysiology of epilepsy and attention-deficit hyperactivity disorder.	protein phosphatase inhibitor activity	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockin	C57BL/6J	24332984	313	Expeimentalparadigm: Irwin test  /n  Model Generation: Transgenic mice were produced using a linearized construct, where 5′ and 3′ arms were derived from 129S6 genomic DNA that was mutated in the 5′ arm to encode Val at amino acid 559 by oligonucleotide mediated site-directed mutagenesis (Stratagene Quik-Change Mutagenesis Kit, Agilent Technologies, Santa Clara, CA). Our construct includes self-excising Cre recombinase and neomycin-resistance cassettes for positive selection and a thymidine kinase cassette for negative selection. The construct was electroporated into 129S6/SvEvTac-derived embryonic stem cells (TL-1) and successful homologous recombination was confirmed by Southern blotting, with the presence of the Val559 substitution confirmed directly by Sanger sequencing. Targeted stem cells were then injected into C57BL/6J blastocysts and implanted in pseudo-pregnant females. Chimeric offspring were mated with WT C57BL/ 6J mice to test for germline transmission of the DAT Val559 allele.  /n  Rescue: -  /n  Model Summary: Currently, the animal models of ADHD exhibit significant limitations, stemming in large part from their lack of construct validity. To remedy this situation, we have pursued the creation of a mouse model derived from a functional nonsynonymous variant in the DAT gene (SLC6A3) of ADHD probands. We trace our path from the identification of these variants to in vitro biochemical and physiological studies to the production of the DAT Val559 mouse model. We discuss our initial findings with these animals and their promise in the context of existing rodent models of ADHD.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Drd1	DRD1	protein-coding	Rattus norvegicus	ENSRNOG00000023688	D1a|Drd-1|Drd1a	24316	Bipolar Disorder	17p14	Overexpression	Sprague Dawley	24408208	314	Expeimentalparadigm: Place conditioning//Delayed discounting//Elevated plus maze//Locomotor activity and novelty preference test//Sucrose and sacharin preference test  /n  Model Generation: Sprague Dawley rats were obtained from Charles River Laboratories (Boston, MA). All cloning experiments were based on standard molecular biological techniques. Virus production, concentration by ultracentrifugation, and qRT-PCR-based titering were performed according to published protocols (Sastry et al. 2002; Seo et al. 2004). Average virus titers were 106 – 107 transducing units per μl. Rats were anesthetized with a ketamine/xylazine mixture (80/12 mg/kg, respectively) and received 0.6 μl of virus (106 – 107 transducing units per μl) bilaterally into the plPFC at stereotaxic coordinates (AP +2.8, ML: 0.4; DV: -2.7). Assessments began between 5–10 days after surgery to allow for viral expression. Expression was stable throughout all experiments and placement within the plPFC was confirmed by histology (Figure 1). Subjects were virus was detected within the infralimbic PFC were excluded from the analyses.  /n  Rescue: -  /n  Model Summary: Virally mediated D1 over-expression in adults leads to stronger drug-cue associations and greater consumption of sweet solutions, elevates bias towards immediate satisfaction rather than delaying gratification, decreases anxiety, and causes rats to work harder for and take more cocaine. Furthermore, elevated cortical D1 reduces D2 receptors in the accumbens (a putative risk marker).	dopamine neurotransmitter receptor activity, coupled via Gs,G-protein alpha-subunit binding,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,protein binding,protein phosphatase binding,neurotransmitter receptor activity,angiotensin receptor binding,D3 dopamine receptor binding,dopamine binding,protein-containing complex binding,ATPase binding,heterocyclic compound binding	Ani
Hey1	HEY1	protein-coding	Mus musculus	ENSMUSG00000040289	CHF2|HRT1|Herp2|Hesr1|bHLHb31|hesr-1	15213	Aggressive Behaviors	3 A1|3 2.15 cM	Knockout	C57BL/129Svj	24431082	315	Expeimentalparadigm: Novel-cage test//Home-cage test//Open field test//Light–dark box test//Elevated plus maze//Resident–intruder test//Rotarod//Startle response and prepulse inhibition test//Hotplate test//Tail-flick test  /n  Model Generation: To disrupt the hesr1 gene, a targeting vector was constructed with a complete deletion of the bHLH region from exon1 through exon4, (see Supplementary Figure) using hesr1 containing BAC clones derived from the RPCI-22 mouse BAC library (BACPAC resources, CA). The targeting vector was then electroporated into AB1 embryonic stem (ES) cells. Colonies resistant to both neomycin (positive selection) and FIAU (negative selection) were screened by Southern blotting to identify correctly targeted clones. The recombinants were subsequently injected into C57B1/6 blastocysts to generate chimeras. Two independent lines were finally obtained that transmitted the targeted allele through the germ line. For genotyping, a PCR method was developed to detect wild-type alleles, using a 3′ forward: CCCTCCCCTCCGTGCTTCTAACCTCAT/3′ reverse: CTCTCCCCACCCCACAAAGCAAAGCAG, primer set, and for the targeted allele a 3′ reverse/Neo: CGACCACCAAGGCGAAACATC primer set. The neo cassette was removed by crossing the mice with CAG-Cre mice and the genotype was determined using the 3′ reverse/lacZ: CTCTGTGTCCTCATAAACCCTAACCTCCTT primer set. Mice containing a disrupted hesr2 gene have been described in a separate manuscript (Kokubo et al., 2004).  /n  Rescue: -  /n  Model Summary: In the present study, we investigated the effects of Hesr1 and Hesr2 on behavior. A behavioral test battery to examine spontaneous activity, anxiety-like behavior, aggressive behavior, pain sensitivity, and sensorimotor gating was conducted in Hesr1 and Hesr2 knockout (KO) mice. Enhanced prepulse inhibition (PPI), which is a form of sensorimotor gating, was observed in only Hesr1 KO mice; other behavioral traits were mostly comparable to wild-type animals in both the Hesr1 and the Hesr2 KO lines. Next, we used a dopamine agonist, apomorphine, to confirm the involvement of the dopaminergic system. Injection of apomorphine reduced the enhanced PPI in Hesr1 KO mice. Additionally, dose-dependent sensitivity to the agonist was lower in the Hesr1 KO mice than in wild-type mice, suggesting that the enhanced PPI resulted from this alteration in dopamine sensitivity. Furthermore, DAT mRNA was downregulated in Hesr1 KO mice, whereas the dopamine D1 and D2 receptors were comparable.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,identical protein binding,sequence-specific DNA binding,protein dimerization activity,RNA polymerase II-specific DNA-binding transcription factor binding,sequence-specific double-stranded DNA binding	Ani
Hey2	HEY2	protein-coding	Mus musculus	ENSMUSG00000019789	CHF1|Herp1|Hrt2|bHLHb32|hesr2	15214	Aggressive Behaviors	10|10 A4	Knockout	C57BL/129Svj	24431082	316	Expeimentalparadigm: Novel-cage test//Home-cage test//Open field test//Light–dark box test//Elevated plus maze//Resident–intruder test//Rotarod//Startle response and prepulse inhibition test//Hotplate test//Tail-flick test  /n  Model Generation: To disrupt the hesr1 gene, a targeting vector was constructed with a complete deletion of the bHLH region from exon1 through exon4, (see Supplementary Figure) using hesr1 containing BAC clones derived from the RPCI-22 mouse BAC library (BACPAC resources, CA). The targeting vector was then electroporated into AB1 embryonic stem (ES) cells. Colonies resistant to both neomycin (positive selection) and FIAU (negative selection) were screened by Southern blotting to identify correctly targeted clones. The recombinants were subsequently injected into C57B1/6 blastocysts to generate chimeras. Two independent lines were finally obtained that transmitted the targeted allele through the germ line. For genotyping, a PCR method was developed to detect wild-type alleles, using a 3′ forward: CCCTCCCCTCCGTGCTTCTAACCTCAT/3′ reverse: CTCTCCCCACCCCACAAAGCAAAGCAG, primer set, and for the targeted allele a 3′ reverse/Neo: CGACCACCAAGGCGAAACATC primer set. The neo cassette was removed by crossing the mice with CAG-Cre mice and the genotype was determined using the 3′ reverse/lacZ: CTCTGTGTCCTCATAAACCCTAACCTCCTT primer set. Mice containing a disrupted hesr2 gene have been described in a separate manuscript (Kokubo et al., 2004).  /n  Rescue: -  /n  Model Summary: In the present study, we investigated the effects of Hesr1 and Hesr2 on behavior. A behavioral test battery to examine spontaneous activity, anxiety-like behavior, aggressive behavior, pain sensitivity, and sensorimotor gating was conducted in Hesr1 and Hesr2 knockout (KO) mice. Enhanced prepulse inhibition (PPI), which is a form of sensorimotor gating, was observed in only Hesr1 KO mice; other behavioral traits were mostly comparable to wild-type animals in both the Hesr1 and the Hesr2 KO lines. Next, we used a dopamine agonist, apomorphine, to confirm the involvement of the dopaminergic system. Injection of apomorphine reduced the enhanced PPI in Hesr1 KO mice. Additionally, dose-dependent sensitivity to the agonist was lower in the Hesr1 KO mice than in wild-type mice, suggesting that the enhanced PPI resulted from this alteration in dopamine sensitivity. Furthermore, DAT mRNA was downregulated in Hesr1 KO mice, whereas the dopamine D1 and D2 receptors were comparable.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,transcription factor binding,identical protein binding,histone deacetylase binding,sequence-specific DNA binding,protein dimerization activity,RNA polymerase II-specific DNA-binding transcription factor binding,sequence-specific double-stranded DNA binding	Ani
Brinp1	BRINP1	protein-coding	Mus musculus	ENSMUSG00000028351	BRINP|Dbc1|Dbccr1|Fam5a	56710	Attention-Deficit/Hyperactivity Disorder	4|4 C1	Knockout	C57BL/6	24528488	317	Expeimentalparadigm: Motor function tests//Rotarod test//Hot plate test//Open field test//Light-dark test//Elevated plus maze//Social interaction test//T-maze alteration test//Social interaction test in home cage  /n  Model Generation: A targeting vector for homologous recombination was designed to replace exon8 (containing 50% of BRINP1 coding sequence) of mouse Brinp1 gene with a PGK-Neo cassette from pKJ2 [50] (Figure 1A). Approximately 10 kb genomic DNA region which encompass entire targeting vector was obtained by screening of mouse genomic library and genomic PCR of TT2 mouse embryonic stem (ES) cell [51] (Gibco-BRL) genomic DNA. BRINP1-KO mice and wild-type littermates were obtained by breeding the heterozygote mice which were backcrossed onto a C57BL/6J line for at least 6 generations.  /n  Rescue: -  /n  Model Summary: Neurogenesis in the subgranular zone of dentate gyrus was increased in BRINP1-KO mice creating a more immature neuronal population in granule cell layer. The number of parvalbumin expressing interneuron in hippocampal CA1 subregion was also increased in BRINP1-KO mice. Furthermore, BRINP1-KO mice showed abnormal behaviors with increase in locomotor activity, reduced anxiety-like behavior, poor social interaction, and slight impairment of working memory, all of which resemble symptoms of human psychiatric disorders such as schizophrenia and attention-deficit/hyperactivity disorder (ADHD).	molecular_function	Ani
Drd3	DRD3	protein-coding	Mus musculus	ENSMUSG00000022705	D3R	13490	Alcohol Use Disorder	16 B4|16 28.44 cM	Knockout	C57BL/6J	24584330	318	Expeimentalparadigm: Two-bottle choice paradigm//Drinking in the dark  /n  Model Generation: Mice D3R null (D3R<U+2212>/<U+2212>) and WT littermates (males, 8–12 weeks old) were individually housed, with free access to chow and water (except in the ethanol-drinking procedures), in an air-conditioned room, with a 12-h light–dark cycle. Mice D3R<U+2212>/<U+2212><U+00A0>were 10th–12th generation of congenic C57BL/6J mice, generated by a back-crossing strategy<U+00A0>  /n  Rescue: We evaluated buspirone, an approved drug for anxiety disorders endowed with D3R antagonist activity (confirmed by molecular modeling analysis), that resulted effective in inhibiting ethanol intake  /n  Model Summary: Thus, DA signaling via D3R is essential for ethanol-related reward and consumption and may represent a novel therapeutic target for weaning.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,protein binding,protein domain specific binding,D1 dopamine receptor binding	Ani
Gabbr1	GABBR1	protein-coding	Mus musculus	ENSMUSG00000024462	GABAB1|GABAbR1|bM573K1.1	54393	Aggressive Behaviors	17 B1|17 19.16 cM	Mutated	C57Bl/6Ola	24612522	319	Expeimentalparadigm: Social choice test//Intruder aggression test//Home cage activity//Nest building test//Urine marking test//Open field test//Light-dark box test//Marble burying test//Social and non-social odor exploration test  /n  Model Generation: GAD67 mutants examined in this study carry insertion of a GFP in the GAD67 gene (Tamamaki et al. 2003) and have been widely used as a tool to identify GABAergic neurons and related morphological and physiological functions (e.g. Meis et al. 2008; Mueller et al. 2012). Mutants were backcrossed to C57Bl/6Ola for 12 generations and bred in our animal facility.  /n  Rescue: -  /n  Model Summary: In this study, we report disturbance of social behavior in male GAD67 haplodeficient mice. GAD67(+/-) mice, compared to GAD67(+/+) littermates, show reduced sociability and decreased intermale aggression, but normal nest building and urine marking behavior, as well as unchanged locomotor activity and anxiety-like behavior. Moreover, the mutants display a reduced sensitivity to both social and non-social odors, indicating a disturbance in the detection and/or processing of socially relevant olfactory stimuli. Indeed, we observed reduced activation of the lateral septum, medial preoptic area, bed nucleus of the stria terminalis, medial and cortical amygdala upon exposure of GAD67(+/-) mice to social interaction paradigm, as indicated by c-Fos immunohistochemistry.	transmembrane signaling receptor activity,G protein-coupled receptor activity,G protein-coupled GABA receptor activity,protein binding,protein heterodimerization activity,G protein-coupled neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,G protein-coupled neurotransmitter receptor activity involved in regulation of presynaptic membrane potential,extracellular matrix protein binding	Ani
Nlgn3	NLGN3	protein-coding	Mus musculus	ENSMUSG00000031302	A230085M13Rik|HNL3|NL3|NLG3	245537	Autism Spectrum Disorder	X|X D	Knockin	129S2/Sv;NL3R451C	24619977	320	Expeimentalparadigm: Three Chamber Social Test//Social preference tests//Open field test//Elevated plus maze//Light-dark test//Locomotion test//Morris water maze  /n  Model Generation: To investigate possible mechanisms, we introduced the R451C-substitution into the endogenous neuroligin-3 gene in mice by gene targeting, generating R451C knockin (KI) mice (Fig. S1, 30). NL3R451C mutant mice were generated as previously described (Tabuchi et al., 2007) and then backcrossed for 10 generations onto a uniform 129S2/SvPasCrl genetic background. Uniformity of the genetic background to 99.5% was confirmed using Jackson Laboratory Congenic Services testing (Jax<U+00AE> Mice and Services, Bar Harbor, Maine 04609 USA).  /n  Rescue: -  /n  Model Summary: We backcrossed our NL3R451C mouse line onto a 129S2/SvPasCrl genetic background and repeated a subset of our previous behavioral testing. NL3R451C mice on a 129S2/SvPasCrl displayed social deficits, enhanced spatial learning, and increased locomotor activity. These data extend our previous findings that NL3R451C mice exhibit autism-relevant behavioral abnormalities and further suggest that different genetic backgrounds can modify this behavioral phenotype through epistatic genetic interactions.	signaling receptor activity,neurexin family protein binding,cell adhesion molecule binding,molecular adaptor activity,scaffold protein binding	Ani
Prnp	PRNP	protein-coding	Mus musculus	ENSMUSG00000079037	CD230|PrP|PrP<C>|PrPC|PrPSc|Prn-i|Prn-p|Sinc|prP27-30|prP33-35C	19122	Aggressive Behaviors	2 F2|2 64.07 cM	Knockout	C57BL/6J	24631389	321	Expeimentalparadigm: Resident–intruder test  /n  Model Generation: Heterozygous mice with the deletion of the prion protein gene Prnp (Prnp+/-) on a 129S7/sv background (Prnp+/- Zurich I) were obtained from EMMA (European mouse mutant archive, Monto Rotondo, Italy) and were backcrossed to C57BL6J background for four generations, always using C57BL6J males in backcrossings to prevent heterogeneity of the Y chromosome, which has been shown to be involved in the regulation of aggressive behavior. Heterozygous Prnp+/- male and female mice were mated to obtain Prnp-/- males for studying offensive aggressive behavior. Control WT males were always littermates of Prnp-/- males. After weaning, at postnatal day 21, WT and Prnp-/- male mice were removed from the mothers and housed in groups (2–3 males per cage) until behavioral testing in adulthood. WT male conspecifics (C57BL/6J line) of a similar body weight and age were bulbectomized in adulthood and used as intruders [42], [43], [44]. For bulbectomy, WT males were anesthetized with a mixture of ketamine (Vetoquinol Biowet, Gorzowie, Poland; 100 μg/g BW), xylazine (Chanelle Pharmaceuticals Ltd., Loughrea, Ireland; 10 μg/g BW) and acepromazine (Fort Dodge Animal Health, Fort Dodge, IA, USA; 2 μg/g BW). Olfactory bulbs were mechanically destroyed through bilateral holes in the skull and mice received two injections of analgesic butorphanol (Fort Dodge Animal Health; 1.7 μg/g BW) after the surgery. Bulbectomized males were then tested for aggressive and defensive behavior 7 days after surgery and were used later in testing with Prnp-/- mice as stimulus animals only if they did not show any aggressive behavior.  /n  Rescue: -  /n  Model Summary: In the present study, Zurich I Prnp(-/-) and their littermate wild type (WT) control male mice were behaviorally characterized for offensive aggressive behavior in a resident-intruder paradigm with the aim to establish the possible function of Prp(c) in the regulation of offensive aggressive behavior. Prnp(-/-) mice showed reduced latencies to the first attack and bite, higher percentage of mice biting and higher frequencies of attacks of stimulus males. These results show that Prnp(-/-) mice exhibit altered aggressive behavior in comparison to their WT controls and therefore suggest that lack of the Prnp either directly or indirectly affects brain circuitry responsible for the regulation of offensive aggressive behavior.	amyloid-beta binding,protease binding,copper ion binding,calcium ion binding,protein binding,lamin binding,glycosaminoglycan binding,microtubule binding,tubulin binding,aspartic-type endopeptidase inhibitor activity,type 5 metabotropic glutamate receptor binding,signaling receptor activity,identical protein binding,ATP-dependent protein binding,transmembrane transporter binding,protein-containing complex binding,metal ion binding,chaperone binding,molecular adaptor activity,protein sequestering activity,molecular condensate scaffold activity,cupric ion binding,cuprous ion binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6	24652766	322	Expeimentalparadigm: Visual acuity//Tail-flick test//Grip strength//Rotarod//Beam walking//Open field test//Elevated zero maze//Nest building//Three-chambered social approach test//Y-maze//Contextual and cued fear conditioning  /n  Model Generation: All animal procedures were approved by the Institutional Animal Care and Use Committee of the Icahn School of Medicine at Mount Sinai and the James J. Peters Veterans Affairs Medical Center (JPVAMC). Shank3-deficient mice were generated using Bruce4 C57BL/6 embryonic stem cells, genotyped as described previously (Bozdagi et al., 2010; Yang et al., 2012) and maintained on a pure C57BL/6N background (Taconic, Germantown, NY). Two additional lines of mice were generated by backcrossing C57BL/6N animals on FVB/NTac and 129S6/SvEvTac (Taconic) backgrounds using the Taconic Speed Congenics program to achieve >99% congenic animals. For each line, heterozygotes were mated to generate litters that consisted of three genotypes – wild type, heterozygotes and knockout.  /n  Rescue: -  /n  Model Summary: To determine whether the broad range of impairments observed in Phelan-McDermid syndrome could be explained by modulation by other genetic loci, the authors generated Shank3-deficient mice using three different strains to provide distinct genetic backgrounds. They tested the animals using an extensive battery of behavioral tests designed to assess the main features of PMS. As in previous studies using similar or slightly different mouse models of Shank3 deficiency, they observed altered phenotypes in different subcategories of behaviors. Surprisingly, however, there were very modest strain effects over a large battery of analysis: few tests revealed significant differences across the different strains or genetic backgrounds.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Nrg3	NRG3	protein-coding	Mus musculus	ENSMUSG00000041014	ska	18183	Attention-Deficit/Hyperactivity Disorder	14|14 B	Mutated	C57BL/6J	24703509	323	Expeimentalparadigm: 5-choice serial reaction time task//Elevated plus maze//Open field test//Light-dark box test//Accelerating rotating rod test//Barnes maze  /n  Model Generation: To generate mice with a mutant Nrg3 allele, a neomycin cassette replaced exon 2 of Nrg3, which encodes the N-terminal part of the epidermal growth factor-like domain in Nrg3, thereby introducing a frame shift mutation in the truncated transcript (Figure S1 in Supplement 1). Subsequently, the line was backcrossed for more than 10 generations to the C57BL/6 background before it was used for the first 5CSRTT experiment.  /n  Rescue: -  /n  Model Summary: Genetic mapping of impulsive action in the BXD panel identified a locus on chromosome 14 (34.5-41.4 Mb), syntenic with the human 10q22-q23 schizophrenia-susceptibility locus. Congenic mice carrying the impulsivity locus (Impu1) confirmed its influence on impulsive action. Increased impulsivity was associated with increased Nrg3 gene expression in the medial prefrontal cortex (mPFC). Viral overexpression of Nrg3 in the mPFC increased impulsivity, whereas a constitutive Nrg3 loss-of-function mutation decreased it.	signaling receptor binding,protein binding,growth factor activity,chemorepellent activity,receptor ligand activity	Ani
H2-Mv	NA	NA	Mus musculus	NA	NA	NA	Aggressive Behaviors	NA	Chromosome engineering	C57BL/6J;129/SvEv	24719092	324	Expeimentalparadigm: Resident-intruder test//Maternal aggressive behavior test//Pup retrieval assay  /n  Model Generation: DNA sequences were obtained from BAC clones of mouse 129/SvEv genomic origin. As homology arms of the M10.2 targeting vector: nt 36283661–36285669 (mouse genome assembly GRCm38) and nt 36277188–36283666; as probe for Southern blot for the M10.2 targeting vector: nt 36285671–36286169; as homology arms of the M10.6 targeting vector: nt 36810861–36815770 and nt 36815765–36819293; as probe for Southern blot for the M10.6 targeting vector: nt 36810361–36810860; as probe for Cre-mediated recombination: human Hprt gene amplified with primers, 5′-GAACCTGCCAGTCTGATAGG and 5′-GCGACCTTGACCATCTTTGG, from the Hprt (5′)-loxP-neo cassette (Ramírez-Solis et al., 1995). Chromosome engineering was performed as described previously (Ramírez-Solis et al., 1995; Del Punta et al., 2002a). The deletion is 532,098 bp, from position 36283667 to 36815764 (GRCm38). Replacement vectors for each end of the H2-Mv gene cluster, M10.2 and M10.6 loci, were constructed using the cassettes Hprt (5′)-loxP-neo and puro-loxP-Hprt (3′), respectively. The vectors were electroporated consecutively into AB2.2 cells, which are derived from an Hprt-deficient 129/SvEv blastocyst. Clones with the two targeted events were electroporated with the Cre-expression plasmid pOG231. Cells that underwent recombination between the loxP sites and thus express reconstituted functional Hprt were selected in hypoxantine-aminopterin-thymidine medium. ES cells were injected into C57BL/6 blastocysts and male chimeras were crossed to 129/SvEv females (Taconic). Deletion of all nine H2-Mv genes was confirmed by PCR using the following primers: outside the cluster at M10.2 locus, 5′-GGAGTCACAGCTTTCCTGTG and 5′-GAAATACATCTAATGTAAAGACGTG; outside the cluster at M10.6 locus, 5′-TGCAGACTCAGTGTCTGTGAG and 5′-TATTCATGTATACAAATCAGTGAATTG; M1, 5′-AATCCAGAAGACTTATGGCTG and 5′-CCAAAGGCCAGGAATCGATG; M9, 5′-ATCCAGGAAACATATGGCTG and 5′-CCAAAGTTCAGGTATTGAAG; M11, 5′-ATCCAGAGAAGGTATGGCTG and 5′-CCATATTCCAGCTCTGTGAG; M10.1, 5′-TATCACACCCTGCAGGAAGT and 5′-GTAAGTCTTCCTCCGTTTTG; M10.2, 5′-TATCACACCCTGCAGGAAGT and 5′-GTAGGTCCTCCAGCCTTCCG; M10.3/M10.5, 5′-TATCACACCCTGCAGGAAGT and 5′-GTAAGTCTTCCACCTTTCTG; M10.4, 5′-TATCACACCCTGCAGGAAGT and 5′-GTAAGTCCTCCAACCTTCTG; M10.6, 5′-TATCACACCCTGCAGGAAGT and 5′-GTAAGTCCTCCAACTTTCTG. ΔH2Mv mice are available from The Jackson Laboratory: strain A in an inbred 129/Sv background as stock JR#6730 and strain name 129-Del(17)4Mom/1MomJ; strain A after at least seven backcrosses to C57BL/6J as JR#8097 and B6.129-Del(17)4Mom/1MomJ; strain C in 129/Sv as JR#6731 and 129-Del(17)5Mom/1MomJ; and strain C backcrossed to C57BL/6J as JR#8098 and B6.129-Del(17)5Mom/1MomJ. Results were obtained with strain C.  /n  Rescue: -  /n  Model Summary: Here, we have taken a genetic approach and have deleted the 530 kb cluster of H2-Mv genes in the mouse germline by chromosome engineering. Homozygous mutant mice (ΔH2Mv mice) are viable and fertile. There are no major anatomical defects in their VNO and accessory olfactory bulb (AOB). Their VSNs can be stimulated with chemostimuli (peptides and proteins) to the same maximum responses as VSNs of wild-type mice, but require much higher concentrations. This physiological phenotype is displayed at the single-cell level and is cell autonomous: single V2rf2-expressing VSNs, which normally coexpress H2-Mv genes, display a decreased sensitivity to a peptide ligand in ΔH2Mv mice, whereas single V2r1b-expressing VSNs, which do not coexpress H2-Mv genes, show normal sensitivity to a peptide ligand in ΔH2Mv mice. Consistent with the greatly decreased VSN sensitivity, ΔH2Mv mice display pronounced deficits in aggressive and sexual behaviors.	NA	Ani
Ncam1	NCAM1	protein-coding	Mus musculus	ENSMUSG00000039542	CD56|E-NCAM|NCAM-1|Ncam	17967	Aggressive Behaviors	9 A5.3|9 26.83 cM	Knockout	C57BL/6J	24751161	325	Expeimentalparadigm: Open field test//Light-dark box test//Elevated plus maze//Novelty object recognition test//Spontaneous alternation test//Resident-intruder test//Urine marking test//Step-through passive avoidance and preference learning test//Test for 8-OH-DPAT-induced hypothermia  /n  Model Generation: The generation of mice conditionally deficient in NCAM has been described (Bukalo et al. 2004). In these mice, NCAM expression is ablated after crossing NCAM-floxed mice (NCAMff; 129X1/SvJ × 129S1/SvImJ × C57BL/6 genetic background) with mice expressing CRE recombinase under the control of the calcium/calmodulin-dependent kinase II promoter [Tg(Camk2a-cre)1Gsc; FVB/N genetic background] to obtain NCAMffcre mice. Mutants were backcrossed to C57BL/6J mice for more than 10 generations and were further maintained as inbred colony by brother–sister mating under specific pathogen-free conditions.  /n  Rescue: -  /n  Model Summary: Here, we studied these behaviours in mice conditionally deficient in NCAM in the postmigratory forebrain neurons. We report deficits in both innate and learned avoidance behaviours, as observed in elevated plus maze and passive avoidance tasks. In contrast, general locomotor activity, trait anxiety or neophobia were unaffected by the mutation. Altered avoidance behaviour of the conditional NCAM mutants was associated with a deficit in serotonergic signalling, as indicated by their reduced responsiveness to (±)-8-hydroxy-2-(dipropylamino)-tetralin-induced hypothermia. Another serotonin-dependent behaviour, namely intermale aggression that is massively increased in constitutively NCAM-deficient mice, was not affected in the forebrain-specific mutants.	protein binding,heparin binding,phosphatase binding,LRR domain binding	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Conditional Knockout	Ms2Yah;C57BL/6J	24752061	326	Expeimentalparadigm: Treadmill//Novel object recognition test//Rotarod//Morris water maze//Contextual fear conditioning paradigm  /n  Model Generation: The Abcg1 and U2af1 targeting vectors were isolated, respectively, from the 5′Hprt and 3′Hprt libraries (84) and inserted by homologous recombination in HM-1 Hprt-deficient ES cells (85). Subsequently, a transient expression of the Cre recombinase provided ES cells with three different configurations (Fig. 1). We obtained ES cell clones carrying two loxP sites in the Abcg1 and U2af1 loci in a cis configuration, which were named Cis(Abcg1tm1Yah–U2af1tm1Yah), ES cells with a deletion of the Abcg1–U2af1 region, the Ms2Yah clone and the Ts1Yah clone which provide a duplication of this region. Ms2Yah and Ts1Yah clones were injected into C57BL/6J blastocysts to generate chimera. These animals were crossed with C57BL/6J mice to obtain the corresponding mouse line. The Ms2Yah [B6.129Del(17Abcg1–U2af1)] and the Ts1Yah [B6.129Dup(17Abcg1–U2af1)] were generated on 129/Ola and backcrossed on the C57BL/6J genetic background up to N7 in this study.  /n  Rescue: -  /n  Model Summary: Here we analyzed the impact of monosomy of the same genetic interval, using a new mouse model, named Ms2Yah. We used several cognitive paradigms and did not detect defects in the object recognition or the Morris water maze tests. However, surprisingly, Ms2Yah mice displayed increased associative memory in a pure contextual fear-conditioning test and decreased social novelty interaction along with a larger long-term potentiation recorded in the CA1 area following stimulation of Schaffer collaterals.	NA	Ani
Fkbp5	FKBP5	protein-coding	Mus musculus	ENSMUSG00000024222	D17Ertd592e|Dit1|FKBP-5|FKBP51	14229	Acute Stress Disorder	17 A3.3|17 14.66 cM	Knockout	C57BL/6;129SvJ	24759731	327	Expeimentalparadigm: Open field<U+00A0>test//Elevated plus maze//Light-dark box test//Y-maze//Forced swim test  /n  Model Generation: ES cells isolated from 129SvJ mouse were cultured in KnocKnockoutut DMEM (Invitrogen) supplemented with 10% FBS, penicillin/streptomycin, essential amino acids, ESGRO (103 U/ml; Chemicon, Temecula, CA) with irradiated embryonic fibroblast feeder cells. ES cells were electroporated at 0.2 kV, 950 μF (Gene Pulser II; Bio-Rad, Hercules, CA) with linearized targeting vectors and selected with G418 (300 μg/ml).<U+00A0>ES cell clones containing a mutant Fkbp4 allele were injected into C57BL/6 blastocysts and implanted into psuedopregnant 129SvJ females. Chimeric offspring were identified by coat patterns and mated to C57BL/6 mice to obtain germline transmission of the mutant allele.  /n  Rescue: -  /n  Model Summary: Overall, female 51Knockout mice did not display any overt behavioural phenotype under basal conditions, but showed a reduced basal hypothalamic–pituitary–adrenal axis activity, a blunted response to, and an enhanced recovery from, acute stress.	peptidyl-prolyl cis-trans isomerase activity,protein binding,FK506 binding,isomerase activity,heat shock protein binding	Ani
Dstn	DSTN	protein-coding	Mus musculus	ENSMUSG00000015932	2610043P17Rik|ADF|Dsn|corn1|sid23p	56431	Attention-Deficit/Hyperactivity Disorder	2 G1|2 70.89 cM	Conditional Knockout	ACC;ADF<U+2212>/<U+2212>/n-Cofflx/flx;CamKII-cre	24768258	328	Expeimentalparadigm: Homecage activity test//Open field test//Y-maze//Radial arm maze  /n  Model Generation: Double mutant mice lacking ADF and n-cofilin (ACC mice; ADF-/-/n-Cofflx/flx,CamKII-cre) were generated by intercrossing mutants with a single ADF allele and a single floxed n-cofilin allele (16). One of the breeding animals additionally expressed Cre recombinase under control of the CaMKIIα promoter (21). ADF/n-Cof+/+flx/flx mice served as control animals. The CaMKII-Cre mice were also intercrossed with Rosa26-Cre reporter mice to determine Cre activity (22).  /n  Rescue: Hyperlocomotion and impulsive behavior were reversed by methylphenidate, a psychostimulant commonly used for the treatment of attention-deficit/hyperactivity disorder (ADHD).  /n  Model Summary: The ACC mice, but not single mutants, exhibited hyperlocomotion, impulsivity, and impaired working memory.	actin binding,actin filament binding	Ani
Galr3	GALR3	protein-coding	Mus musculus	ENSMUSG00000114755	Galnr3	14429	Anxiety Disorder	15 E1|15 37.7 cM	Knockout	C57BL/6	24782539	329	Expeimentalparadigm: Elevated plus maze//Light-dark box test//Open field test//Social interaction box test//Tail suspension test//Forced swim test  /n  Model Generation: GAL3-KO mice were produced by targeting both coding exons of the GAL3 receptor by homologous recombination(https://beta.infrafrontier.eu/sites/infrafrontier.eu/files/upload/public/lexicon/combined_lexicon_data/LEXKO-230-treeFrame.html) (Fig. S1A) and then backcrossing the mutant on a C57BL/6 background for at least seven generations.  /n  Rescue: -  /n  Model Summary: In recent years, numerous studies of animal models have suggested an involvement of GAL and GAL1 and GAL2 receptors in anxiety- and depression-related behavior. However, to date, there is sparse literature implicating GAL3 receptors in behavioral functions. Therefore, we studied the behavior of GAL3 receptor-deficient (GAL3-KO) mice to elucidate whether GAL3 receptors are involved in mediating behavior-associated actions of GAL. The GAL3-KO mouse line exhibited normal breeding and physical development. In addition to behavioral tests, phenotypic characterization included analysis of hematology, amino acid profiles, metabolism, and sudomotor function. In contrast to WT littermates, male GAL3-KO mice exhibited an anxiety-like phenotype in the elevated plus maze, open field, and light/dark box tests, and they were less socially affiliated than WT animals to a stranger mouse in a social interaction test.	G protein-coupled receptor activity,galanin receptor activity,G protein-coupled peptide receptor activity,peptide hormone binding	Ani
Pten	PTEN	protein-coding	Mus musculus	ENSMUSG00000013663	2310035O07Rik|A130070J02Rik|B430203M17Rik|MMAC1|PTENbeta|TEP1	19211	Autism Spectrum Disorder	19 C1|19 28.14 cM	Conditional Knockout	NS-Pten	24795561	330	Expeimentalparadigm: Social partition//Olfactory habituation-dishabituation test//Hole-board test//Marble burying//Ultrasonic vocalizations//Open field//Elevated plus-maze  /n  Model Generation: Neuron subset-specific Pten conditional mice have been previously described as GFAP-Cre; PtenloxP/loxP (Backman et al., 2001; Kwon et al., 2001). They are on a FVB-based mixed background strain and have been bred for more than 10 generations. We bred NS-PtenloxP/+ heterozygote parents to produce NS-Pten wildtype (WT), NS-Pten+/+loxP/+ heterozygous (HT), and PtenloxP/loxP KO.  /n  Rescue: -  /n  Model Summary: In the current study we examined the behavioral and molecular consequences in mice with neuron subset-specific deletion of PTEN. The knockout (KO) mice showed deficits in social chamber and social partition test. KO mice demonstrated alterations in repetitive behavior, as measured in the marble burying test and hole-board test. They showed no changes in ultrasonic vocalizations emitted on postnatal day 10 or 12 compared to wildtype (WT) mice. They exhibited less anxiety in the elevated-plus maze test and were more active in the open field test compared to WT mice.	phosphatidylinositol-3-phosphate phosphatase activity,phosphoprotein phosphatase activity,protein serine/threonine phosphatase activity,protein tyrosine phosphatase activity,platelet-derived growth factor receptor binding,protein binding,anaphase-promoting complex binding,phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity,hydrolase activity,phosphatase activity,myosin phosphatase activity,enzyme binding,protein kinase binding,PDZ domain binding,ionotropic glutamate receptor binding,identical protein binding,inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity,phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity,molecular function inhibitor activity,ubiquitin-specific protease binding,protein tyrosine kinase binding	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Transgene	C57Bl/6J	24801365	331	Expeimentalparadigm: Rotarod//Morris water maze//Y-maze  /n  Model Generation: Ts65Dn mice (Davisson et al., 1993) were maintained on a B6/C3H background and genotyped as described previously (Reinholdt et al., 2011). Mice carrying the murine BAC containing one copy of Dyrk1A were maintained on a C57Bl/6J background and genotyped as described (Guedj et al., 2012). Dp(16)1Yey mice were maintained on a C57Bl/6J background and genotyped as described (Li et al., 2007). The GAD67-GFP knock-in delta-neo mouse was maintained on a CD1 background, genotyped as previously described (Tamamaki et al., 2003), and females were crossed with males of the hYACtgDyrk1a (Guedj et al., 2009, Smith et al., 1997) model (on C57Bl/6J background) or of the Dp(16)1Yey (C57Bl/6J) to obtain F1 generation mice that were genotyped for the three genotypes as previously described (Guedj et al., 2009, Li et al., 2007, Tamamaki et al., 2003). (Primer information for genotyping is included in Supplementary Table 1.) Dyrk1a(+/-) mice were maintained on a CD1 background and genotyped as previously described (Fotaki et al., 2002). All analyses were performed comparing the transgenic or trisomic mice with their wildtype (WT) littermates.  /n  Rescue: -  /n  Model Summary: Various mouse models and studies from human brains have implicated an HSA21 gene, the serine/threonine kinase DYRK1A, as a candidate for inducing cognitive dysfunction. Here, consequences of alterations in Dyrk1a dosage were assessed in mouse models with varying copy numbers of Dyrk1a: mBACtgDyrk1a, Ts65Dn and Dp(16)1Yey (with 3 gene copies) and Dyrk1a(+/-) (one functional copy). Molecular (i.e. immunoblotting/immunohistochemistry) and behavioral analyses (e.g., rotarod, Morris water maze, Y-maze) were performed in mBACtgDyrk1a mice. Increased expression of DYRK1A in mBACtgDyrk1a induced molecular alterations in synaptic plasticity pathways, particularly expression changes in GABAergic and glutaminergic related proteins. Similar alterations were observed in models with partial trisomy of MMU16, Ts65Dn and Dp(16)1Yey, and were reversed in the Dyrk1a(+/-) model. Dyrk1a overexpression produced an increased number and signal intensity of GAD67 positive neurons, indicating enhanced inhibition pathways in three different models: mBACtgDyrk1a, hYACtgDyrk1a and Dp(16)1Yey. Functionally, Dyrk1a overexpression protected mice from PTZ-induced seizures related to GABAergic neuron plasticity.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Trim32	TRIM32	protein-coding	Mus musculus	ENSMUSG00000051675	1810045E12Rik|3f3|BBS11|Zfp117	69807	Anxiety Disorder	4 C1|4 34.43 cM	Knockout	C57BL/6J	24839933	332	Expeimentalparadigm: Sucrose preference test//Open field test//Elevated zero maze test//Forced swim test//Tail suspension test  /n  Model Generation: C57BL/6J mice were purchased from the Vital River Laboratories (Beijing, China), and Trim32 knockout mice were kindly provided by Dr H. Ding (University of Manitoba).  /n  Rescue: -  /n  Model Summary: Trim32 knockout mice showed reduced anxiety and depressive behaviors and hyperactivities compared with Trim32 wild-type mice under normal and mild stress conditions. We conclude that TRIM32 plays important roles in regulation of hyperactivities and positively regulates the development of anxiety and depression disorders induced by chronic stress.	transcription coactivator activity,RNA binding,ubiquitin-protein transferase activity,protein binding,zinc ion binding,transferase activity,myosin binding,translation initiation factor binding,identical protein binding,ubiquitin binding,protein self-association,metal ion binding,ubiquitin protein ligase activity	Ani
Maoa	MAOA	protein-coding	Mus musculus	ENSMUSG00000025037	1110061B18Rik	17161	Aggressive Behaviors	X A1.2|X 11.78 cM	Knockout	129S6	24882701	333	Expeimentalparadigm: Open field test//Marble burying//Water mist-induced grooming//Social interaction//Resident-intruder test  /n  Model Generation: We used 3-5 month old, experimentally na<U+00EF>ve male 129S6 mice (n=10-20 per genotype and treatment group), weighing 25-30 g. We used heterozygous MAO-A KO and MAO-ANeo dams for breeding with wild-type (WT) sires to generate MAO-A KO and hypomorphic MAO-ANeo animals as previously described (Bortolato et al. 2011). The MAO-ANeo construct was specifically designed to harbor a floxed neomycin selection cassette (NeoR) in intron-12 of the Maoa gene and a loxP sequence in intron-11. This particular configuration was devised to generate a hypomorphic variant in which either the NeoR cassette or exon-12 (which encodes for the active site of the enzyme) may be removed upon recombination with Cre sequences. The full details of the generation of MAO-ANeo mice are presented under Supplementary Materials and Methods. Briefly, an MAO-ANeo targeting vector was derived from the plasmid pPGKneo-I—containing the NeoR cassette with a phosphoglycerate kinase-1 (PGK1) promoter—and a 9-kb BamHI MAO-A clone (Figure 1a). The MAO-ANeo targeting vector was electroporated into embryonic stem cells as described and incubated in the culture medium with G418 for neomycin-resistance selection. Two independent neomycin-resistant homologous recombinant clones were selected among the embryonic stem cell lines and used to generate two lines of 129S6 mice. The presence of loxP sequences was then ascertained by genomic DNA PCR and the selected line of MAO-ANeo mice was then expanded into a stable colony. Throughout the study MAO-ANeo mice were compared with WT littermates as well as age-matched MAO-A KO mice on 129S6 genetic background. In particular, for MAO-A KO mice, we used MAO-AA863T KO mice, which show a spontaneous point nonsense mutation strikingly similar to that featured in Brunner syndrome (Brunner et al, 1993). Each line was bred with homogenotypic pairs and backcrossed to 129S6 every three generations.  /n  Rescue: Furthermore, the translational implications of our results highlight 5-HT reuptake inhibition as an interesting approach for the control of aggressive outbursts in MAO-A deficient individuals.  /n  Model Summary: To ascertain the role of 5-HTT in the behavioral anomalies associated to MAO-A deficiency, we tested the behavioral effects of its blocker fluoxetine on perseverative, social and aggressive behaviors in transgenic animals with hypomorphic or null-allele MAO-A mutations. Acute treatment with the 5-HTT blocker fluoxetine (10 mg/kg, i.p.) reduced aggressive behavior in MAO-A knockout (KO) mice and social deficits in hypomorphic MAO-A(Neo) mice. Furthermore, this treatment also reduced perseverative responses (including marble burying and water mist-induced grooming) in both MAO-A mutant genotypes. Both MAO-A mutant lines displayed significant reductions in 5-HTT expression across the prefrontal cortex, amygdala and striatum, as quantified by immunohistochemical detection; however, the down-regulation of 5-HTT in MAO-A(Neo) mice was more pervasive and widespread than in their KO counterparts, possibly indicating a greater ability of the hypomorphic line to enact compensatory mechanisms with respect to 5-HT homeostasis. Collectively, these findings suggest that the behavioral deficits associated with low MAO-A activity may reflect developmental alterations of 5-HTT within 5-HTergic neurons.	protein binding,primary amine oxidase activity,oxidoreductase activity,flavin adenine dinucleotide binding,serotonin binding,tryptamine:oxygen oxidoreductase (deaminating) activity,aminoacetone:oxygen oxidoreductase(deaminating) activity,aliphatic amine oxidase activity,phenethylamine:oxygen oxidoreductase (deaminating) activity,monoamine oxidase activity	Ani
Ambra1	AMBRA1	protein-coding	Mus musculus	ENSMUSG00000040506	2310079H06Rik|A130023A14|D030051N19Rik|mKIAA1736	228361	Autism Spectrum Disorder	2|2 E1	Conditional Knockout	C57BL/6N	24904333	334	Expeimentalparadigm: Elevated plus maze//Open field test//Hole board//Rotarod//Startle response and prepulse inhibition//Hearing//Visual cliff//Marble burying test//Y-maze//Buried food finding//Sucrose preference//Social interaction in pairs//Morris water maze//Hot plate test//LABORAS home cage activity//Novel object recognition test//Forced swim test//Nest building//Vocalization  /n  Model Generation: Ambra1+/<U+2212><U+00A0>and wildtype (WT,<U+00A0>Ambra1+/+) littermates of both genders with a >99% C57BL/6N genetic background were used for behavioral and biochemical studies. They were obtained from male<U+00A0>Ambra1+/<U+2212><U+2009>×<U+2009>female WT C57BL/6N breeding pairs.  /n  Rescue: -  /n  Model Summary: Surprisingly, comprehensive behavioral characterization of these mice revealed an autism-like phenotype in<U+00A0>Ambra1+/<U+2212><U+00A0>females only, including compromised communication and social interactions, a tendency of enhanced stereotypies/repetitive behaviors, and impaired cognitive flexibility	protein binding,protein phosphatase binding,ubiquitin protein ligase binding,GTPase binding,ubiquitin ligase-substrate adaptor activity	Ani
Apc	APC	protein-coding	Mus musculus	ENSMUSG00000005871	CC1|Min|mAPC	11789	Autism Spectrum Disorder	18 B1|18 18.53 cM	Conditional Knockout	Rosa26R<U+00A0>	24934177	335	Expeimentalparadigm: Barnes maze//Probe trials//Y-maze//Activity or distance traveled during home cage//Gait analysis//Marble burying test//Elevated plus maze test//Novelty object recognition test//Social versus non-social olfaction test//Three-chamber test  /n  Model Generation: APC cKO mice were generated by crossing APClox468/lox468 mice31<U+00A0>with CamKII-Cre mice.32<U+00A0>Littermates, negative for Cre, were used as controls in all experiments. For synaptic spine analysis, Thy1-YFP mice33<U+00A0>were crossed with APC cKO mice to obtain APC cKO-Thy1-YFP mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: APC cKO mice, compared with wild-type littermates, exhibit learning and memory impairments, and autistic-like behaviors (increased repetitive behaviors, reduced social interest).<U+00A0>	protease binding,protein binding,beta-catenin binding,microtubule binding,protein kinase regulator activity,protein kinase binding,ubiquitin protein ligase binding,protein-containing complex binding,gamma-catenin binding,microtubule plus-end binding,dynein complex binding	Ani
Nlgn3	NLGN3	protein-coding	Mus musculus	ENSMUSG00000031302	A230085M13Rik|HNL3|NL3|NLG3	245537	Autism Spectrum Disorder	X|X D	Conditional Knockin	C57BL/6J	24995986	336	Expeimentalparadigm: Rotarod testing//Open field test//Force-plate actometer assays  /n  Model Generation: Gene-targeting strategy for Nlgn3*KI-mVenus mice. The targeting vector introduces a knock-in (KI) cassette flanked by frt sites, replicating the endogenous intron/splice acceptor upstream of exon 2, which harbors the start codon for Nlgn3. A modified NL3 cDNA (Nlgn3*) containing an mVenus tag and mutations abolishing neurexin binding (shown in yellow) is followed by a PGK-neo selection cassette flanked by F3 sites (shown in blue). The KI cassette is immediately followed by a single loxP511 site, with a second loxP511 site located in the intron downstream of exon 3. After successful homologous recombination into the endogenous locus (“KI+neo”), Flp-recombinase activity will either remove the PGK-neo selection cassette (“KI w/o neo”), or delete the entire KI cassette and leave loxP511 sites flanking exons 2 and 3 (“cKO”). The latter allele is subject to Cre-mediated recombination, allowing conditional deletion of NL3. All analyses were performed on male littermate mice after extensive backcrossing to C57Bl/6J except when noted.  /n  Rescue: -  /n  Model Summary: In humans, neuroligin-3 mutations are associated with autism, whereas in mice, the corresponding mutations produce robust synaptic and behavioral changes. However, different neuroligin-3 mutations cause largely distinct phenotypes in mice, and no causal relationship links a specific synaptic dysfunction to a behavioral change. Using rotarod motor learning as a proxy for acquired repetitive behaviors in mice, we found that different neuroligin-3 mutations uniformly enhanced formation of repetitive motor routines. Surprisingly, neuroligin-3 mutations caused this phenotype not via changes in the cerebellum or dorsal striatum but via a selective synaptic impairment in the nucleus accumbens/ventral striatum.	signaling receptor activity,neurexin family protein binding,cell adhesion molecule binding,molecular adaptor activity,scaffold protein binding	Ani
Tshr	TSHR	protein-coding	Mus musculus	ENSMUSG00000020963	hypothroid|hyt|pet	22095	Attention-Deficit/Hyperactivity Disorder	12 D3|12 44.51 cM	Knockout	C57BL/6;129S1-Tshr<tm1Rmar>/J	25016105	337	Expeimentalparadigm: Open field test//Cliff avoidance test//Social interaction test//Y-maze test//Novelty object recognition test  /n  Model Generation: Thyrotropin receptor knockout (TSHR KO) (B6;129S1-Tshr<tm1Rmar>/J) heterozygotes (TSHR+/-) were obtained from the Jackson laboratory, and male F3 progenies were used in this study (TSHR, n = 46; TSHR+/++/-, n = 46; TSHR-/-, n = 36).  /n  Rescue: -  /n  Model Summary: Here, we clarified a novel role for TSHR in emotional and cognitive functions related to monoaminergic nervous systems. TSHR knockout mice showed phenotypes of ADHD such as hyperactivity, impulsiveness, a decrease in sociality and increase in aggression, and an impairment of short-term memory and object recognition memory.	G protein-coupled receptor activity,thyroid-stimulating hormone receptor activity,G protein-coupled peptide receptor activity,protein-hormone receptor activity,signaling receptor activity,protein-containing complex binding	Ani
Nrxn1	NRXN1	protein-coding	Mus musculus	ENSMUSG00000024109	1700062G21Rik|9330127H16Rik|A230068P09Rik|mKIAA0578	18189	Autism Spectrum Disorder	17|17 E5	Knockout	C57BL/6J	25017069	338	Expeimentalparadigm: Rotarod test//Open field test//Novelty object recognition test  /n  Model Generation: The HA-βnrx1ΔC construct contains an HA tag at the N terminus of the mature protein and lacks the last 55 residues of the cytoplasmic tail. A DNA fragment containing the TRE promoter, the coding sequence of HA-βNrx1ΔC and a WPRE fragment (woodchuck hepatitis virus posttranscriptional regulatory element) was injected into the pronucleus of FVB/N zygote for transgenic mouse production. TRE-HAβnrx1ΔC mice were backcrossed with C57BL/6J mice for four generations followed by mating with CaMKIIα-tTA mice in a C57BL/6J background (Mayford et al., 1996) that led to the generation of βNrx1ΔC mice (CaMKIIα-tTA/TRE-HAβnrx1ΔC).  /n  Rescue: The autistic-like phenotype of βNrx1ΔC mice can be reversed after removing the mutant protein in aged animals.  /n  Model Summary: Here, we generated transgenic βNrx1ΔC mice in which neurexin function is selectively impaired during late postnatal stages. Whole-cell recordings in cortical neurons show an impairment of glutamatergic synaptic transmission in the βNrx1ΔC mice. Importantly, mutant mice exhibit autism-related symptoms, such as increased self-grooming, deficits in social interactions, and altered interaction for nonsocial olfactory cues. The autistic-like phenotype of βNrx1ΔC mice can be reversed after removing the mutant protein in aged animals.	transmembrane signaling receptor activity,signaling receptor binding,type 1 fibroblast growth factor receptor binding,calcium channel regulator activity,calcium ion binding,protein binding,acetylcholine receptor binding,protein-containing complex binding,metal ion binding,calcium-dependent protein binding,cell adhesion molecule binding,neuroligin family protein binding	Ani
Elfn1	ELFN1	protein-coding	Mus musculus	ENSMUSG00000048988	A930017N06Rik|Ppp1r28	243312	Attention-Deficit/Hyperactivity Disorder	5|5 G2	Knockout	C57BL/6J	25047565	339	Expeimentalparadigm: Homecage activity test//Open field test//Light–dark box test//Elevated plus maze//Startle response and prepulse inhibition test//Hole board test//Hot plate test//Tail flick test  /n  Model Generation: Briefly, to construct the Elfn1 targeting vector, overlapping Elfn1 genomic clones were obtained from BACPAC Resources Center at Children’s Hospital Oakland Research Institute (Oakland, CA). The targeting construct contained the 4.5-kb 5′ and 5.9-kb 3′ homology regions, and the 3.5-kb fragment containing the open reading frame of Elfn1 was replaced with the phosphoglycerol kinase (PGK)–neo expression cassette flanked by a loxP sequence. Embryonic stem cells (EmbryoMax Embryonic Stem Cell Line—Strain C57BL/6, Millipore) were electroporated with the targeting construct and selected with G418. Drug-resistant clones were analysed by Southern blotting. Chimeric mice were generated by injection of the targeted embryonic stem cells into BALB/c blastocysts.  /n  Rescue: -  /n  Model Summary: Elfn1 protein increases during postnatal development and localizes to postsynaptic sites of somatostatin-containing interneurons (SOM-INs) in the hippocampal CA1 stratum oriens and dentate gyrus (DG) hilus. Elfn1 knockout (KO) mice have deficits in mGluR7 recruitment to synaptic sites on SOM-INs, and presynaptic plasticity is impaired at these synapses.	protein phosphatase inhibitor activity	Ani
Dlgap2	DLGAP2	protein-coding	Mus musculus	ENSMUSG00000047495	6430596N04Rik|Dap-2|Dap2|Sapap2	244310	Autism Spectrum Disorder	8|8 A1.1	Knockout	C57BL/6	25071926	340	Expeimentalparadigm: Locomotion test//Three Chamber Social Test//Resident-intruder task//Tube test//T-maze  /n  Model Generation: We used the method of targeting vector construction to generate Dlgap2 knockout (KO) mice as previously described by Liu, Jenkins, and Copeland [28]. In summary, exon 6 of Dlgap2 (Gene ID: 244310) in embryonic stem (ES) cells from the 129S1/Sv mouse strain was replaced by a construct containing Dlgap2 exon 6 interposed between two loxP sites and a NEO cassette via spontaneous homologous recombination. Exon 6 of Dlgap2 was knocked out by Cre-induced homologous recombination (Figure 1A). The ES cell clones containing the mutant allele were rechecked by Southern blot DNA fragment analysis to ensure the correctness of gene targeting. The targeted ES cells were microinjected into the blastocysts from the C57BL/6 mouse strain and the injected blastocysts were transferred into ICR foster mothers to produce chimeric mice. F1 founders were produced by mating male chimeric mice with wild-type (WT) C57BL/6 females. The mice were backcrossed for more than eight generations to make the congenic strain in a 99.9% C57BL/6 genetic background.  /n  Rescue: -  /n  Model Summary: Dlgap2 (-/-) mice displayed exacerbated aggressive behaviors in the resident-intruder task, and elevated social dominance in the tube test. In addition, Dlgap2 (-/-) mice exhibited a clear reduction of receptors and scaffold proteins in cortical synapses. Dlgap2 (-/-) mice also demonstrated lower spine density, decreased peak amplitude of miniature excitatory postsynaptic current and ultra-structural deficits of PSD in the OFC.	protein domain specific binding,molecular adaptor activity	Ani
Ngfr	NGFR	protein-coding	Mus musculus	ENSMUSG00000000120	LNGFR|Tnfrsf16|p75|p75NGFR|p75NTR	18053	Aggressive Behaviors	11 D|11 59.01 cM	Knockout	C57BL/6J	25072321	341	Expeimentalparadigm: Spontaneous locomotor activity//Social behavior  /n  Model Generation: Mice of a C57Bl6J background with loxP sites flanking all p75NTR spliced isoforms (exons 4–6) were obtained from Vesa Kaartinen, PhD (University of Michigan).17 Mice of a C57Bl6 background with a hemizygous Cre gene driven by the Purkinje cell protein-2 promoter (Pcp-2) and previously shown to express Cre selectively in cerebellar Purkinje cells were obtained from Jackson Laboratories (Bar Harbor, ME, USA; strain B6.129-Tg(Pcp2-cre)2Mpin/J; stock number 004146). These mice were developed as follows: the transgene vector was electroporated into R1 ES cells and positive clones were injected into C57BL/6J blastocysts. Resulting chimeras were crossed with C57BL/6NCrl. The strain has been backcrossed for a total of six generations to C57BL/6J. Cre is variably turned on in post-natal life and half of the progeny resulting from mating of these hemizygous mice with floxed mice exhibit knockout of the floxed gene in ~ 50% of their Purkinje cells. We used this hemizygous targeted Cre mouse because the Pcp-2 promoter-linked homozygous Cre mouse dies during embryonic life (http://jaxmice.jax.org/strain/004146.html, accessed 16 December 2013). The Pcp-2 Cre mice were cross-bred with the p75NTR-floxed mice. The genomic DNA of the resulting progeny was extracted from tail snips by using the Wizard SV Genomic Purification System Kit (Promega, Madison, WI, USA, no. A2360). Genotyping was performed with PCR using an Eppendorf Master Cycler. The protocol for detection of Cre was obtained from Jackson Laboratories (http://jaxmice.jax.org/protocolsdb/f?p=116:2:2606126352577965::NO:2:P2_MASTER_PROTOCOL_ID,P2_JRS_CODE:288,010536; accessed 16 December 2013); the protocol for detection of p75NTR was obtained from Dr Kaartinen.17 Primers used were as follows: Cre, 5′-GCGGTCTGGCAGTAAAAACTATC-3′ and 5′-GTGAAACAGCATTGCTGTCACTT-3′ P75-C, 5′-TGCAGAAATCATCGACCCTTCCC-3′ P75-D: 5′-TCCTCACCCCGTTCTTTCCCC-3′. Littermates with the range of genotypes were used, and a total of only three litters were used in these studies of 15 mice. Control (non-Cre, non-loxP) mice were of C57BL/6J background, as recommended by Jackson Laboratories (http://jaxmice.jax.org/strain/004146.html, accessed 16 December 2013).  /n  Rescue: -  /n  Model Summary: We have created Purkinje cell-selective p75NTR knockout mice that are the progeny of hemizygous Cre-Purkinje cell protein 2 C57Bl mice and p75NTR floxed C57Bl mice. These Cre-loxP mice exhibit complete knockout of p75NTR in ~50% of the cerebellar Purkinje cells. Relative to Cre-only mice and wild-type C57Bl mice, this results in a behavioral phenotype characterized by less allogrooming of (P<0.05; one-way analysis of variance) and socialization or fighting with (each P<0.05) other mice; less (1.2-fold) non-ambulatory exploration of their environment than wild-type (P<0.01) or Cre only (P<0.01) mice; and almost twofold more stereotyped jumping behavior than wild-type (P<0.05) or Cre (P<0.02) mice of the same strain. Wild-type mice have more complex dendritic arborization than Cre-loxP mice, with more neurites per unit area (P<0.025, Student's t-test), more perpendicular branches per unit area (P<0.025) and more short branches/long neurite (P<0.0005).	amyloid-beta binding,death receptor activity,neurotrophin TRKA receptor binding,protein binding,calmodulin binding,coreceptor activity,small GTPase binding,ubiquitin protein ligase binding,identical protein binding,neurotrophin binding,protein-containing complex binding,nerve growth factor binding,preprotein binding	Ani
Dio2	DIO2	protein-coding	Mus musculus	ENSMUSG00000007682	5DII|DIOII	13371	Motor Disorders	12|12 D3	Knockout	C57BL/6	25083788	342	Expeimentalparadigm: Footprint test  /n  Model Generation: D2Knockout mice and wild-type (WT) counterparts were initially provided by Dr. Galton<U+00A0>[18]<U+00A0>and a colony was established at Instituto de Investigaciones Biomédicas (Madrid, Spain).<U+00A0>Dio2<U+00A0>mutation was backcrossed for 3 further generations onto the C57BL/6 background.  /n  Rescue: -  /n  Model Summary: The motor alterations observed in D2Knockout mice indicate an important role for D2 in T3 availability to maintain motor function and muscle strength. Our results suggest a possible implication of D2 in motor disorders.	thyroxine 5'-deiodinase activity,oxidoreductase activity,ubiquitin protein ligase binding,thyroxine 5-deiodinase activity	Ani
Dcdc2a	DCDC2	protein-coding	Mus musculus	ENSMUSG00000035910	AW492955|Dcdc2|RU2	195208	Developmental Dyslexia	13|13 A3.1	Knockout	129SJ;C57BL/6J<U+00A0>	25130614	343	Expeimentalparadigm: Pre-pulse inhibition test//Radial arm maze//Rotarod  /n  Model Generation: Dcdc2<U+00A0>knocKnockoutut mice (Dcdc2del2/del2) carried a constitutive homozygous deletion of exon 2 (del2) within the<U+00A0>Dcdc2<U+00A0>gene region of a 129SJ x C57BL/6J hybrid background backcrossed to C57BL/6J for 10 generations (Wang et al., 2011<U+00A0>for detailed<U+00A0>Dcdc2<U+00A0>gene targeting and RT-PCR analysis). All subjects were generated from the<U+00A0>Dcdc2<U+00A0>colony maintained by AC/JJL at the University of Connecticut using a heterozygous-heterozygous (Dcdc2wt/del2<U+00A0>×<U+00A0>Dcdc2wt/del2) mating scheme with resultant genotypes recovered in the expected mendelian ratios (1:2:1).  /n  Rescue: -  /n  Model Summary: Behavioral results revealed deficits in rapid auditory processing, working memory, and reference memory in<U+00A0>Dcdc2del2/del2<U+00A0>mice as compared to matched wild types. Current findings parallel clinical research linking genetic variants of<U+00A0>DCDC2<U+00A0>with specific impairments of phonological processing and memory ability.	molecular_function,kinesin binding	Ani
Atg7	ATG7	protein-coding	Mus musculus	ENSMUSG00000030314	1810013K23Rik|Agp7|Apg7l|Atg7l|Gm21553	74244	Autism Spectrum Disorder	6|6 E3	Conditional Knockout	C57BL/6	25155956	344	Expeimentalparadigm: Novel object recognition test//Three-chamber test//Anxiety-like behaviors//Exploratory locomotion behaviors//Self-grooming behavior  /n  Model Generation: we generated forebrain excitatory neuronal specific autophagy-deficient mice by crossing<U+00A0>Atg7flox/flox<U+00A0>mice to<U+00A0>CamKIIa-cre mice. Atg7 is an E1-like activating enzyme required for autophagosome formation  /n  Rescue: -  /n  Model Summary: In<U+00A0>Tsc2+/- ASD mice where mTOR is constitutively overactive, we observed postnatal spine pruning defects, blockade of autophagy, and ASD-like social behaviors.<U+00A0>	protein binding,ubiquitin-like modifier activating enzyme activity,Atg12 activating enzyme activity,Atg8 activating enzyme activity,protein homodimerization activity	Ani
Chga	CHGA	protein-coding	Mus musculus	ENSMUSG00000021194	ChrA|cgA	12652	Aggressive Behaviors	12 E|12 51.66 cM	Knockout	C57BL/6J	25257107	345	Expeimentalparadigm: Accelerated rotarod//Light–dark box//Marble burying test//Morris water maze//Open field test//Forced swimming test//Resident-intruder test//Shuttle-box active avoidance learning test  /n  Model Generation: The methods to generate the CgA-, CgB- and CgA&B-KO mice have been described previously [9], [30], [31], [32], [33]. Briefly, a C57BL/6J mouse strain blastocyst was chosen for implantation of successfully targeted embryonic stem (ES) cells with a completely inactivated Chga allele. ES cells came from mouse strain CJ7, derived from 129/Sv mice. After suitable germ-line tests for transmission of the targeted transgene (backcrossing to the wild-type strain C57BL/6J), heterozygotes (Chga +/-; background strain 129/Sv) were mated to yield F1 generation. F1 generation animals were later inbred for seven generations to establish Chga -/- mouse line. Chga mouse line parents were Chga+/+ -/- littermates and, therefore, they were siblings with identical genomes. The WT (Chga ) mouse and KO mouse (Chga+/+ -/-) used, are descended from these two homogeneous mouse lines generated by systematic inbreeding. One-month-old mice were genotyped by PCR using genomic DNA extracted from tail snips. The absence of CgA protein expression in the adrenal medulla was confirmed by immunoblot and immunocytochemistry.  /n  Rescue: -  /n  Model Summary: We have used three different genetic mutant models of mice lacking chromogranin A, chromogranin B and both all on the same C57BL/6J background, to characterize the physiological roles of these proteins using metabolic, cardiovascular and behavioural tests. In mice from 3 to 18 months of age, the lack of any chromogranin promoted age-dependent hypersensitivity to insulin, while the lack of both chromogranins provoked progressive lack of response to stress, as restriction did not promote tachycardia in old mice. Moreover, the lack of chromogranin B produced a depressive-like and aggressive phenotype, while the lack either or both chromogranins increased barbering behaviour. In addition, we observed no effects on light-dark box or RotaRod tests. Mice lacking chromogranin B exhibited lower exploratory activity.	protein binding	Ani
Chgb	CHGB	protein-coding	Mus musculus	ENSMUSG00000027350	Scg-1|cgB|sgI	12653	Aggressive Behaviors	2 F2|2 64.74 cM	Knockout	C57BL/6J	25257107	346	Expeimentalparadigm: Accelerated rotarod//Light–dark box//Marble burying test//Morris water maze//Open field test//Forced swimming test//Resident-intruder test//Shuttle-box active avoidance learning test  /n  Model Generation: The methods to generate the CgA-, CgB- and CgA&B-KO mice have been described previously [9], [30], [31], [32], [33]. Briefly, a C57BL/6J mouse strain blastocyst was chosen for implantation of successfully targeted embryonic stem (ES) cells with a completely inactivated Chga allele. ES cells came from mouse strain CJ7, derived from 129/Sv mice. After suitable germ-line tests for transmission of the targeted transgene (backcrossing to the wild-type strain C57BL/6J), heterozygotes (Chga +/-; background strain 129/Sv) were mated to yield F1 generation. F1 generation animals were later inbred for seven generations to establish Chga -/- mouse line. Chga mouse line parents were Chga+/+ -/- littermates and, therefore, they were siblings with identical genomes. The WT (Chga ) mouse and KO mouse (Chga+/+ -/-) used, are descended from these two homogeneous mouse lines generated by systematic inbreeding. One-month-old mice were genotyped by PCR using genomic DNA extracted from tail snips. The absence of CgA protein expression in the adrenal medulla was confirmed by immunoblot and immunocytochemistry.  /n  Rescue: -  /n  Model Summary: We have used three different genetic mutant models of mice lacking chromogranin A, chromogranin B and both all on the same C57BL/6J background, to characterize the physiological roles of these proteins using metabolic, cardiovascular and behavioural tests. In mice from 3 to 18 months of age, the lack of any chromogranin promoted age-dependent hypersensitivity to insulin, while the lack of both chromogranins provoked progressive lack of response to stress, as restriction did not promote tachycardia in old mice. Moreover, the lack of chromogranin B produced a depressive-like and aggressive phenotype, while the lack either or both chromogranins increased barbering behaviour. In addition, we observed no effects on light-dark box or RotaRod tests. Mice lacking chromogranin B exhibited lower exploratory activity.	protein binding	Ani
Foxp1	FOXP1	protein-coding	Mus musculus	ENSMUSG00000030067	3110052D19Rik|4932443N09Rik	108655	Neurodevelopmental Disorders	6|6 D3	Conditional Knockout	C57BL/6	25266127	347	Expeimentalparadigm: Locomotor activity//Non-spatial and spatial short-term memory//Open field test//Nest building test//Nest building behaviour//Elevated plus maze  /n  Model Generation: Homozygous floxed<U+00A0>Foxp1<U+00A0>mice17<U+00A0>were crossed with Nestin-Cre deleter mice18<U+00A0>heterozygous for the floxed<U+00A0>Foxp1<U+00A0>allele, producing 25% homozygous<U+00A0>Foxp1<U+00A0>KO, 25% heterozygous<U+00A0>Foxp1<U+00A0>KO and 50% wild-type (WT) offspring.  /n  Rescue: -  /n  Model Summary: The behavioural and physiological abnormalities in<U+00A0>Foxp1<U+00A0>KO mice are consistent with ASD-like phenotypes in other mouse models of ASD, support findings in human patients with<U+00A0>FOXP1<U+00A0>mutations and open up new opportunities for translational investigations.	transcription cis-regulatory region binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,core promoter sequence-specific DNA binding,transcription coregulator binding,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,chromatin binding,DNA-binding transcription factor activity,protein binding,identical protein binding,sequence-specific DNA binding,protein self-association,metal ion binding,nuclear androgen receptor binding,sequence-specific double-stranded DNA binding	Ani
Efna2	EFNA2	protein-coding	Mus musculus	ENSMUSG00000003070	CEK7L|Elf1|Epl6|Eplg6|Lerk6	13637	Autism Spectrum Disorder	10 C1|10 39.72 cM	Conditional Knockout	C57BL/6;Swiss Webster	25281279	348	Expeimentalparadigm: Open field test//Elevated plus//Marble burying test//Grooming//Prepulse inhibition//Acoustic startle response//Three-chamber test//Morris water maze//Acquisition training//Probe Trial//Visible Platform Trial//Reversal Trial//Fear conditioning test  /n  Model Generation: Founder mice for the ephrin-A2-/-A3-/- (ephrin-A2/3 double knockout; “DKO”) and ephrin-A2A3 (wildtype; “WT”) mice were generously provided by Dr. David Feldheim at UC, Santa Cruz. Founding breeders were on a mixed Swiss-Webster/C57BL-6/129 background and contained various combinations of gene deletions for ephrin-A2, ephrin-A3, and ephrin-A5. The original ephrin-A2 mutant mice were generated on a Swiss-Webster mouse strain background by Feldheim et al. [20]. Ephrin-A3 mutant mice were generated on a C57BL-6 strain background as described in Cutforth et al. [30]. The Ephrin-A5 mutant mice were generated in mice of a 129 strain background as described by Frisén et al. [21]. For a parallel set of physiological and anatomical experiments (manuscripts in preparation), the ephrin-A mouse colony was also crossed with mice that contained transgenes for either D1-tomato (BAC-Drd1a-tomato [31] courtesy of Dr. Calakos, Duke University), D2-EGFP (BAC-Drd2-EGFP [32] courtesy of Dr. Lovinger, National Institutes of Health), or EphA2-EGFP [MMRRC Tg(EphA2-EGFP)DE51Gsat/Mmmh; Stock #000298-MU]. These mice also were on either a C57BL-6 or a Swiss-Webster background. Since individuals with ASD comprise a heterogeneous genetic population, we decided to maintain our colony on a C57BL-6/Swiss-Webster hybrid background so the effects of the genetic background of a single strain would not bias our results. As performance on many common behavioral assays can vary between inbred strains [33-35], genetic drift between the DKOs and WTs was minimized by interbreeding these mice and then limiting the number of subsequent breeding cycles for each genotype to a maximum of 3 generations before back-crossing with mice from an earlier generation.  /n  Rescue: -  /n  Model Summary: To better characterize a potential role for these ligands in ASDs, we performed a comprehensive behavioral characterization of anxiety-like, sensorimotor, learning, and social behaviors in ephrin-A2/-A3 double knockout (DKO) mice. The predominant phenotype in DKO mice was repetitive and self-injurious grooming behaviors such as have been associated with corticostriatal circuit abnormalities in other rodent models of neuropsychiatric disorders. Consistent with ASDs specifically, DKO mice exhibited decreased preference for social interaction in the social approach assay, decreased locomotor activity in the open field, increased prepulse inhibition of acoustic startle, and a shift towards self-directed activity (e.g., grooming) in novel environments, such as marble burying.	protein binding,ephrin receptor binding	Ani
Efna3	EFNA3	protein-coding	Mus musculus	ENSMUSG00000028039	EFL-2|Ehk1-L|Epl3|LERK-3	13638	Autism Spectrum Disorder	3 F1|3 39.06 cM	Conditional Knockout	C57BL/6;Swiss Webster	25281279	349	Expeimentalparadigm: Open field test//Elevated plus//Marble burying test//Grooming//Prepulse inhibition//Acoustic startle response//Three-chamber test//Morris water maze//Acquisition training//Probe Trial//Visible Platform Trial//Reversal Trial//Fear conditioning test  /n  Model Generation: Founder mice for the ephrin-A2-/-A3-/- (ephrin-A2/3 double knockout; “DKO”) and ephrin-A2A3 (wildtype; “WT”) mice were generously provided by Dr. David Feldheim at UC, Santa Cruz. Founding breeders were on a mixed Swiss-Webster/C57BL-6/129 background and contained various combinations of gene deletions for ephrin-A2, ephrin-A3, and ephrin-A5. The original ephrin-A2 mutant mice were generated on a Swiss-Webster mouse strain background by Feldheim et al. [20]. Ephrin-A3 mutant mice were generated on a C57BL-6 strain background as described in Cutforth et al. [30]. The Ephrin-A5 mutant mice were generated in mice of a 129 strain background as described by Frisén et al. [21]. For a parallel set of physiological and anatomical experiments (manuscripts in preparation), the ephrin-A mouse colony was also crossed with mice that contained transgenes for either D1-tomato (BAC-Drd1a-tomato [31] courtesy of Dr. Calakos, Duke University), D2-EGFP (BAC-Drd2-EGFP [32] courtesy of Dr. Lovinger, National Institutes of Health), or EphA2-EGFP [MMRRC Tg(EphA2-EGFP)DE51Gsat/Mmmh; Stock #000298-MU]. These mice also were on either a C57BL-6 or a Swiss-Webster background. Since individuals with ASD comprise a heterogeneous genetic population, we decided to maintain our colony on a C57BL-6/Swiss-Webster hybrid background so the effects of the genetic background of a single strain would not bias our results. As performance on many common behavioral assays can vary between inbred strains [33-35], genetic drift between the DKOs and WTs was minimized by interbreeding these mice and then limiting the number of subsequent breeding cycles for each genotype to a maximum of 3 generations before back-crossing with mice from an earlier generation.  /n  Rescue: -  /n  Model Summary: To better characterize a potential role for these ligands in ASDs, we performed a comprehensive behavioral characterization of anxiety-like, sensorimotor, learning, and social behaviors in ephrin-A2/-A3 double knockout (DKO) mice. The predominant phenotype in DKO mice was repetitive and self-injurious grooming behaviors such as have been associated with corticostriatal circuit abnormalities in other rodent models of neuropsychiatric disorders. Consistent with ASDs specifically, DKO mice exhibited decreased preference for social interaction in the social approach assay, decreased locomotor activity in the open field, increased prepulse inhibition of acoustic startle, and a shift towards self-directed activity (e.g., grooming) in novel environments, such as marble burying.	ephrin receptor binding	Ani
Tsc1	TSC1	protein-coding	Mus musculus	ENSMUSG00000026812	-	64930	Autism Spectrum Disorder	2|2 A3	Conditional Knockout	C57BL/6	25315683	350	Expeimentalparadigm: Three-chamber test//Marble burying test  /n  Model Generation: Tsc1 mice (31)[from The Jackson Laboratory (Bar Harbor, ME)] were crossed with CaMKIIα-Cre mice [strain T29-1 (Tsien et al., 1996)] or Slc6a4-Cre mice[from Mutant Mouse Region Resource Center (MMRRC) (UC Davis, CA)]. The CaMKIIα-Cre line was received and maintained on a C57BL/6J background. The Tsc1 line was received on a mixed background (C57BL/6J, BALB/cJ, and 129/SvJae) and was backcrossed onto C57BL/J6 for 8 generations in our lab. The Slc6a4-Cre mice were on a C57BL/6J background.  /n  Rescue: Tsc1flox/flox;Slc6a4-cre mice displayed alterations of the 5-HT system and autism-like behaviors, without causing epilepsy.  /n  Model Summary: We find that epileptiform activity propagates to the raphe nuclei, resulting in seizure-dependent hyperactivation of mTOR in 5-HT neurons. To dissect whether mTOR hyperactivity in 5-HT neurons alone was sufficient to recapitulate an autism-like phenotype we utilized Tsc1flox/flox;Slc6a4-cre mice, in which mTOR is restrictively hyperactivated in 5-HT neurons.	protein binding,Hsp70 protein binding,GTPase activating protein binding,ATPase inhibitor activity,protein-containing complex binding,protein N-terminus binding,chaperone binding,Hsp90 protein binding	Ani
Grin2b	GRIN2B	protein-coding	Mus musculus	ENSMUSG00000030209	GluN2B|GluRepsilon2|NR2B|Nmdar2b	14812	Aggressive Behaviors	6 G1|6 66.38 cM	Knockdown	C57BL/6JNarl	25348768	351	Expeimentalparadigm: Open field test//Locomotion test//Forced swimming test//Startle response and prepulse inhibition//Open field test//Resident-intruder test  /n  Model Generation: After 7 weeks of isolation, the SI mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and mounted on a stereotaxic apparatus (Kopf). The mice were implanted with cannulas (26 gauge stainless steel tubing) into the ventral hippocampus (anterioposterior, -3.0 mm; mediolateral, ±3.2 mm; dorsoventral, -4.0 mm). After 7 days of recovery, the mice received acute stress followed by an RI test. Another 3 days later, a volume of 1.0 μl of either MK-801, ifenprodil, or vehicle was administered bilaterally into the ventral hippocampus at a rate of 0.1 μl/min. Thirty minutes after infusion, the mice were given acute stress followed by an RI test.  /n  Rescue: -  /n  Model Summary: In the present study, mice on postnatal day 21-28 were randomly assigned to either a group or isolated cages for 8 weeks. The socially isolated (SI) mice exhibited a higher level of spontaneous locomotor activity, a longer duration of immobility in the forced swimming test (FST), significantly less prepulse inhibition (PPI) and an increase in aggressive (but not attack) behavior. However, acute stress markedly exacerbated the attack counts of the SI mice but did not affect the group housing (GH) mice. SI mice exhibited higher synaptosomal NR2A and NR2B levels in the hippocampus as compared to the GH mice. Whole-cell patch clamp recordings of CA1 neurons in hippocampal slices showed that the SI mice exhibited a higher input-output relationship of NMDAR-EPSCs as compared to the GH mice. Application of the NR2B -specific antagonist ifenprodil produced a greater attenuating effect on NMDAR-EPSCs in slices from the SI mice. NMDAR EPSCs recorded from the SI mice had a slower deactivation kinetic. MK-801, CPP and ifenprodil, the NMDA antagonists, reversed acute stress-induced exaggeration of aggressive and depressive behaviors. Furthermore, acute stress-induced exacerbation of attack behavior in the SI mice was abolished after the knockdown of NR2B expression.	ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,interleukin-1 receptor binding,ion channel activity,extracellularly glutamate-gated ion channel activity,cation channel activity,calcium channel activity,protein binding,beta-catenin binding,zinc ion binding,ligand-gated ion channel activity,glycine binding,glutamate binding,glutamate-gated calcium ion channel activity,D2 dopamine receptor binding,ionotropic glutamate receptor binding,small molecule binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,metal ion binding,cell adhesion molecule binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
stxbp1a	STXBP1	protein-coding	Zebrafish	ENSDARG00000001994	fj43h10|stxbp1|wu:fj36d12|wu:fj43h10|zgc:114171	574003	Neurodevelopmental Disorders	-	Knockdown(MO)	AB	25362483	352	Expeimentalparadigm: Open field test  /n  Model Generation: To perform stx1b knockdown in zebrafish embryos, we used morpholino antisense oligonucleotides17,44 designed to target the region spanning the 5′ UTR and/or translational start site in stx1b mRNA, thus blocking translation and leading to a complete or partial loss of syntaxin-1B protein levels. Morpholinos were synthesized by GeneTools. Two different translation-blocking morpholinos were designed to target bases –11 to +14 (stx1b-MO) and –47 to –23 (stx1b-MO2) of the zebrafish stx1b mRNA (Supplementary Table 12). A control morpholino (randomized 25-nucleotide sequence) was used as a negative control (ctrl-MO). Gene knockdown was achieved through microinjection of embryos from the AB (wild-type) strain at the one- to two-cell stage with 2 nl of morpholino according to the previously described method. We titrated the amount of stx1b-MO to 3 ng per injection and the amount of stx1b-MO2 to 7 ng per injection. The same amount of randomized control morpholino as the corresponding stx1b morpholino was used for injection.  /n  Rescue: Wild-type human syntaxin-1B but not a mutated protein rescued the effects of stx1b knockdown in zebrafish.  /n  Model Summary: Here we report the identification of mutations in STX1B, encoding syntaxin-1B, that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations and a de novo microdeletion encompassing STX1B were then identified in 449 familial or sporadic cases. Video and local field potential analyses of zebrafish larvae with antisense knockdown of stx1b showed seizure-like behavior and epileptiform discharges that were highly sensitive to increased temperature.	syntaxin-1 binding,syntaxin binding	Ani
Nrxn2	NRXN2	protein-coding	Mus musculus	ENSMUSG00000033768	6430591O13Rik|mKIAA0921	18190	Autism Spectrum Disorder	19 A|19	Knockout	C57BL/6J	25423136	353	Expeimentalparadigm: Open field test//Elevated plus maze//Forced swim test//Social interaction//Emergence test//Novelty object recognition test//Prepulse inhibition//Passive avoidance  /n  Model Generation: B6;129-Nrxn3tm1Sud/Nrxn1tm1Sud/Nrxn2tm1Sud/J mice (JAX #006377) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) as heterozygous KO at Nrxn1, homozygous KO at Nrxn2 and wild-type at Nrxn3. We subsequently outbred to the C57BL/6NCrl strain (Charles River, Margate, UK) to obtain mice that were Nrxn2α KO heterozygotes, but wild-type at Nrxn1 and Nrxn3. Nrxn2α KO heterozygotes were then intercrossed to obtain wild-type (WT) and KO littermates.  /n  Rescue: -  /n  Model Summary: We report that Nrxn2α KO mice displayed deficits in sociability and social memory when exposed to novel conspecifics. In tests of exploratory activity, Nrxn2α KO mice displayed an anxiety-like phenotype in comparison with wild-type littermates, with thigmotaxis in an open field, less time spent in the open arms of an elevated plus maze, more time spent in the enclosure of an emergence test and less time spent exploring novel objects. However, Nrxn2α KO mice did not exhibit any obvious changes in prepulse inhibition or in passive avoidance learning.	transmembrane signaling receptor activity,calcium channel regulator activity,protein binding,metal ion binding,cell adhesion molecule binding,neuroligin family protein binding	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Attention-Deficit/Hyperactivity Disorder	X A7.1|X 34.83 cM	Knockout	C57BL/6J	25433180	354	Expeimentalparadigm: Open field test  /n  Model Generation: Subjects were the offspring of eleven litters from four breeding pairs obtained from Dr. James Malter’s laboratory at the University of Wisconsin, Waisman Center. The Fmr1 KO mice were generated by William Greenough (University of Illinois) and backcrossed 6 times to C57BL/6J mice. Breeding pairs consisted of a female heterozygous for the null mutation in Fmr1 and a male wild type. Breeding in this manner produced male offspring that were either wild type (WT) or hemizygous for the null mutation (Fmr1 KO), and these males were used in the experiments described below.  /n  Rescue: We found that clonidine reduces motor activity in both WT and Fmr1 KO mice, but that the effect is delayed in the knockouts. Methylphenidate increased motor activity similarly in both genotypes. Future research should include evaluations of additional drugs (e.g., aripiprazole) prescribed to those with FXS [13] as well as the effects of chronic administration of drugs on the Fmr1 KO behavioral phenotype.  /n  Model Summary: The Fmr1 knockout (KO) mouse has been found to be a valid model for FXS both biologically and behaviorally. Of particular interest to our research, the Fmr1 KO mouse has been demonstrated to show increased locomotion in comparison to wild type (WT) littermates. In the present study, we assessed the effects of clonidine (0.05 mg/kg) and methylphenidate (5 mg/kg) on motor activity in Fmr1 KO mice and their WT littermates in the open field test. Results showed that methylphenidate increased motor activity in both genotypes. Clonidine decreased motor activity in both genotypes, but the effect was delayed in the Fmr1 KO mice.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Chrm4	CHRM4	protein-coding	Mus musculus	ENSMUSG00000040495	Chrm-4|M4	12672	Alcohol Use Disorder	2 E1|2 50.63 cM	Knockout	129SvEv/CF1;C57BL/6Ntac	25445043	355	Expeimentalparadigm: Operant alcohol self-administration//Alcohol-seeking behavior  /n  Model Generation: Male M4<U+2212>/<U+2212><U+00A0>mice were bred at the Panum Institute, University of Copenhagen. Founder mice of mixed genetic background (129SvEv/CF1) were backcrossed to the C57BL/6Ntac strain for 13 generations<U+00A0>  /n  Rescue: -  /n  Model Summary: Enhanced self-administration of alcohol in muscarinic acetylcholine M4<U+00A0>receptor knocKnockoutut mice	G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,guanyl-nucleotide exchange factor activity,G protein-coupled acetylcholine receptor activity,neurotransmitter receptor activity	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6	25450119	356	Expeimentalparadigm: Light-dark box test//5-Choice serial reaction time task  /n  Model Generation: NK1R-/- mice and their wildtype counterparts were bred at University College London in a facility held at 21 ± 2 °C, 45 ± 5% humidity, with a 12:12 h light: dark cycle (07.00–19.00 h). The home-cages incorporated environmental enrichment (cardboard tunnels and nesting material (LBS Biotechnology, UK)) and were cleaned twice-weekly (bedding obtained from Litaspen Premium (Lillico)). Rodent chow was obtained from Harlan UK (2018 global Rodent Diet). All the mice derived from inbred homozygous strains (see: Yan et al., 2010, Pillidge et al., 2014) and were of a 129/Sv × C57BL/6J background, backcrossed with an outbred MF1 strain many generations ago (de Felipe et al., 1998).  /n  Rescue: Atomoxetine reduced the hyperactivity displayed by NK1R(-/-) mice in the LDEB at a dose (3mg/kg) which did not affect the locomotor activity of wildtypes. Atomoxetine (10mg/kg) also reduced impulsivity in NK1R(-/-) mice, but not wildtypes, in the 5-CSRTT. No dose of drug affected attention in either genotype.  /n  Model Summary: Mice with functional ablation of the neurokinin-1 receptor gene (NK1R(-/-)) display behavioural abnormalities which resemble the hyperactivity, inattention and impulsivity seen in Attention Deficit Hyperactivity Disorder (ADHD).	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Dlg4	DLG4	protein-coding	Mus musculus	ENSMUSG00000020886	Dlgh4|PSD-95|PSD95|SAP90|SAP90A	13385	Posttraumatic Stress Disorder	11|11 B3	Knockdown	C57BL/6J	25510511	357	Expeimentalparadigm: Pavlovian fear conditioning  /n  Model Generation: PSD-95GK<U+00A0>mutant mice were engineered with a disruption of the guanylate kinase (GK) domain of the PSD-95 (Dlg4) gene and have been previously reported<U+00A0>33,<U+00A0>35,<U+00A0>36. In other models, shRNA knockdown or mutation of the PSD-95 GK domain disrupts NMDAR-mediated AMPAR endocytosis and LTD<U+00A0>21. PSD-95GK<U+00A0>were repeatedly backcrossed onto a C57BL/6J background. Analysis of 150 SNP markers at ~15–20 megabase intervals across all autosomal chromosomes confirmed 95% C57BL/6J congenicity (JRS Allele Typing Services, The Jackson Laboratory, Bar Harbor, ME).  /n  Rescue: -  /n  Model Summary: Collectively, these data identify PSD-95 in the IL as a critical mechanism supporting the durability of fear memories over time.	signaling receptor binding,frizzled binding,structural molecule activity,protein binding,protein C-terminus binding,immunoglobulin binding,kinesin binding,kinase binding,protein kinase binding,protein phosphatase binding,PDZ domain binding,beta-1 adrenergic receptor binding,beta-2 adrenergic receptor binding,D1 dopamine receptor binding,P2Y1 nucleotide receptor binding,acetylcholine receptor binding,glutamate receptor binding,ionotropic glutamate receptor binding,neurexin family protein binding,protein-containing complex binding,neuroligin family protein binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Npas4	NPAS4	protein-coding	Mus musculus	ENSMUSG00000045903	LE-PAS|Nxf	225872	Major Depressive Disorder	19|19 A	Mutated	C57BL/6J	25549857	358	Expeimentalparadigm: Open field test//Elevated zero maze//Forced swim test//Saccharin preference test//Y-maze//Sociability test  /n  Model Generation: The transgenic mouse Npas4tm1Meg (MGI:3828099), established on a C57BL/6J background was a gift from Prof. Yingxi Lin [2]. Npas4-RNAi, 5′-GGTTGACCCTGATAATTTA-3′, and control-RNAi with a scrambled sequence (underlined), 5′-GGTTCAGCGTCATAATTTA-3′, were cloned into the pSuper expression vector (OligoEngine). The same Npas4-RNAi was used to generate the lentivirus construct (Cellogenetics, Inc). The control lentivirus construct, pLenti-shGL3 (Cellogenetics, Inc), targets the luciferase gene, which is not expressed by mouse hippocampal neurons. The Npas4-minigene was generated by subcloning the mouse genomic region from CTCGGTTTCTATCTTCATGCC to GCCATGTGGCCTGCCGGTAC into a pBluescriptIIk<U+2009>+<U+2009>vector between the SacII and KpnI digestion sites. The sequence targeted by Npas4-RNAi was mutated to AgtCgaTccCgataattta, preserving the amino-acid sequence, to generate an RNAi-resistant Npas4-minigene. The Npas4 luciferase reporter was constructed by replacing the tandem MEF2 responsive elements with three copies of the Npas4 responsive element28 in the 3×MRE-luc plasmid50.  /n  Rescue: -  /n  Model Summary: Behavioural characterisation of Npas4(-/-), Npas4(+/-) and Npas4(+/+) mice has been conducted using the open field, elevated zero maze (EZM), Y-maze, sociability test and forced swim test (FST) to investigate a range of behaviours. Npas4(-/-) mice spent more time in the open arm of the EZM than other genotypes, suggesting decreased anxiety-like behaviour. Npas4(+/-) mice, however, were more immobile in the FST than other genotypes, suggesting increased depression-like behaviour, and also showed impaired spatial recognition memory in the Y-maze. There were no differences between genotype in social behaviour.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,protein binding,protein-containing complex binding,protein heterodimerization activity,protein dimerization activity	Ani
Clock	CLOCK	protein-coding	Mus musculus	ENSMUSG00000029238	5330400M04Rik|KAT13D	12753	Bipolar Disorder	5 C3.3|5 40.63 cM	Mutated	C57BL/6	25560763	359	Expeimentalparadigm: Locomotion test//Elevated plus maze//Open field test//Light-dark test//Forced swim test//Tail suspension test//Sucrose preference test  /n  Model Generation: ClockΔ19 mutant mice were created by N-ethyl-N-nitrosurea mutagenesis that produces a dominant-negative CLOCK protein defective in transcriptional activity5. For all experiments using ClockΔ19 mutants, adult male mutant (Clock/Clock) and wild-type (+/+) littermate controls, on a mixed BALBc, C57BL/6 background, were group housed in sets of 2–4 per cage.  /n  Rescue: -  /n  Model Summary: Here, we find that mice with a mutation in the circadian Clock gene (ClockΔ19) exhibit rapid mood-cycling, with a profound manic-like phenotype emerging during the day following a period of euthymia at night. Mood-cycling coincides with abnormal daytime spikes in ventral tegmental area (VTA) dopaminergic activity, tyrosine hydroxylase (TH) levels and dopamine synthesis. To determine the significance of daytime increases in VTA dopamine activity to manic behaviors, we developed a novel optogenetic stimulation paradigm that produces a sustained increase in dopamine neuronal activity and find that this induces a manic-like behavioral state. Time-dependent dampening of TH activity during the day reverses manic-related behaviors in ClockΔ19 mice. Finally, we show that CLOCK acts as a negative regulator of TH transcription, revealing a novel molecular mechanism underlying cyclic changes in mood-related behavior.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,histone acetyltransferase activity,protein binding,transcription factor binding,transferase activity,acyltransferase activity,chromatin DNA binding,sequence-specific DNA binding,protein dimerization activity,E-box binding,sequence-specific double-stranded DNA binding	Ani
Pten	PTEN	protein-coding	Mus musculus	ENSMUSG00000013663	2310035O07Rik|A130070J02Rik|B430203M17Rik|MMAC1|PTENbeta|TEP1	19211	Autism Spectrum Disorder	19 C1|19 28.14 cM	Knockout	B6.129-Pten<U+00A0>tm1Rps;C57BL/6J	25561290	360	Expeimentalparadigm: Resident–intruder test//Non-agonistic social behaviors//Mutual agonistic behaviors//Agonistic behaviors delivered by resident//Agonistic behaviors delivered by intruder//Non-agonistic social behaviors//Non-social behaviors  /n  Model Generation: Mice of the<U+00A0>B6.129-Ptentm1Rps<U+00A0>line (Podsypanina<U+00A0>et al.<U+00A0>1999) were obtained from the repository at the National Cancer Institute at Frederick, where they were already backcrossed onto a congenic C57BL/6J background by the Donating Investigator. The line has been maintained by backcrossing to C57BL/6J mice for more than 10 generations. Mice used in this study were generated by crossing<U+00A0>Ptentm1Rps/+<U+00A0>(Pten+/<U+2212>) mice with wild-type (Pten+/+) mice.  /n  Rescue: -  /n  Model Summary: Here, we further examine the social behavior of<U+00A0>Pten+/<U+2212><U+00A0>male mice in the resident–intruder test of aggression, using a comprehensive behavioral analysis to obtain an overall picture of the agonistic, non-agonistic and non-social behavior patterns of<U+00A0>Pten+/<U+2212><U+00A0>mice during a free interaction with a novel conspecific.<U+00A0>Pten+/<U+2212><U+00A0>male mice were involved in less aggression than their wild-type littermates.<U+00A0>Pten+/<U+2212><U+00A0>mice also performed less social investigation, including anogenital investigation and approaching and/or attending to the intruder, which is consistent with our previous finding of decreased sociability in the social approach test. In contrast to these decreases in social behaviors,<U+00A0>Pten+/<U+2212><U+00A0>mice showed increased digging.	phosphatidylinositol-3-phosphate phosphatase activity,phosphoprotein phosphatase activity,protein serine/threonine phosphatase activity,protein tyrosine phosphatase activity,platelet-derived growth factor receptor binding,protein binding,anaphase-promoting complex binding,phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity,hydrolase activity,phosphatase activity,myosin phosphatase activity,enzyme binding,protein kinase binding,PDZ domain binding,ionotropic glutamate receptor binding,identical protein binding,inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity,phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity,molecular function inhibitor activity,ubiquitin-specific protease binding,protein tyrosine kinase binding	Ani
Adcy1	ADCY1	protein-coding	Mus musculus	ENSMUSG00000020431	AC1|D11Bwg1392e|I-AC|brl	432530	Attention-Deficit/Hyperactivity Disorder	11 A1|11 4.72 cM	Overexpression	C57BL/6	25568126	361	Expeimentalparadigm: Elevated plus maze test//Open field test// Light-dark test //Tail suspension test//Forced swim test//Novelty-suppressed feeding test//Sucrose preference test//Actogram monitoring in the home cage//Object exploration in an open field//Cliff avoidance  test//Rotarod test//Startle response and prepulse inhibition//Sociability test//Social choice test//Reciprocal interaction test//Resident-intruder aggression test//Olfactory habituation-dishabituation test  /n  Model Generation: Transgenic AC1+ mice overexpress<U+00A0>Acdy1<U+00A0>in the forebrain under α-CaMKII promoter. AC1+ mice and AC1 WT littermates were bred from AC1+ heterozygotes and with AC1 WT mice, as previously reported (Wang et al., 2004;<U+00A0>Shan et al., 2008).<U+00A0>  /n  Rescue: Interestingly, the hyperactivity of AC1+ mice can be corrected by valproate, a mood-stabilizing drug.  /n  Model Summary: Here we report that AC1+ mice exhibit hyperactive behaviors and demonstrate increased impulsivity and reduced sociability. In contrast, AC1 and AC8 double knock-out mice are hypoactive, and exhibit increased sociability and reduced impulsivity.	nucleotide binding,adenylate cyclase activity,calmodulin binding,ATP binding,calcium- and calmodulin-responsive adenylate cyclase activity,lyase activity,phosphorus-oxygen lyase activity,metal ion binding	Ani
Thrb	THRB	protein-coding	Mus musculus	ENSMUSG00000021779	Nr1a2|T3R[b]|T3Rbeta|Thrb1|Thrb2|c-erbAbeta	21834	Attention-Deficit/Hyperactivity Disorder	14|14 A1	Knockout	C57BL/6	25612897	362	Expeimentalparadigm: Open field test  /n  Model Generation: Littermates of TRα0/0<U+00A0>TRβ+/+<U+00A0>(TRα0/0) mice, TRα+/+TRβ<U+2212>/<U+2212><U+00A0>(TRβ<U+2212>/<U+2212>) mice, and wild-type mice (WT) were generated from heterozygous dams and were used in behavioral and neurochemical experiments.  /n  Rescue: -  /n  Model Summary: TRβ<U+2212>/<U+2212><U+00A0>mice, a model of attention-deficit/hyperactivity disorder, showed significantly high exploratory activity and reduced habituation, whereas TRα0/0<U+00A0>mice showed normal exploratory activity.<U+00A0>	RNA polymerase II cis-regulatory region sequence-specific DNA binding,transcription coactivator binding,DNA binding,chromatin binding,double-stranded DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,zinc ion binding,enzyme binding,chromatin DNA binding,identical protein binding,sequence-specific DNA binding,metal ion binding,thyroid hormone binding,sequence-specific double-stranded DNA binding	Ani
Nos1	NOS1	protein-coding	Mus musculus	ENSMUSG00000029361	2310005C01Rik|N-NOS|NC-NOS|NO|NOS|NOS-I|Nos-1|bNOS|nNOS	18125	Attention-Deficit/Hyperactivity Disorder	5 F|5 57.29 cM	Knockout	C57BL/6	25621792	363	Expeimentalparadigm: Open field test//Two-way active avoidance paradigm//Passive avoidance//Spontaneous motor activity  /n  Model Generation: NOS1 KO (B6.129S4-Nos1tm1Plh/J, C57BL/6J congenic strain, Jackson Laboratory, Bar Harbor, Maine, USA) as described previously (Huang, Dawson, Bredt, Snyder, & Fishman, 1993) were used in this experiment. Descendants from the initial heterozygote breeding pairs were used to set up the following breeding schemes: male NOS1-/- × female NOS1-/-, male NOS1-/- × female NOS1-/+, and male NOS1 × female NOS1, to efficiently produce sibling cohorts (KO: NOS1+/++/+-/-; WT: NOS1; HT: NOS1+/++/-) on C57BL/6 background for subsequent experiments.  /n  Rescue: -  /n  Model Summary: In this study, we investigated the behavioral alterations in the neuronal NO synthase knockout mice (NOS1 KO) with a deficient NO production mechanism in the brain, characterizing it as a potential rodent model for attention deficit hyperactivity disorder (ADHD). NOS1 KO exhibited higher locomotor activity than their wildtype counterparts in a novel environment, as measured by open field (OF) test. In a 2-way active avoidance paradigm (TWAA), we found sex-dependent effects, where male KO displayed deficits in avoidance and escape behavior, sustained higher incidences of shuttle crossings, and higher incidences of intertrial interval crossings, suggesting learning, and/or performance impairments.	nitric-oxide synthase activity,protein binding,calmodulin binding,zinc ion binding,FMN binding,oxidoreductase activity,sodium channel regulator activity,enzyme binding,heme binding,identical protein binding,transmembrane transporter binding,cadmium ion binding,metal ion binding,calcium-dependent protein binding,flavin adenine dinucleotide binding,NADP binding,ATPase binding,phosphoprotein binding,NADPH binding,scaffold protein binding	Ani
Bche	BCHE	protein-coding	Mus musculus	ENSMUSG00000027792	C730038G20Rik	12038	Aggressive Behaviors	3|3 E3	Knockout	C57BL/6	25646463	364	Expeimentalparadigm: Aggression test  /n  Model Generation: Adult male C57BL/6 wild-type and BChE-/- mice were obtained from Jackson Labs.  /n  Rescue: -  /n  Model Summary: Consistent with in vitro results, male BALB/c mice with high plasma BChE after gene transfer exhibited sharply reduced plasma ghrelin. Unexpectedly, such animals fought less, both spontaneously and in a resident/intruder provocation model. One mutant BChE was found to be deficient in ghrelin hydrolysis. BALB/c mice transduced with this variant retained normal plasma ghrelin levels and did not differ from untreated controls in the aggression model. In contrast, C57BL/6 mice with BChE gene deletion exhibited increased ghrelin and fought more readily than wild-type animals.	acetylcholinesterase activity,cholinesterase activity,hydrolase activity,choline binding,identical protein binding,carboxylic ester hydrolase activity	Ani
per1b	NA	protein-coding	Zebrafish	ENSDARG00000012499	per4|zfper4	406204	Attention-Deficit/Hyperactivity Disorder	-	Knockout	AB;Per1b mutant lines	25673850	365	Expeimentalparadigm: Long-term monitoring of locomotor activity//Active-avoidance conditioning paradigm for learning and memory activity//Evaluation of retention//Reward-mediated impulsivity evaluation//Mirror-image attack test//Activities in light and dark  /n  Model Generation: Zebrafish, including a wild-type AB strain and per1b mutant lines, are raised at our fish facility according to standard protocols (Westerfield,1993). The zebrafish per1b mutant was generated through a retroviral insertion approach (Golling et al., 2002), whereby the retroviral sequence was inserted into the first intron of the per1b gene.  /n  Rescue: -  /n  Model Summary: Here we found that the zebrafish mutant for the circadian gene period1b (per1b) displays hyperactive, impulsive-like, and attention deficit-like behaviors and low levels of dopamine, reminiscent of human ADHD patients. We found that the circadian clock directly regulates dopamine-related genes monoamine oxidase and dopamine β hydroxylase, and acts via genes important for the development or maintenance of dopaminergic neurons to regulate their number and organization in the ventral diencephalic posterior tuberculum.	transcription cis-regulatory region binding,transcription corepressor binding	Ani
Oxt	OXT	protein-coding	Mus musculus	ENSMUSG00000027301	OT|Oxy	18429	Aggressive Behaviors	2 F1|2 63.24 cM	Knockout	C57BL/6J	25677455	366	Expeimentalparadigm: Elevated plus maze//Open field test//Intermale aggression//Maternal aggression//Maternal retrieval behavior//Olfactory test  /n  Model Generation: We previously reported the creation of a line of mice with loxP sites flanking (flox) the coding sequence of the Oxtr gene (Oxtrflox/flox) (Lee et al., 2008). The development and genotyping of the 5-HT Oxtr KO is similar to that of the forebrain Oxtr line (Lee et al., 2008): the conditional Oxtr KO line (B6.129(SJL)-Oxtrtm1.1Wsy/J) is crossed with a transgenic line expressing Cre recombinase under the control of serotonin transporter [Tg(Slc6a4-cre)ET33Gsat, originally on FVB/N background; generously provided by Charles Gerfen, NIMH; (Gong et al., 2007)]. In this line, the Slc6a4 promoter drives Cre recombinase expression in the serotonergic neurons (Fig. 1, for dorsal and median raphe expression). Both lines were back-crossed for more than 10 generations into the C57BL/6J strain (Jackson Laboratories, Bar Harbor, ME). Cre recombinase recognizes the two loxP sites flanking the Oxtr exons (floxed) and excises the Oxtr sequence resulting in progeny in which the conditional Oxtr allele is inactivated only in the 5-HT neurons. In practical terms, the Oxtrflox/flox male mice were crossed with Oxtr+/flox,cre female mice that had one transgenic allele for Cre. The offspring of this pairing yielded the following genotypes: 1) Oxtrflox/flox, 2) Oxtr+/flox 3) Oxtr+/flox,cre 4) Oxtrflox/flox,cre. The first and second are wildtype (WT), the third is heterozygous (Het) for expression of the Oxtr and Cre in the 5-HT neurons, and the fourth is a KO of the Oxtr (and het for Cre) in 5-HT neurons (hereafter referred to as 5-HT Oxtr KO). Mice were genotyped by PCR as previously described (Lee et al., 2008).  /n  Rescue: -  /n  Model Summary: We hypothesized that oxytocin acts on raphe neurons to influence serotonergically mediated anxiety-like, aggressive and parental care behaviors. We eliminated expression of the oxytocin receptor in raphe neurons by crossing mice expressing Cre recombinase under control of the serotonin transporter promoter (Slc6a4) with our conditional oxytocin receptor knockout line. The knockout mice generated by this cross are normal across a range of behavioral measures: there are no effects for either sex on locomotion in an open-field, olfactory habituation/dishabituation or, surprisingly, anxiety-like behaviors in the elevated O and plus mazes. There was a profound deficit in male aggression: only one of 11 raphe oxytocin receptor knockouts showed any aggressive behavior, compared to 8 of 11 wildtypes. In contrast, female knockouts displayed no deficits in maternal behavior or aggression. Our results show that oxytocin, via its effects on raphe neurons, is a key regulator of resident-intruder aggression in males but not maternal aggression. Furthermore, this reduction in male aggression is quite different from the effects reported previously after forebrain or total elimination of oxytocin receptors. Finally, we conclude that when constitutively eliminated, oxytocin receptors expressed by serotonin cells do not contribute to baseline anxiety-like behaviors or maternal care.	hormone activity,neuropeptide hormone activity,neurohypophyseal hormone activity,oxytocin receptor binding	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6J	25703442	367	Expeimentalparadigm: Light-dark exploration box//5-Choice serial reaction time task  /n  Model Generation: A genomic DNA clone containing exon 1 of the mouse NK1receptor gene was isolated by screening a λ2001 mouse 129 library with a rat NK-1 cDNA probe3. A cassette containing an internal ribosome entry site and the<U+00A0>lacZ<U+00A0>coding sequence11, together with a neomycin-resistance gene expressed from its own promoter, was inserted into the unique<U+00A0>StuI site in exon 1. For negative selection, two copies of an HSV-tk<U+00A0>gene were inserted in the 5′ polylinker11. The vector was linearized and electroporated into HM1 ES cells. G418- and GANC-resistant clones were selected and identified. Two targeted clones were injected into C57BL/6 blastocysts, and chimaeric males were mated with C57BL/6 females. Transmission of the mutant allele was determined by Southern blot analysis of tail DNA. Mice homozygous for the NK1 mutation were produced by crossing heterozygotes.  /n  Rescue: Both antagonists increased the locomotor activity of NK1R-/- mice, but neither affected the wildtypes.  /n  Model Summary: Finally, we tested the effects of captopril on the performance of male NK1R<U+2212>/<U+2212> and wildtype mice in the 5-choice serial reaction-time task (5-CSRTT) and found that ACE inhibition prevented the impulsivity of NK1R<U+2212>/<U+2212> mice.<U+00A0>	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Conditional Knockout	Ms2Yah;Tc1;B6xB6C3B	25706610	368	Expeimentalparadigm: Open filed test//Morris water maze//Rotarod  /n  Model Generation: The Ms2Yah, official name Del(17Abcg1-Cbs)2Yah, mice were generated on 129/Ola ES cells as described previously [16] and backcrossed on the C57BL/6J genetic background at least to N10 in this study [30]. The Tc1 transchromosomic line has been described previously [21]; These mice were kept on an F1 B6C3B background; the C3B are sighted C3H/HeH, a congenic line for the BALB/c allele at the Pde6b gene in C3H/HeH [31]. The two lines were crossed to generate double mutant and control cohorts on a mixed genetic background B6xB6C3B (N2B6C3B) under Specific Pathogen Free conditions.  /n  Rescue: We used the Ms2Yah model carrying a deletion of the corresponding interval in the mouse genome to rescue gene dosage in the Tc1/Ms2Yah compound mice to determine how the different behavioral phenotypes are affected. We detected subtle changes with the Tc1/Ms2Yah mice performing better than the Tc1 individuals in the reversal paradigm of the Morris water maze. We also found that Tc1/Ms2Yah compound mutants performed better in the rotarod than the Tc1 mice. This data support the impact of genes from the Abcg1-U2af1 region as modifiers of Tc1-dependent memory and locomotor phenotypes.  /n  Model Summary: In this report, we confirmed that rescuing the number of copies of Abcg1-U2af1 modulates Tc1-induced phenotypes only slightly, although the region was sufficient alone to induce certain learning and memory deficits [15,16], and as such this genetic interval certainly contributes, along with other regions of Hsa21, to the variability of DS features.	NA	Ani
Gsk3b	GSK3B	protein-coding	Mus musculus	ENSMUSG00000022812	7330414F15Rik|8430431H08Rik|GSK-3|GSK-3beta|GSK3	56637	Bipolar Disorder	16|16 B3	Mutated	C57BL/6	25724980	369	Expeimentalparadigm: Circadian rhythmicity  /n  Model Generation: Wild-type (WT) C57-BL6/J, and GSK3αS21A/S21A and GSK3βS9A/S9A (GSK3-DKI) mice (2-5 months old) backcrossed for at least 10 generations to C57BL/6 mice, in which regulatory serine-alanine substitution on both isoforms of GSK3 rendered GSK3 de-phosphorylated and constitutively active (McManus et al., 2005). Control WT mice were C57BL/6 mice that were age matched (generated within the colony or purchased from Jackson Laboratories, Bar Harbor, ME, USA).  /n  Rescue: -  /n  Model Summary: The purpose of this study was to determine if the endogenous rhythm of GSK3 (α and β) phosphorylation is critical for rhythmic BMAL1 expression and normal amplitude and periodicity of the molecular clock in the SCN. Significant circadian rhythmicity of phosphorylated GSK3 (α and β) was observed in the SCN from wild-type mice housed in constant darkness for 2 weeks. Importantly, chronic activation of both GSK3 isoforms impaired rhythmicity of the GSK3 target BMAL1. Furthermore, chronic pharmacological inhibition of GSK3 with 20 μM CHIR-99021 enhanced the amplitude and shortened the period of PER2::luciferase rhythms in organotypic SCN slice cultures. These results support the model that GSK3 activity status is regulated by the circadian clock and that GSK3 feeds back to regulate the molecular clock amplitude in the SCN.	nucleotide binding,protease binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,integrin binding,protein binding,ATP binding,beta-catenin binding,kinase activity,transferase activity,protein kinase binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding,dynactin binding,ionotropic glutamate receptor binding,tau protein binding,tau-protein kinase activity,NF-kappaB binding,RNA polymerase II-specific DNA-binding transcription factor binding,dynein complex binding,protein serine kinase activity,protein serine/threonine kinase binding	Ani
Nlgn2	NLGN2	protein-coding	Mus musculus	ENSMUSG00000051790	NL2|NLG2	216856	Aggressive Behaviors	11|11 B3	Overexpression	C57BL/6	25765754	370	Expeimentalparadigm: Elevated plus maze//Open field test//Resident–intruder test//Social recognition test//Social preference test  /n  Model Generation: In order to investigate how altered nlgn2 expression affects social behavior, we overexpressed (nlgn2-OE, batch 1) or knocked down (nlgn2-KD, batch 2) nlgn2 in the hippocampus using adeno-associated virus (AAV) constructs in adult mice under basal conditions. Before surgery at the age of 12 weeks, all mice were characterized regarding their anxiety levels in the elevated plus maze (EPM) to assign them to the experimental groups in a balanced fashion. Adult animals in batch 1 were injected with the nlgn2-OE construct (n = 14, one animal was permanently excluded due to stereotypies throughout the experiment) or a control virus not containing the nlgn2 sequence (n = 14). In batch 2, the animals were injected with either a short-hairpin RNA construct (shRNA, n = 14) leading to nlgn2 silencing via RNA interference, or a control virus carrying scrambled shRNA (n = 13). Behavioral testing was performed at the age of 17–18 weeks as described below. Brains were taken for validation of successful virus infection and nlgn2 expression analysis.  /n  Rescue: -  /n  Model Summary: In this study, we show that early-life stress, induced by limited nesting and bedding material, leads to impaired social recognition and increased aggression in adult mice, accompanied by increased expression levels of hippocampal neuroligin-2. Viral overexpression of hippocampal neuroligin-2 in adulthood mimics early-life stress-induced alterations in social behavior and social cognition. Moreover, viral knockdown of neuroligin-2 in the adult hippocampus attenuates the early-life stress-induced behavioral changes. Our results highlight the importance of neuroligin-2 in mediating early-life stress effects on social behavior and social cognition and its promising role as a novel therapeutic target for neuropsychiatric disorders.	protein binding,signaling receptor activity,neurexin family protein binding,identical protein binding,cell adhesion molecule binding	Ani
Nlgn2	NLGN2	protein-coding	Mus musculus	ENSMUSG00000051790	NL2|NLG2	216856	Aggressive Behaviors	11|11 B3	Knockdown	C57BL/6	25765754	371	Expeimentalparadigm: Elevated plus maze//Open field test//Resident–intruder test//Social recognition test//Social preference test  /n  Model Generation: In this study, we aimed to elucidate the potential of nlgn2-KD to attenuate ELS-induced effects on social behavior. Therefore, approximately one half of the litters, derived from in-house breeding, were subjected to the ELS paradigm (described in detail below) or alternatively left in standard housing conditions. After weaning, male mice were single-housed in standard cages throughout the experiment. At the age of 12 weeks, all male mice were characterized regarding their anxiety levels (in the EPM) for a balanced distribution into the respective virus group (nlgn2-KD vs. SCR) within their treatment group (ctl vs. ELS). Animals of both treatment groups were then subjected to surgery for the injection of a virus expressing shRNA leading to the silencing of nlgn2 (nlgn2-KD) or a virus expressing scrambled shRNA (SCR) as a control (nctl-SCR = 15, nctl-nlgn2-KD = 14, nELS-SCR = 16, nELS-nlgn2-KD = 16). After a recovery period of 5 weeks, behavioral testing started as described below. One week after the last test, all animals were killed and brains were taken for the verification of successful virus expression and further gene analyses. Animals without successful virus expression were excluded from the analyses (remaining animals nctl-SCR = 15, nctl-nlgn2-KD = 13, nELS-SCR = 15, nELS-nlgn2-KD = 12).  /n  Rescue: -  /n  Model Summary: In this study, we show that early-life stress, induced by limited nesting and bedding material, leads to impaired social recognition and increased aggression in adult mice, accompanied by increased expression levels of hippocampal neuroligin-2. Viral overexpression of hippocampal neuroligin-2 in adulthood mimics early-life stress-induced alterations in social behavior and social cognition. Moreover, viral knockdown of neuroligin-2 in the adult hippocampus attenuates the early-life stress-induced behavioral changes. Our results highlight the importance of neuroligin-2 in mediating early-life stress effects on social behavior and social cognition and its promising role as a novel therapeutic target for neuropsychiatric disorders.	protein binding,signaling receptor activity,neurexin family protein binding,identical protein binding,cell adhesion molecule binding	Ani
DAT	SLC6A3	protein-coding	Drosophila melanogaster		CG8380|Dat|DmDAT|Dmel\CG8380|Fumin|dDAT|dat|fmn|fumin	36849	Autism Spectrum Disorder	53C7-53C8|2-80 cM	Knockout	Bloomington Indiana (BI) 6326	25774383	372	Expeimentalparadigm: Locomotion test  /n  Model Generation: Flies lacking the<U+00A0>Drosophila<U+00A0>dopamine transporter (DATfmn) (Kume et al., 2005) and flies harboring TH-Gal4 were outcrossed to a control line (Bloomington Indiana (BI) 6326) and selected by PCR or by eye color. TH-GAL4 (Bl 8848) and M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP′} ZH-22A (Bl 24481) were obtained from the BI stock center and outcrossed to flies lacking the<U+00A0>Drosophila<U+00A0>DAT (DATfmn) and carrying the<U+00A0>white<U+00A0>(w1118) mutation (BI stock number 6236) for 5–10 generations. Transgenes (hDAT or hDAT R/W) were cloned into pBI-UASC, and constructs were injected into embryos from M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP′}ZH-22A (Bl 24481). Initial potential transformants were isolated by selecting for red eyes and lack of GFP signal in the head. Transformants were also verified by RFP fluorescence and outcrossed 5–8 times to<U+00A0>DATfmn<U+00A0>flies.  /n  Rescue: -  /n  Model Summary: We expressed hDAT or hDAT R/W in DA neurons of dDAT KO flies as described above. We fed male<U+00A0>Drosophila<U+00A0>a sucrose solution containing either AMPH (1<U+00A0>mM) or vehicle and quantified locomotion in 30-minute intervals. AMPH exposure induced a significantly smaller increase in locomotion in hDAT R/W expressing flies as compared to hDAT expressing flies (Fig.<U+00A0>7C, compare hDAT<U+00A0>+<U+00A0>AMPH versus hDAT R/W<U+00A0>+<U+00A0>AMPH).	dopamine:sodium symporter activity,cocaine binding	Ani
Esrra	ESRRA	protein-coding	Mus musculus	ENSMUSG00000024955	ERRalpha|Err1|Estrra|Nr3b1	26379	Behavioral Disorders	19 A|19 5.08 cM	Knockdown	C57BL/6J	25865889	373	Expeimentalparadigm: Operant responding//Wheel running//Grooming//Home cage activity//Forced swim test //Elevated plus maze//Marble burying test//Social dominance//Three-chamber test//Barnes maze//Novelty object recognition test  /n  Model Generation: Esrra-null and C57BL/6J mice were obtained from Jackson Laboratory and backcrossed more than five generations onto C57BL/6J. All animal procedures were performed in accordance with University of Iowa Institutional Animal Care and Use Committee guidelines. Mice heterozygous for Esrra+/<U+2212><U+00A0>alleles were bred to generate wild-type (Esrra+/+) and Esrra-null (Esrra<U+2212>/<U+2212>) littermate mice.  /n  Rescue: -  /n  Model Summary: Esrra-null female mice display a reduced operant response to a high-fat diet, compulsivity/behavioral rigidity, and social deficits.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,protein binding,zinc ion binding,protein domain specific binding,sequence-specific DNA binding,metal ion binding,sequence-specific double-stranded DNA binding	Ani
syngap1a	SYNGAP1	protein-coding	Zebrafish	ENSDARG00000063713	si:dkeyp-24a7.8	100034485	Neurodevelopmental Disorders	-	Knockdown(MO)	Tg vglut2:dsRed;Tg SaigFF213A	25882707	374	Expeimentalparadigm: Swimming test  /n  Model Generation: Transgenic lines Tg vglut2:dsRed (96) and Tg SaigFF213A (81) were used for all morpholino knockdown experiments.  /n  Rescue: -  /n  Model Summary: Here, we present functional data from syngap1 and shank3 zebrafish loss-of-function models of ASD. SYNGAP1, a synaptic Ras GTPase activating protein, and SHANK3, a synaptic scaffolding protein, were chosen because of mounting evidence that haploinsufficiency in these genes is highly penetrant for ASD and intellectual disability (ID). Orthologs of both SYNGAP1 and SHANK3 are duplicated in the zebrafish genome and we find that all four transcripts (syngap1a, syngap1b, shank3a and shank3b) are expressed at the earliest stages of nervous system development with pronounced expression in the larval brain. Consistent with early expression of these genes, knockdown of syngap1b or shank3a cause common embryonic phenotypes including delayed mid- and hindbrain development, disruptions in motor behaviors that manifest as unproductive swim attempts, and spontaneous, seizure-like behaviors. Our findings indicate that both syngap1b and shank3a play novel roles in morphogenesis resulting in common brain and behavioral phenotypes.	GTPase activator activity	Ani
shank3b	SHANK3	protein-coding	Zebrafish	ENSDARG00000063054	si:dkey-153k10.1	566152	Neurodevelopmental Disorders	-	Knockdown(MO)	Tg vglut2:dsRed;Tg SaigFF213A	25882707	375	Expeimentalparadigm: Swimming test  /n  Model Generation: Transgenic lines Tg vglut2:dsRed (96) and Tg SaigFF213A (81) were used for all morpholino knockdown experiments.  /n  Rescue: -  /n  Model Summary: Here, we present functional data from syngap1 and shank3 zebrafish loss-of-function models of ASD. SYNGAP1, a synaptic Ras GTPase activating protein, and SHANK3, a synaptic scaffolding protein, were chosen because of mounting evidence that haploinsufficiency in these genes is highly penetrant for ASD and intellectual disability (ID). Orthologs of both SYNGAP1 and SHANK3 are duplicated in the zebrafish genome and we find that all four transcripts (syngap1a, syngap1b, shank3a and shank3b) are expressed at the earliest stages of nervous system development with pronounced expression in the larval brain. Consistent with early expression of these genes, knockdown of syngap1b or shank3a cause common embryonic phenotypes including delayed mid- and hindbrain development, disruptions in motor behaviors that manifest as unproductive swim attempts, and spontaneous, seizure-like behaviors. Our findings indicate that both syngap1b and shank3a play novel roles in morphogenesis resulting in common brain and behavioral phenotypes.	synaptic receptor adaptor activity,ionotropic glutamate receptor binding	Ani
Htr1b	HTR1B	protein-coding	Mus musculus	ENSMUSG00000049511	5-HT-1B	15551	Aggressive Behaviors	9 E1|9 44.61 cM	Knockout	NA	25892302	376	Expeimentalparadigm: DRL//Go No-Go paradigm  /n  Model Generation: A vector containing a floxed-tetO-htr1b cDNA-PGK-neo cassette was introduced into the genome through homologous recombination in place of the endogenous htr1b gene coding region (Figure S1). Spatial- and temporal-specific knockdown was achieved through genetic crosses to β-actin-tTS, CaMKII-tTS, and ePet-Cre mice, and by administration of doxycycline to tTS lines.  /n  Rescue: -  /n  Model Summary: 5-HT1BR knockout mice show increased aggression and impulsivity, and 5-HT1BR polymorphisms are associated with aggression and drug addiction in humans. To dissect the mechanisms by which the 5-HT1BR affects these phenotypes, we developed a mouse model to spatially and temporally regulate 5-HT1BR expression. Our results demonstrate that forebrain 5-HT1B heteroreceptors expressed during an early postnatal period contribute to the development of the neural systems underlying adult aggression. However, distinct heteroreceptors acting during adulthood are involved in mediating impulsivity. Correlating with the impulsivity, dopamine in the nucleus accumbens is elevated in the absence of 5-HT1BRs and normalized following adult rescue of the receptor.	G protein-coupled receptor activity,G protein-coupled serotonin receptor activity,neurotransmitter receptor activity,serotonin binding,voltage-gated calcium channel activity involved in regulation of presynaptic cytosolic calcium levels,heterocyclic compound binding	Ani
Gabbr1	GABBR1	protein-coding	Mus musculus	ENSMUSG00000024462	GABAB1|GABAbR1|bM573K1.1	54393	Aggressive Behaviors	17 B1|17 19.16 cM	Conditional Knockout	C57BL/6J	25904796	377	Expeimentalparadigm: Resident-intruder test//Social instigation test  /n  Model Generation: A conditional GABAB receptor allele in mice (GABAB1lox511/lox511) was developed at the University of Basel (Haller et al., 2004), and then backcrossed into C57BL/6J over 10 generations at Nagoya University. The 5-HT transporter (5-HTT)-Cre transgenic (Tg208) mouse expressing the Cre recombinase under the control of putative 5-HTT promoter in the RP23–39F11 BAC clone (Mizuno et al., 2014) was generated at RIKEN BSI (Arakawa et al., 2014, Suzuki et al., 2015). This mouse was generated and has been maintained on a C57BL/6J genetic background. GABAB1lox511/lox511 and 5-HTT-Cre mice were crossed at the NIG to obtain GABAB1+/lox511;5-HTT-Cre mice. Subsequently, we crossed these mice to GABA+B1lox511/lox511 mice to yield GABAB1lox511/lox511;5-HTT-Cre mice (referred to as 5-HTT-GABA+B1-/- or conditional knock-out (cKO) mice in this paper) and GABAB1lox511/lox511;5-HTT-Cre- mice (wild-type control littermates; WT). Genotyping was conducted before weaning using ear punch samples.  /n  Rescue: -  /n  Model Summary: Here, we used a serotonin (5-HT) neuron-specific GABAB receptor knock-out mouse to demonstrate that baclofen acts on nonserotonergic neurons to escalate aggression. Intra-DRN baclofen administration increased glutamate release, but did not alter GABA release, within the DRN. Microinjection of l-glutamate into the DRN escalated dose-dependently attack bites toward an intruder. In vivo microdialysis showed that glutamate release increased in the DRN during an aggressive encounter, and the level of glutamate was further increased when the animal was engaged in escalated aggressive behavior after social instigation. Finally, 5-HT release was increased within the DRN and also in the medial prefrontal cortex when animals were provoked by social instigation, and during escalated aggression after social instigation, but this increase in 5-HT release was not observed when animals were engaged in species-typical aggression.	transmembrane signaling receptor activity,G protein-coupled receptor activity,G protein-coupled GABA receptor activity,protein binding,protein heterodimerization activity,G protein-coupled neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,G protein-coupled neurotransmitter receptor activity involved in regulation of presynaptic membrane potential,extracellular matrix protein binding	Ani
Cirl	ADGRL3	protein-coding	Drosophila melanogaster		ADGRL3|BcDNA:GH07331|CG8639|CIRL|Dmel\CG8639|anon-WO0170980.7|anon-WO0170980.8|dCirl|dcirl	35846	Attention-Deficit/Hyperactivity Disorder	44D4-44D5|2-59 cM	Knockdown	UAS-RNAi	25962619	378	Expeimentalparadigm: Locomotor activity  /n  Model Generation: Conditional knockdown of Drosophila genes was achieved with the UAS-GAL4 system,40 using pan-neuronal drivers (w; UAS-Dcr-2; elav-GAL4 or yw; UAS-Dcr-2 hs(X); n-syb-GAL4) and UAS-RNAi lines.41 A copy of UAS-Dicer-2 was included to improve the efficiency of knockdown.41 UAS-RNAi lines (DAT v106961; Cirl v100749; Nf1 v109637) and lines targeting a set of random control genes (Supplementary Table 1), their genetic background control (v60100) and UAS-Dcr-2 (v60009) were obtained from the Vienna Drosophila RNAi Centre (VDRC).41 UAS-RNAi line (Cirl 27524) and its genetic background control (36303) were obtained from the Bloomington Drosophila stock center (Indiana University).  /n  Rescue: The locomotor signature was not found in control models and could be ameliorated by methylphenidate, validating its relevance to symptoms of the disorder.  /n  Model Summary: The activity profile (Figure 4a) strongly resembled the behavioral signatures exhibited by DAT and latrophilin mutant flies: the phenotype was most prominent during the night, where Δactivity was 10-fold increased and Δsleep fivefold decreased (Figure 4a’). Thus the behavioral signature is present in a monogenic model with increased prevalence of ADHD, strengthening the relevance of the observed Drosophila phenotypes to hallmark behaviors associated with the human condition. We conclude that the DAT-, latrophilin- and Nf1-associated light-dependent hyperactivity and sleep signatures suggest disrupted dopamine signaling and identify a Drosophila ADHD endophenotype.	G protein-coupled receptor activity,latrotoxin receptor activity,carbohydrate binding	Ani
scn1lab	SCN2A	protein-coding	Zebrafish	ENSDARG00000062744	-	559447	Neurodevelopmental Disorders	-	Knockdown(MO)	AB	25965391	379	Expeimentalparadigm: Larval locomotor behavior  /n  Model Generation: 9 ng of a translation blocking MO (ATG MO: 5’-CTGAGCAGCCATATTGACATCCTGC-3’) was used to achieve partial knockdown of zebrafish scn1Lab. Standard control MO (5'-CCTCTTACCTCAGTTACAATTTATA) or randomized 25-N MO was used as a negative control (CTRL MO) (9 ng). All MOs were designed and synthesized by GeneTools LLC (Philomath, Oregon, USA) and injected into one- to two-cell stage embryos.  /n  Rescue: -  /n  Model Summary: We developed a zebrafish model of DS using morpholino antisense oligomers (MOs) targeting scn1Lab, the zebrafish ortholog of SCN1A. Zebrafish larvae with an antisense knockdown of scn1Lab (scn1Lab morphants) were characterized by automated behavioral tracking and high-resolution video imaging, in addition to measuring brain activity through local field potential recordings. Our findings reveal that scn1Lab morphants display hyperactivity, convulsive seizure-like behavior, loss of posture, repetitive jerking and a myoclonic seizure-like pattern.	ion channel activity,voltage-gated ion channel activity,voltage-gated sodium channel activity,cation channel activity,sodium channel activity	Ani
Npsr1	NPSR1	protein-coding	Mus musculus	ENSMUSG00000043659	9330128H10Rik|GPRA|Gpr154|MVTR|PGR14|VRR1	319239	Aggressive Behaviors	9|9 A3- A4	Knockout	NA	25979487	380	Expeimentalparadigm: Resident-intruder test  /n  Model Generation: Mice NPSR(+/+) and NPSR(-/-) were generated as described by Ruzza et al. (2012a). Segments of the NPSR1/GPRA encoding gene were amplified by PCR and used to create a plasmid capable of undergoing homologous recombination with the endogenous locus. Two 5-kb fragments of the Npsr1/Gpra gene were amplified using the following primer sets: 5′-GCGGC CGCAAGATGCCCACCCAGTAAGAAATC-3′ and 5′-GTCGACCTAGGTAGAGGCATAC AGCAGGACAA-3′ and 5′-GGTACCCGGGCCATGGGGAACAGAACGGAGAT-3′ and 5′-GCAATTGAGCCCCAC CAAGCAAACTGT-3′. The fragments were then cloned 5′ and 3′ of the neomycin gene in the pXena vector. This targeting plasmid is designed to replace a 744-bp region containing the majority of exon 4 with the neomycin cassette. Exon 4 includes regions of the gene encoding the third transmembrane-spanning domain and regions of the i2 intracellular loop. The plasmid was linearized and introduced into embryonic stem cells derived from 129/SvEv mice, and transformants were isolated using standard methodologies (24). A DNA probe corresponding to the region immediately 5′ of the targeted region generated by PCR (5′-GCTCATGTGTTTTCTTTCCTTATCT-3′ and 5′-ACCTCCCATGCC CACTCGT-3′) was used to identify targeted ES cells by Southern blot. A second probe, corresponding to DNA encoding exon 4, was generated by PCR (5′-CCATCGTTTACCCCATGAAG-3′ and 5′-CCTGGTACCCCAACAGTAGC-3′) and was used to verify the loss of the region of the gene during the homologous recombination event. ES cells carrying the correctly modified locus were used to generate chimeric animals, which in turn were bred to 129/SvEv, C57BL/6, or BALB/c mice. Those carrying the mutant allele were identified by either Southern blot analysis using the probes described above or by PCR analysis (common: 5′-GTGGGTACATGAGAAGGTTAGGAG-3′; endogenous: CCTTATCCTCAAACCACGAAG TAT-3′; targeted: AAATGCCTGCTCTTTACTGAAGG) of DNA prepared from tail biopsies. We designate this mutation GPRAΔ94–159; however, in the interest of brevity, we will refer to mice homozygous for the mutation as GPRA-/-.  /n  Rescue: -  /n  Model Summary: The aim of the study was to investigate the effects of NPS on the aggressiveness of mice subjected to the resident/intruder test. Moreover the putative role played by the endogenous NPS/NPSR system in regulating mice aggressiveness was investigating using mice lacking the NPSR receptor (NPSR(-/-)) and the NPSR selective antagonists [(t)Bu-D-Gly(5)]NPS and SHA 68. NPS (0.01-1 nmol, icv) reduced, in a dose dependent manner, both the time that resident mice spent attacking the intruder mice and their number of attacks, producing pharmacological effects similar to those elicited by the standard anti-aggressive drug valproate (300 mg/kg, ip). This NPS effect was evident in NPSR wild type (NPSR(+/+)) mice but completely disappeared in NPSR(-/-) mice. Moreover, NPSR(-/-) mice displayed a significantly higher time spent attacking than NPSR(+/+) mice. [(t)Bu-D-Gly(5)]NPS (10 nmol, icv) did not change the behavior of mice in the resident/intruder test but completely counteracted NPS effects. SHA 68 (50 mg/kg, ip) was inactive per se and against NPS.	G protein-coupled receptor activity,vasopressin receptor activity,neuropeptide receptor activity	Ani
Dnaaf4	DNAAF4	protein-coding	Mus musculus	ENSMUSG00000092192	1700010I24Rik|Dyx1c1|EKN1|b2b811.1Clo|b2b811Clo	67685	Developmental Dyslexia	9|9 D	Knockout	C57BL/6J;129S4/SvJaeSor-Gt(ROSA)26Sor tm1(FLP1)Dym	25989970	381	Expeimentalparadigm: Rotarod//Auditory Processingp//Water escape//Novel Object recognition//T-maze  /n  Model Generation: Briefly, embryonic stem cells harboring a<U+00A0>loxP-flanked allele of exons 2–4 of<U+00A0>Dyx1c1<U+00A0>were produced by electroporating mouse embryonic stem (ES) cells (129S6) with a targeting construct designed to replace exons 2–4 and flanking intronic sequence through homologous recombination. After PCR screening of the ES cell clones for correctly targeted colonies, a single positive colony was expanded, and chimeric mice were generated by embryo reaggregation. The animals were crossed with C57BL/6J mice and transmitted the targeted allele to the offspring through germ line. These mice were subsequently crossed with<U+00A0>129S4/SvJaeSor-Gt(ROSA)26Sortm1(FLP1)Dym/J<U+00A0>mice (The Jackson Laboratory) to remove the<U+00A0>PGK-Neo<U+00A0>cassette in the targeting construct and the offspring thus produced were used to generate<U+00A0>Dyx1c1flox/flox<U+00A0>mice colony.<U+00A0>  /n  Rescue: -  /n  Model Summary: Mice with the homozygous<U+00A0>Dyx1c1<U+00A0>knocKnockoutut showed deficits on memory and learning, but not on auditory or motor tasks. These findings affirm existing evidence that<U+00A0>DYX1C1<U+00A0>may play an underlying role in the development of neural systems important to learning and memory, and disruption of this function could contribute to the learning deficits seen in individuals with dyslexia.	protein binding,nuclear estrogen receptor binding	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Conditional Knockout	Ms5Yah	26035870	382	Expeimentalparadigm: Elevated plus maze//Open field test//Novel object recognition test//Y-maze//Rotarod//Notched bar test//Grip strength test//Morris water maze  /n  Model Generation: Del(16App-Runx1)5Yah mice, also named Ms5Yah, were kept and bred on an F1 B6C3B background. The model was generated through Cre-LoxP in vivo recombination (Brault et al., 2006) using a mouse line carrying two loxP sites inserted at App and Runx1 in a cis configuration, as described previously (Raveau et al., 2012). The Ms5Yah allele was identified by using PCR analysis with one forward primer (5′-ATCCGGGAATGGT-CCCTA-3′) specific for the wild-type allele, one forward primer (5′-CAAGCACTGGCTATGCATGT-3′) specific for the Ms5Yah allele and a Ms5Yah/wild-type reverse primer (5′-GTTCGTTGCCTGAAGGAGAG-3′) common to both alleles. PCR analyses gave wild-type and Ms5Yah products of 482bp and 328bp, respectively.  /n  Rescue: -  /n  Model Summary: As a complement to human genetic approaches, our team has developed new monosomic mouse models that carry deletions on Hsa21 syntenic regions in order to identify the dosage-sensitive genes that are responsible for the symptoms. We focus here on the Ms5Yah mouse model, in which a 7.7-Mb region has been deleted from the App to Runx1 genes. Ms5Yah mice display high postnatal lethality, with a few surviving individuals showing growth retardation, motor coordination deficits, and spatial learning and memory impairments.	NA	Ani
Cdk5	CDK5	protein-coding	Rattus norvegicus	ENSRNOG00000008017	-	140908	Cognitive Disorders	4q11	Knockdown	Wistar	26104286	383	Expeimentalparadigm: Spontaneous activity//Symmetry in limb movement//Forepaw outstretching//Climbing//Body proprioception//Response to vibrissae touch//Inclined plane test//Water maze  /n  Model Generation: The RNAi (short hairpin RNAmiR, shRNAmiR) sequences for silencing CDK5 (CDK5miR) and a control scrambled RNA sequence (SCRmiR), as well as the viral particle production and<U+00A0>in vitro<U+00A0>model silencing validation, were based on Piedrahita<U+00A0>et al.17<U+00A0>The AAV particles were obtained from the Davidson Laboratory (University of Iowa Viral Vector Core). The animals were injected with 2.5<U+2009>μL of AAV2.5.shSCRmiR.GFP or AAV2.5.shCDK5miR.GFP into the right hippocampus (bregma coordinates: <U+2212>2.56 antero-posterior, 0.8 lateral, and 4.1 depth).<U+00A0>  /n  Rescue: -  /n  Model Summary: Cyclin-dependent kinase 5 RNA interference (RNAi) prevented dysfunctions in learning, memory, and reversal learning at 1 month after ischemia.<U+00A0>	p53 binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ErbB-2 class receptor binding,protein binding,ATP binding,cytoskeletal protein binding,kinase activity,protein kinase binding,acetylcholine receptor activator activity,histone kinase activity,ErbB-3 class receptor binding,ephrin receptor binding,tau-protein kinase activity,Hsp90 protein binding,protein serine kinase activity	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Mutated	C57BL/6J;129Sv/Evs6	26134648	384	Expeimentalparadigm: Elevated plus maze//Light-dark test//Open field test//Locomotor//Grooming//Marble burying test//Rotarod//Nest building test//Morris water maze//Visible water maze//Three chamber test  /n  Model Generation: Construction of genetically reversible exon 21 insertion mutant targeting vector.<U+00A0>The targeting vector DNA was linearized by Not1 and introduced by electroporation into SM-1 (129Sv/Evs6) embryonic stem (ES) cells grown on mitomycin-C-treated G418-resistant primary mouse embryonic fibroblasts. DNA was purified from the ES cells and analyzed by Southern blotting with a probe that distinguished between the targeting and wild-type Shank3 alleles. ES cells from three correct clones were injected into the blastocoel cavity of E3.5 C57BL6 embryos using standard procedures. The chimeric males with >90% agouti coat color on black background were bred with 6-week-old females of wild-type C57BL6J. The Shank3G mutation mice were crossed with wild-type C57BL6J mice >4 times.  /n  Rescue: -  /n  Model Summary: Shank3G/G<U+00A0>mice exhibit deficits in hippocampus-dependent spatial learning, impaired motor coordination, altered response to novelty, and sensory processing deficits. This work identifies clear alterations in synaptic function and behavior in a novel, genetically accurate mouse model of autism mimicking an autism-associated insertion mutation	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Il6	IL6	protein-coding	Mus musculus	ENSMUSG00000025746	Il-6	16193	Aggressive Behaviors	5 B1|5 15.7 cM	Knockout	C57BL/6	26143620	385	Expeimentalparadigm: Hole-board test//Elevated plus maze//Tail suspension test//Morris water maze//Visible platform test//Cued learning test//Hidden platform test//Probe trial test//Spatial reversal test//Spatial reversal probe trial test//Dominance tube test//Resident intruder test  /n  Model Generation: IL-6 floxed mice were generated by our group as described elsewhere (Quintana et al., 2013) and backcrossed with C57BL/6 mice for at least 10 generations. IL-6R floxed mice were generously provided by Dr. Angela Drew, generated as described elsewhere (McFarland-Mancini et al., 2010), and glial fibrillary acidic protein (GFAP) promoter-specific Cre recombinase-expressing mice (GFAP-Cre mice, 01XN3) were obtained from the National Cancer Institute Mouse Models of Human Cancers Consortium (MMHCC) at Frederick, MD 21702, USA. Astrocyte IL-6 KO (Ast-IL-6 KO) and Astrocyte IL-6 Receptor KO (Ast-IL-6R KO) mice were obtained as previously described (Quintana et al., 2013). To obtain conditional KO mice where either IL-6 or IL-6 receptor expression was blunted in astrocytes together with appropriated controls, we proceeded as follows: heterozygous GFAP-Cre mice were first crossed with each of the two floxed mice, and from the offspring GFAP-Cre positive animals were selected and crossed again with the proper floxed mice (for either IL-6 or IL-6 receptor) to get the subjects to be studied. With this strategy, four possible genotypes are obtained which are littermates and thus assuring genetic homogeneity: GFAP-Cre Il-6 (or Il-6R±)lox/lox, which will lack either IL6 or IL6 receptor expression in astrocytes (GFAP-Cre Il-6±△/△ or GFAP-Cre Il-6r±△/△ mice); GFAP-Cre Il-6 (or Il6r±)lox/+ which will be heterozygous for the conditional deletion in astrocytes (GFAP-Cre Il6±△/+ or GFAP-Cre Il-6r±△/+); GFAP-Cre Il-6 (or Il-6r-/-)lox/lox; and GFAP-Cre Il-6 (or Il-6r-/-)lox/+. For the sake of simplicity, we will call these groups Ast-IL6 KO/Ast-IL6R KO, heterozygous, floxed and wild-type mice. Although we will present the results of the four groups, emphasis will be given to the comparisons between Ast-IL-6 KO and Ast-IL-6R KO with their respective floxed mice as the proper controls. PCR-based genotyping in tail DNA was performed for the different mouse lines described. Primers used for GFAP-Cre transgene presence were, as stated by NCI, 5′-CAT CGC CAG TCT AGC CCA CT-3′ (forward) and 5′-CAC GTT CAC CGG CAT CAA C-3′ (reverse). For IL-6 receptor gene the sequences used were 5′-GAA GGA GGA GCT TGA CCT TGG-3′(forward) and 5′-AAC CAT GCC TAT CAT CCT TTG G-3′(reverse). For IL6 genotyping sequences used were 5′-CCC ACC AAG AAC GAT AGT CA-3′(forward) and 5′-GGT ATC CTC TGT GAA GTC CTC-3′(reverse) (see Results).  /n  Rescue: -  /n  Model Summary: We herewith confirm and expand the importance of astrocytic production of and response to IL-6 by using transgenic mice deficient in astrocytic IL-6 (Ast-IL-6 KO) or in its receptor (Ast-IL-6R KO) in full C57Bl/6 genetic background. A major prosurvival effect of astrocytic IL-6 at early ages was clearly demonstrated. Robust effects were also evident in the control of activity and anxiety in the hole-board and elevated plus-maze, and in spatial learning in the Morris water-maze. The results also suggest an inhibitory role of IL-6 in the mechanism controlling the consolidation of hippocampus-dependent spatial learning. Less robust effects of astrocytic IL-6 system were also observed in despair behavior in the tail suspension test, and social behavior in the dominance and resident-intruder tests. The behavioral phenotype was highly dependent on age and/or sex in some cases. The phenotype of Ast-IL-6R KO mice mimicked only partially that of Ast-IL-6KO mice, which indicates both a role of astrocytes in behavior and the participation of other cells besides astrocytes. No evidences of altered function of the hypothalamic-pituitary-adrenal axis were observed.	signaling receptor binding,cytokine activity,interleukin-6 receptor binding,protein binding,growth factor activity	Ani
Cntnap2	CNTNAP2	protein-coding	Mus musculus	ENSMUSG00000039419	5430425M22Rik|Caspr2|mKIAA0868	66797	Autism Spectrum Disorder	6|6 B2.2- B2.3	Knockout	C57BL/6J	26273832	386	Expeimentalparadigm: Three-chamber test//T-maze//Smart cube//Reciprocal interaction//Marble burying test//Open field test//Pre pulse inhibition  /n  Model Generation: A cohort of 40 female and 20 male Cntnap2 -/- (B6.129(Cg)-Cntnap2 tm1Pele/J) mice (catalog #017482), backcrossed to C57BL/6J for more than 10 generations, was provided by The Jackson Laboratory at 4.1–9.4 weeks of age. Breeders for the last experimental cohort 3 of the Cntnap2 line were unrelated heterozygous offspring of the original breeders.  /n  Rescue: -  /n  Model Summary: Cntnap2 homozygous null mice were also hyperactive, froze less during testing, showed a mild gait phenotype and deficits in the three-chamber social preference test, although less robust than previously published. In the open field test with exposure to urine of an estrous female, however, the Cntnap2 null mice showed reduced vocalizations. In addition, Cntnap2 null mice performed slightly better in a cognitive procedural learning test.	protein binding,enzyme binding,PDZ domain binding	Ani
Slc6a4	SLC6A4	protein-coding	Mus musculus	ENSMUSG00000020838	5-HTT|Htt|Sert	15567	Panic Disorder	11 B5|11 46.18 cM	Knockout	Wistar	26302762	387	Expeimentalparadigm: Fear-potentiated startle  /n  Model Generation: SERT knockout rats (Slc6a4 [1Hubr]) on a Wistar rat genetic background were generated by ENU-driven mutagenesis (Smits et al., 2006). Rats from three inbred strains, BN/RijHsd, F344/NHsd, and LEW/HanHsd, and one outbred strain, Wistar/Crl were used. Animal experiments were performed in accordance with national and local rules and ethical guidelines. Male animals of 11 weeks of age were given three weekly intraperitoneal injections of ENU. The inbred strains were given 3×20, 30 and 40mg of ENU/kg bodyweight. The Wistar strain received 3×30, 35 and 40mg of ENU/kg bodyweight. Preparation of ENU (Isopac; Sigma, Poole, UK) was done within 1h prior to injections. One gram of ENU was dissolved in 5ml 96% ethanol. After dissolving the powder by vigorous shaking, 95ml of phosphate citrate buffer (0.1M NaH2PO4, 0.05M citric acid, pH5.0) was added. The concentration was determined by measuring the optical density (OD) of a 10×dilution at wavelength of 395nm and the assumption that 1 OD unit equals a concentration of approximately 1mg/ml. Final concentrations of the ENU stock typically varied between 6 and 8.5mg/ml, depending on the batch number. To monitor fertility after treatment, the injected males were paired with one or two females starting 3 weeks after the last injection. Progeny from these early matings was not analyzed, but counted for fertility measurements. Ten weeks after the last injection, fertile males of the highest-dosed fertile groups were kept on a 3-weekly breeding scheme with two females to produce F1 progeny for mutation analysis.  /n  Rescue: -  /n  Model Summary: The inability to associate aversive events with relevant cues (i.e. fear learning) may lead to maladaptive anxiety. To further study the role of the serotonin transporter (SERT) in fear learning, classical fear conditioning was studied in SERT knockout rats (SERT(-/-)) using fear potentiation of the startle reflex. Next, fear acquisition and concomitant development of contextual conditioned fear were monitored during training. To differentiate between developmental and direct effects of reduced SERT functioning, effects of acute and chronic SSRI treatment were studied in adult rats. Considering the known interactions between serotonin and corticotropin-releasing factor (CRF), we studied the effect of the CRFR1 antagonist CP154,526 on behavioral changes observed and determined CRF1 receptor levels in SERT(-/-) rats. SERT(-/-) showed blunted fear potentiation and enhanced contextual fear, which resulted from a deficit in fear acquisition. Paroxetine treatment did not affect acquisition or expression of fear-potentiated startle, suggesting that disturbed fear learning in SERT(-/-) results from developmental changes and not from reduced SERT functioning. Although CRF1 receptor levels did not differ significantly between genotypes, CP154,526 treatment normalized both cue- and contextual fear in SERT(-/-) during acquisition, but not expression of fear-potentiated startle. The disrupted fear acquisition and concomitant increase in contextual conditioned fear-potentiated startle fear in SERT(-/-) resembles the associative learning deficit seen in patients with panic disorder and suggests that normal SERT functioning is crucial for the development of an adequate fear neuro-circuitry.	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Psme3	PSME3	protein-coding	Mus musculus	ENSMUSG00000078652	Ki|PA28gamma|REGgamma|pa28g	19192	Cognitive Disorders	11 D|11 64.67 cM	Knockout	C57BL/6	26370326	388	Expeimentalparadigm: Open field test//Prepulse inhibition//Radial Eight-Arm Maze//Nest-Building  /n  Model Generation: REGγ<U+2212>/<U+2212> mice were kindly provided by Dr John J Monaco at the University of Cincinnati (Barton<U+00A0>et al, 2004). All the mice had a C57BL/6 background. REGγ<U+2212>/<U+2212> and REGγ+/+ mice were obtained by breeding heterozygous REGγ+/<U+2212><U+00A0>  /n  Rescue: Inhibition of GSK3β<U+00A0>rescued the compromised PPI phenotypes and working memory deficiency in the knocKnockoutut mice.<U+00A0>  /n  Model Summary: Elderly REGγ<U+2212>/<U+2212> Mice Exhibit Hyperactivity, Sensorimotor Gating Deficiency, and Aberrant Cognitive Behaviors	p53 binding,identical protein binding,endopeptidase activator activity,MDM2/MDM4 family protein binding	Ani
Hsa21	Hsa21	NA	Mus musculus	NA	NA	NA	Intellectual Disability	NA	Conditional Knockout	Dyrk1aGt(XQ0369)Wtsi, C57BL/6J	26374847	389	Expeimentalparadigm: T-maze test//Fear conditioning test//Foot shock sensitivity test  /n  Model Generation: We generated new chromosomal deletions using Cre/loxP-mediated chromosome engineering (39). Specific MICER clones (17) were selected for use as the targeting vectors to deliver loxP to the two endpoints of each deletion in the genome of mouse ES cells, i.e. AB2.2 ES cells (40). Prior to gene targeting, MICER clones were linearized in the mouse genomic DNA inserts with specific restriction enzymes (Supplementary Material, Table S2). The linearized targeting vectors were electroporated into ES cells, which were then selected with G418 or puromycin. Double-targeted ES cell clones were identified by Southern blot analysis using PCR products as probes. ES cell culture and electroporation were carried out as described (41). To induce recombination between targeted loxP sites, a Cre-expression vector, pOG231 (42), was electroporated into double-targeted cells. ES cell clones carrying individual deletions were identified by Southern blot analysis with ES cell DNA digested with specific restriction enzymes and hybridized with specific probes (Supplementary Material, Table S2) and confirmed by FISH analysis. To generate a Dyrk1a mutant allele in mice, the SIGTR ES cell line XQ0369, which carries Dyrk1aGt(XQ0369)Wtsi (i.e. Dyrk1am1), was obtained from the Mutant Mouse Regional Resource Centers, (http://www.informatics.jax.org/allele/MGI:4338238). This mutant ES cell line was generated by the Wellcome Trust Sanger Institute via a gene trap event in intron 4 of Dyrk1a using the gene trap vector pGT01xf (http://www.sanger.ac.uk/resources/mouse/sigtr/). We examined this mutant ES cell line by carrying out RT–PCR analysis of ES cell RNA with PCR primers based on exon 4 of Dyrk1a (forward primer: 5′-GGGCCAGGGGGACGATTCCAGT-3′) and the beta-Geo cassette in the gene trap vector (reverse primer: 5′-CGCCAGGGTTTTCCCAGTCACGA-3′) (Fig. <U+200B>(Fig.5A).5A). The RT–PCR product was sequenced to confirm the presence of the specific fusion mRNA as the consequence of the gene trap event (Fig. <U+200B>(Fig.5B5B and Supplementary Material, Fig. S1). Our sequence is identical to the junction sequence generated by the Wellcome Trust Sanger Institute for this cell line (http://www.genetrap.org/cgi-bin/annotation.py?cellline=XQ0369). The ES cell lines carrying the aforementioned individual mutations were used to generate germline chimeras by injecting them into blastocysts isolated from C57BL/6J mice, as described previously (19,41,43). Deletion mutant mice were identified by Southern blot analysis of mouse tail DNA (Supplementary Material, Table S2). Dyrk1am1/+ mice were identified using beta-Geo-specific PCR-based analysis of mouse tail DNA with the following primer pair: 5′-ACGAGTTCTTCTGAGCGGGACTCT-3′ and 5′-GATAACCGTATTACCGCCTTTG-3′ (Fig. <U+200B>(Fig.5A)5A) and confirmed by sequencing the junction between exon 4 of Dyrk1a and the gene trap vector pGT01xf using cDNA generated from brain mRNA of Dyrk1am1/+ mice (Fig. <U+200B>(Fig.55B).  /n  Rescue: The partial rescue by a Dyrk1a mutation in a compound mutant carrying Dp(16)1Yey and the Dyrk1a mutation confirmed the causative role of Dyrk1a, whereas the absence of a similar rescue by Df(16Dyrk1a-Kcnj6)Yey in Dp(16)1Yey/Df(16Dyrk1a-Kcnj6)Yey mice demonstrated the importance of Kcnj6.  /n  Model Summary: Our results revealed the high levels of complexities of gene actions and interactions associated with the Setd4/Cbr1-Fam3b/Mx2 region as well as their relationship with developmental cognitive deficits in DS.	NA	Ani
Tlr2	TLR2	protein-coding	Mus musculus	ENSMUSG00000027995	Ly105	24088	Schizophrenia	3|3 E3	Knockout	C57BL/6	26381703	390	Expeimentalparadigm: Open field test//Elevated plus-maze//Marble-burying test//Forced swim test//Three-chamber test//Reciprocal social interaction test//Fear conditioning test//Novel object recognition test//Y-maze//Barnes maze//Startle response and prepulse inhibition//Rotarod  /n  Model Generation: LR-2 KO mice backgrounds from C57BL/6 mice were obtained from Dr. Sung J. Lee (Seoul National University, Seoul, Korea)56. An 129/SvJ mouse genomic library (Stratagene) was screened using a probe derived from a mouse EST clone similar to human TLR2 (accession number D77677). A genomic DNA fragment that includes an exon was subcloned into pBluescript (Stratagene), characterized by restriction enzyme mapping and DNA sequencing. A targeting vector was constructed by replacing a 1.3 kb fragment containing the exon with pMC1-neo (Stratagene). The targeting vector was flanked by the 4.8 kb 5′ genomic fragment and a 1.0 kb 3′ fragment and contained an HSV-tk cassette at the 5′ end of the vector. The targeting vector was linearized with SalI and electroporated into E14.1 ES cells. The resistant clones to G418 and gancyclovir were screened for homologous recombination by PCR and confirmed by Southern blot analysis using the probe indicated in Figure 1A. Chimeric mice were generated by microinjection of the targeted ES clones into C57BL/6 blastocysts. Male chimeric mice were bred to C57BL/6 females to produce heterozygous mice. Heterozygous mice were interbred to obtain homozygotes. TLR2-deficient mice and their wild-type littermates from these intercrosses were used for experiments.  /n  Rescue: -  /n  Model Summary: Here, we demonstrated that toll-like receptor (TLR)-2, a family of pattern-recognition receptors, is involved in the pathogenesis of schizophrenia-like symptoms. Psychotic symptoms such as hyperlocomotion, anxiolytic-like behaviors, prepulse inhibition deficits, social withdrawal, and cognitive impairments were observed in TLR-2 knock-out (KO) mice. Ventricle enlargement, a hallmark of schizophrenia, was also observed in TLR-2 KO mouse brains. Levels of p-Akt and p-GSK-3α/β were markedly higher in the brain of TLR-2 KO than wild-type (WT) mice. Antipsychotic drugs such as haloperidol or clozapine reversed behavioral and biochemical alterations in TLR-2 KO mice. Furthermore, p-Akt and p-GSK-3α/β were decreased by treatment with a TLR-2 ligand, lipoteichoic acid, in WT mice.	lipopolysaccharide binding,amyloid-beta binding,transmembrane signaling receptor activity,protein binding,Toll-like receptor binding,signaling receptor activity,pattern recognition receptor activity,triacyl lipopeptide binding,diacyl lipopeptide binding,identical protein binding,peptidoglycan binding,protein-containing complex binding,lipoteichoic acid binding,lipopeptide binding	Ani
Crh	CRH	protein-coding	Mus musculus	ENSMUSG00000049796	CRF|Gm1347	12918	Posttraumatic Stress Disorder	3 A2|3 5.75 cM	Overexpression	C57BL/6J	26538448	391	Expeimentalparadigm: Predator exposure//Open field test//Open field test//Locomotor and exploratory activity//Light–dark box test//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: To induce CRHOE in spatio-temporally restricted manner, we used double-mutant mice carrying<U+00A0>CamkIIα<U+00A0>promoter-driven<U+00A0>rtta2<U+00A0>transgene (Michalon<U+00A0>et al, 2005) and doxycycline (DOX)-regulated<U+00A0>tetO<U+00A0>promoter fused to the<U+00A0>Crh<U+00A0>gene (Vicentini<U+00A0>et al, 2009) on a C57BL/6J background<U+00A0>  /n  Rescue: -  /n  Model Summary: These data support growing evidence for significant sex differences in response to trauma, and support further study of CRHR2 as a candidate mechanism for PTSD risk.	hormone activity,corticotropin-releasing hormone activity,corticotropin-releasing hormone receptor 1 binding,corticotropin-releasing hormone receptor 2 binding	Ani
Nlgn3	NLGN3	protein-coding	Mus musculus	ENSMUSG00000031302	A230085M13Rik|HNL3|NL3|NLG3	245537	Aggressive Behaviors	X|X D	Knockout	Sv129/C57BL6	26583067	392	Expeimentalparadigm: Repetitive object novel contact test//Grooming//Reciprocal juvenile social interaction//Three-chamber test//Olfactory discrimination test//Light-dark arena//Elevated plus maze//Resident-intruder test  /n  Model Generation: B6;129-Nlgn3tm1Sud/J mice were obtained from Jackson Laboratories (Bar Harbor, Maine USA) and maintained to generation F9 on a Sv129/C57BL6 background. NL3R451C and wild-type (WT) animals were derived by mating heterozygous females with NL3R451C males, which produced 50:50 WT and NL3R451C male offspring (Y/+ and Y/R451C) that were genotyped as previously described [9].  /n  Rescue: -  /n  Model Summary: We investigated aggression in mice containing the ASD-associated R451C (arginine to cysteine residue 451 substitution) mutation in neuroligin-3 (NL3). Furthermore, we sought to verify social interaction impairments and assess olfaction, anxiety, and repetitive and restrictive behavior in NL3(R451C) mutant mice. We show a pronounced elevation in aggressive behavior in NL3(R451C) mutant mice. Treatment with risperidone reduced this aggression to wild-type (WT) levels. Juvenile and adult social interactions were also investigated, and subtle differences in initiation of interaction were seen in juvenile NL3(R451C) mice. No genotype differences in olfactory discrimination or anxiety were observed indicating that aggression was not dependent on altered olfaction, stress response, or social preference. We also describe repetitive behavior in NL3(R451C) mice as assessed by a clinically relevant object exploration task.	signaling receptor activity,neurexin family protein binding,cell adhesion molecule binding,molecular adaptor activity,scaffold protein binding	Ani
Slc17a6	SLC17A6	protein-coding	Mus musculus	ENSMUSG00000030500	2900073D12Rik|DNPI|VGLUT2	140919	Aggressive Behaviors	7|7 B4	Knockout	C57BL/6;129/SvJ	26629409	393	Expeimentalparadigm: Rotarod//Open field test//Elevated plus maze//Corticosterone assay//Cued fear conditioning//Predator odor assay  /n  Model Generation: Vglut2+/fl mice in a mixed C57BL/6, Sv129J background were provided by Dr. R.D. Palmiter, (University of Washington) [22]. Sf1+/Cre mice were provided by Dr. J.K. Elmquist (University of Texas Southwestern Medical Center) [11] and subsequently backcrossed into the C57BL/6 background (Taconic Biosciences), which was confirmed by microsatellite analysis. Vglut2fl/fl mice were generated and maintained on a mixed background or backcrossed for 10 generations into the C57BL/6 background. Experimental cohorts were obtained by crossing Sf1+/Cre; Vglut2fl/fl with Vglut2fl/fl mice. We previously generated and characterized the Sf1TauGFP reporter mice [24].  /n  Rescue: -  /n  Model Summary: Several phenotypes observed in Vglut2 (Sf1-Cre) mice were largely unexpected based on prior studies that have perturbed VMH development or VMH glutamate signaling. In our hands, Vglut2 (Sf1-Cre) mice failed to exhibit the anticipated increase in body weight after high fat diet (HFD) or the impaired glucose homeostasis after fasting. Instead, there was a significant sex-dependent attenuation of DIO in Vglut2 (Sf1-Cre) females. Vglut2 (Sf1-Cre) males also display a sex-specific loss of conditioned-fear responses and aggression accompanied by more novelty-associated locomotion. Finally, unlike the higher anxiety noted in Sf1 (Nestin-Cre) mice that lack a fully formed VMH, both male and female Vglut2 (Sf1-Cre) mice were less anxious.	chloride channel activity,L-glutamate transmembrane transporter activity,neurotransmitter transmembrane transporter activity,sodium:phosphate symporter activity,symporter activity,antiporter activity,potassium:proton antiporter activity,transmembrane transporter activity,L-glutamate uniporter activity	Ani
Tert	TERT	protein-coding	Mus musculus	ENSMUSG00000021611	EST2|TCS1|TP2|TR|TRT	21752	Autism Spectrum Disorder	13 C1|13 40.12 cM	Overexpression	FVB/N	26696493	394	Expeimentalparadigm: Open-field test//Social novelty test//Nest building test//Elevated plus maze  /n  Model Generation: TERT-tg mice with a pure FVB/N genetic background were kindly donated by Prof. Han-Woong Lee (Department of Biochemistry, College of Science, Yonsei University, Seoul, Korea). The donated mTERT-transgenic mice were produced and used as previously described [13]. TERT-tg mice were identified by genomic DNA PCR. The primers used in this analysis are mTert, 5′CTCCACCTGCCGACCTTTC (forward) and 5′CAGCACGTTTCTCTCGTTGC (reverse).  /n  Rescue: -  /n  Model Summary: During embryonic brain development, expression of transcription factors involved in glutamatergic neuronal differentiation was increased in mice over-expressing TERT (TERT-tg mice). We observed increased expression of NMDA receptor subunits and phosphorylation of α-CaMKII in TERT-tg mice. TERT-tg mice showed autism spectrum disorder (ASD)-like behavioral phenotypes as well as lowered threshold against electrically induced seizure.	tRNA binding,transcription coactivator binding,DNA binding,telomerase activity,telomerase RNA reverse transcriptase activity,RNA binding,RNA-directed DNA polymerase activity,RNA-dependent RNA polymerase activity,protein binding,protein C-terminus binding,transferase activity,nucleotidyltransferase activity,telomeric DNA binding,identical protein binding,protein homodimerization activity,metal ion binding,protein N-terminus binding,chaperone binding,telomerase RNA binding,template-free RNA nucleotidyltransferase	Ani
mecp2	MECP2	protein-coding	Zebrafish	ENSDARG00000014218	wu:fk96a04|zgc:111857	335250	Neurodevelopmental Disorders	-	Mutated(MO)	AB	26733807	395	Expeimentalparadigm: Tactile stimuli  /n  Model Generation: Wild-type zebrafish of the AB strain were maintained under standard conditions of fish husbandry. Freshly fertilized zebrafish eggs were injected with mRNA (100 ng/μl), plasmid DNA (40 ng/μl), mecp2 morpholino (800 μM), robo2 morpholino (200 μM) and sema5b morpholino (500 μM) at the one- to two-cell stage in a volume of approximately 1 nl. Approximately 200 embryos were injected for each morpholinos or overexpresson constructs. At least 30 embryos were analyzed for each experimental group used per experiment. For experiments using mecp2-null zebrafish embryos, mecp2 splice blocking morpholino was also injected into mecp2Q63*/Q63* mutant (mecp2-null) and its wild-type control embryos (WT-CTR) (both in the Nacre background). The injected embryos were cultured at 28°C, and embryos were fixed at specific developmental stages for further analysis. Morpholinos were purchased from GeneTools. Splice-blocking morpholino (5′-CTCACCTCTGCTGACAACAAAATAA-3′) was selected for knocking down Mecp2. This splice-blocking MO that allows efficiency of MO to be determined through PCR, was used for all the Mecp2 morphants shown here. The control morpholino (5′-CCTCTTACCTCAGTTACAATTTATA-3′) and p53 morpholino (5′-GCGCCATTGCTTTGCAAGAATTG-3′) used were the scrambled sequence and a translational blocker respectively from Gene Tools.  /n  Rescue: -  /n  Model Summary: Here, we used two independent methods of silencing expression of Mecp2 in zebrafish to uncover a novel role of Mecp2 in trigeminal ganglion sensory neurons during the embryonic development. mecp2-null mutation and morpholino-mediated silencing of Mecp2 in the zebrafish embryos resulted in defects in peripheral innervation of trigeminal sensory neurons and consequently affecting the sensory function. These defects were demonstrated to be dependent on the expression of Sema5b and Robo2.	DNA binding,chromatin binding,DNA-binding transcription factor activity,methyl-CpG binding,double-stranded methylated DNA binding	Ani
Drd1	DRD1	protein-coding	Rattus norvegicus	ENSRNOG00000023688	D1a|Drd-1|Drd1a	24316	Bipolar Disorder	17p14	Overexpression	Sprague Dawley	26762379	396	Expeimentalparadigm: Sexual behavior//Sucrose preference test//Locomotor activity//Active avoidance//Learned helplessness  /n  Model Generation: An inducible (Tet.On), lentiviral vector was used to manipulate the expression of the DRD1 gene in glutamate neurons within the prefrontal cortex in male, adult rats. Adult, male Sprague Dawley rats (350-375g) were obtained from Charles River Laboratories (Boston, MA). A third generation Tetracycline-On inducible lentiviral vector system (Tet.On) was used. The system expressed the rat D1R (or the control, red fluorescent protein dsRed) driven by a CamKIIα promoter in the presence of the tetracycline derivative, DOX. Virus production, concentration by ultracentrifugation, qRT-PCR-based titer determination was performed at the Massachusetts General Hospital Viral Core according to published protocols (Sonntag et al. 2014). Viral expression is shown in cultured cells (Figure 1a), as in vivo ‘OFF’ expression is not possible to detect. Briefly, cells were stained for D1R with rat anti-D1 DAR IgG (1:250; Sigma; secondary: anti-rat TRITC coupled IgG [1:200; Molecular Probes]), or CamKIIα in mouse CamKIIα IgG (1:250; Chemicon; secondary: anti-mouse Alexa 488-coupled IgG [1:200; Molecular Probes]) in the presence or absence of doxycylcline to demonstrate ‘ON’ or ‘OFF’. Rats were anesthetized with a ketamine/xylazine mixture (80/12 mg/kg) and received 1 μl of virus (2 × 107 transducing units per μl) bilaterally into the mPFC at stereotaxic coordinates (AP +2.7, ML: 0.4; DV: -2.8) of (Paxinos et al. 1980).  /n  Rescue: -  /n  Model Summary: ON D1R expression increased sexual activity that returned to baseline in the OFF state. Sucrose preferences increased ~6 % in ON state but fell 11 % below control levels when OFF. Consistent with a depressive-like phenotype, D1R OFF decreased activity by 40 %, impaired the ability to control (43 %) and motivation to escape shock (27 % more impaired) relative to dsRed OFF. CREB increased 29 % in the NA in the D1R OFF state relative to the ON state.	dopamine neurotransmitter receptor activity, coupled via Gs,G-protein alpha-subunit binding,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,signaling receptor binding,protein binding,protein phosphatase binding,neurotransmitter receptor activity,angiotensin receptor binding,D3 dopamine receptor binding,dopamine binding,protein-containing complex binding,ATPase binding,heterocyclic compound binding	Ani
MECP2	MECP2	protein-coding	Macaca fascicularis	ENSMMUG00000018704	-	700174	Autism Spectrum Disorder	-	Overexpression	Macaca fascicularis	26808898	397	Expeimentalparadigm: Locomotive behaviour//Social interaction behaviours//TAD behaviours//WGTA tests//Black-white test//Hamilton search test//Learning set test  /n  Model Generation: We first co-injected lentivirus expressing synapsin-promoter-driven10 haemagglutinin (HA)-tagged human MeCP2 and green fluorescence protein (GFP) and lentivirus expressing mCherry into the perivitelline space of 94 mature oocytes of cynomolgus monkeys (Fig. 1a). We found that 61 out of 88 (69%) of the surviving oocytes became zygotes after intracytoplasmic sperm injection (ICSI), and 53 embryos were then transferred into 18 surrogate monkeys. Nine surrogates (9 out of 18, 50%) became pregnant and produced eight live births (3 male, 5 female; Fig. 1b) and four stillbirths, all carrying human MECP2, GFP and mCherry transgenes, as determined by PCR (Fig. 1c). The AccuCopy assay showed that the copy numbers of MECP2 transgenes in 8 live (T04–T11) and 2 aborted (T01 and T02) transgenic (TG) monkeys varied from 1.0 to 7.3 (Extended Data Table 1a). In the second experiment, we injected 264 mature oocytes with lentivirus carrying the hSynapsin-HA-hMECP2-2a-GFP cassette, and transferred 105 embryos after ICSI into 36 surrogates. Owing to unfavourable seasonal conditions, only 7 pregnant surrogates gave birth to 9 monkeys (T13–T21), and only 2 survived (Supplementary Table 1). Western blotting of tissues of stillbirth TG monkey T14 showed expression of GFP and HA–MeCP2 proteins in the cortex and cerebellum, but not in non-neural tissues, confirming specific transgene expression under the synapsin promoter (Fig. 1d). Levels of MeCP2 protein were also significantly higher than that found in an aborted wild-type (WT) monkey of a similar age (Fig. 1e, f). Transgenic integration was confirmed by Southern blotting using a probe targeting the HA-hMECP2-2a-GFP transgene (Extended Data Fig. 1a). We next analysed genomic integration sites of lentiviral cassettes containing HA-hMECP2-2a-GFP and mCherry transgenes by a deep-sequencing-based method (Extended Data Fig. 1b). All transgenes were located in genomic loci distant from known coding exons, and thus unlikely to interfere with endogenous genes (Fig. 1g and Supplementary Table 2), and insertion numbers were largely consistent with the copy numbers identified by AccuCopy (Extended Data Fig. 1c). Therefore, the human MECP2 transgene was successfully incorporated into the monkey genome and specifically expressed in the monkey’s brain.  /n  Rescue: -  /n  Model Summary: Here we report that lentivirus-based transgenic cynomolgus monkeys (Macaca fascicularis) expressing human MeCP2 in the brain exhibit autism-like behaviours and show germline transmission of the transgene. Expression of the MECP2 transgene was confirmed by western blotting and immunostaining of brain tissues of transgenic monkeys. Genomic integration sites of the transgenes were characterized by a deep-sequencing-based method. As compared to wild-type monkeys, MECP2 transgenic monkeys exhibited a higher frequency of repetitive circular locomotion and increased stress responses, as measured by the threat-related anxiety and defensive test9. The transgenic monkeys showed less interaction with wild-type monkeys within the same group, and also a reduced interaction time when paired with other transgenic monkeys in social interaction tests. The cognitive functions of the transgenic monkeys were largely normal in the Wisconsin general test apparatus, although some showed signs of stereotypic cognitive behaviours. Notably, we succeeded in generating five F1 offspring of MECP2 transgenic monkeys by intracytoplasmic sperm injection with sperm from one F0 transgenic monkey, showing germline transmission and Mendelian segregation of several MECP2 transgenes in the F1 progeny. Moreover, F1 transgenic monkeys also showed reduced social interactions when tested in pairs, as compared to wild-type monkeys of similar age.	NA	Ani
Tspyl2	TSPYL2	protein-coding	Mus musculus	ENSMUSG00000041096	CDA1|CINAP|DENTT|DXBwg1396e|DXHXS1008E|E130307F10Rik	52808	Neurodevelopmental Disorders	X F3|X 68.46 cM	Knockout	129 Sv/Ev	26826030	398	Expeimentalparadigm: Prepulse inhibition//Marble burying//Reciprocal social interaction//Three Chamber Social Test//Open field test  /n  Model Generation: The neomycin resistance (neo) cassette with the phosphoglycerate kinase 1 promoter and polyA was franked by frt sites and inserted into intron 5 of<U+00A0>Tspyl2. This allowed the removal of the neo cassette by flip recombinase so that it would not interfere with the transcription of<U+00A0>Tspyl2. Exons 2 to 5, together with the neo cassette oriented in opposite direction to<U+00A0>Tspyl2<U+00A0>transcription, was flanked by loxP sites. Exons 2 to 5, which encoded the NAP domain, could be conditionally deleted by expression of Cre recombinase. The targeting vector contained 4.0 kb of 5′ and 1.9 kb of 3′ homology arms. Embryonic stem (ES) cells were derived in house from 129Sv/Ev embryos by the Transgenic Core Facility at HKU, which also provided the service for electroporations and blastocyst injections. Homologous recombination in the G418 resistant ES clones was detected by Southern blot analysis using standard procedures. Probes for Southern blotting were derived from PCR, cloned and sequence verified. Chimeric mice were generated by injecting the targeted ES clones into C57BL/6 blastocysts, and mated to 129Sv/Ev mice.  /n  Rescue: -  /n  Model Summary: We hypothesized that<U+00A0>Tspyl2<U+00A0>knockout (KO) would precipitate a phenotype relevant to neurodevelopmental conditions. In line with this prediction, we found that<U+00A0>Tspyl2<U+00A0>KO mice were marginally more active, had significantly impaired prepulse inhibition, and were significantly more ‘sensitive’ to the dopamine agonist amphetamine. In addition, the lateral ventricles were significantly smaller in KO mice.	chromatin binding,histone binding	Ani
Cc2d1a	CC2D1A	protein-coding	Mus musculus	ENSMUSG00000036686	Freud-1|Tape	212139	Neurodevelopmental Disorders	8|8 C2	Conditional Knockout	129/SvEvTac;C57BL/6;Swiss Webster	26826102	399	Expeimentalparadigm: Righting reflex//Aacoustic startle//Open field test//Novel object recognition test//Marble burying test//Three-chamber test//Ultrasonic vocalization  /n  Model Generation: A<U+00A0>Cc2d1a<U+00A0>null mouse line (KO) was generated by the Knockout Mouse Project Repository (Project Design ID 49663) at the University of California, Davis, from a C57BL/6 embryonic stem cell clone (Chen et al. 2012). The<U+00A0>Cc2d1a<U+00A0>targeting constructs contains an “engrailed 2” splice acceptor (En2SA) gene-trap allele with bicistronic expression of β-galactosidase. In addition, a neomycin resistance cassette is expressed under the human β-actin (Actb) promoter. These 2 elements are flanked by flippase recombinase target (FRT) recombination sites, in intron 11 of<U+00A0>Cc2d1a. Finally, the construct carries<U+00A0>LoxP<U+00A0>sites flanking exons 12–14<U+00A0>  /n  Rescue: -  /n  Model Summary: These animals display deficits in neuronal plasticity and in spatial learning and memory that are accompanied by reduced sociability, hyperactivity, anxiety, and excessive grooming. Cc2d1a conditional knockout mice therefore recapitulate features of both cognitive and social impairment caused by human<U+00A0>CC2D1A<U+00A0>mutation	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding	Ani
cntnap2a	CNTNAP2	protein-coding	Zebrafish	ENSDARG00000058969	Caspr2a	559157	Autism Spectrum Disorder	-	Knockout(Mutated)	Tg(<U+00A0>dlx6a-1.4kbdlx5a/dlx6a:GFP<U+00A0>);Tg(<U+00A0>vglut:DsRed<U+00A0>)	26833134	400	Expeimentalparadigm: Locomotion test  /n  Model Generation: Mutations in<U+00A0>cntnap2a<U+00A0>and<U+00A0>cntnap2b<U+00A0>were generated using zinc finger nucleases. The<U+00A0>cntnap2aΔ121/Δ121cntnap2b31i/31i<U+00A0>and<U+00A0>cntnap2aΔ25/Δ25cntnap2bΔ7/Δ7<U+00A0>lines were generated by incrossing double homozygotes, which are viable and fertile. Tg(dlx6a-1.4kbdlx5a/dlx6a:GFP) and Tg(vglut:DsRed) were obtained from the laboratories of M. Ekker and J. Fetcho, respectively.<U+00A0>cntnap2aΔ121/Δ121cntnap2b31i/31i<U+00A0>mutants were crossed to these transgenic lines.  /n  Rescue: Finally, we find that estrogen receptor agonists elicit a behavioral fingerprint anti-correlative to that of<U+00A0>cntnap2<U+00A0>mutants and show that the phytoestrogen biochanin A specifically reverses the mutant behavioral phenotype.<U+00A0>  /n  Model Summary: Here we investigate the function of Cntnap2 and undertake pharmacological screens to identify phenotypic suppressors. We find that zebrafish<U+00A0>cntnap2<U+00A0>mutants display GABAergic deficits particularly in the forebrain and sensitivity to drug-induced seizures. High-throughput behavioral profiling identifies nighttime hyperactivity in<U+00A0>cntnap2<U+00A0>mutants, while pharmacological testing reveals dysregulation of GABAergic and glutamatergic systems.<U+00A0>These results identify estrogenic compounds as phenotypic suppressors and illuminate novel pharmacological pathways with relevance to autism.	NA	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Autism Spectrum Disorder	X A7.1|X 34.83 cM	Knockout	FVB	26850918	401	Expeimentalparadigm: Deviant sound paradigm  /n  Model Generation: The FVB.Cg-Mmp-9tm1Tvu/J and FVB.129P2-Fmr1tm1Cgr/J (Fmr1 KO) and FVB.129P2-Pde6bTyr+c-ch/AntJ controls (WT) were obtained from The Jackson Laboratory. The FVB.Cg-Mmp-9tm1Tvu/J mice were backcrossed, in-house, with the Fmr1 KO mice or WT mice to generate Fmr1/Mmp-9 DKO or Mmp-9 KO mice, respectively. All genotypes were confirmed by PCR analysis of genomic DNA isolated from mouse tails.  /n  Rescue: -  /n  Model Summary: Fragile X Syndrome (FXS) is a leading genetic cause of intellectual disability and autism. Electrophysiological responses in humans with FXS show reduced habituation with sound repetition and this deficit may underlie auditory hypersensitivity in FXS. Our previous study in Fmr1 knockout (KO) mice revealed an unusually long state of increased sound-driven excitability in auditory cortical neurons suggesting that cortical responses to repeated sounds may exhibit abnormal habituation as in humans with FXS. Here, we tested this prediction by comparing cortical event related potentials (ERP) recorded from wildtype (WT) and Fmr1 KO mice.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Caprin1	CAPRIN1	protein-coding	Mus musculus	ENSMUSG00000027184	Caprin-1|Gpiap|Gpiap1|Mmgpip137|P137|rng105	53872	Autism Spectrum Disorder	2|2 E2	Knockout	C57BL/6	26865403	402	Expeimentalparadigm: Three-chambered social approach test//Social interaction test in a home cage//Social interaction test in a novel environment//Novel object recognition test//Place recognition test//Barnes maze test//T-maze  /n  Model Generation: Here, we demonstrate that RNG105 knock-out in mice reduces the dendritic localization of mRNAs for Na+/K+<U+00A0>ATPase (NKA) subunit isoforms (i.e., α3, FXYD1, FXYD6, and FXYD7) and backcrossed for more than 10 generations on the C57BL/6 background. Rng105+/<U+2212> mice and wild-type littermates were prepared by crossing wild-type female mice and Rng105+/<U+2212> male mice.  /n  Rescue: -  /n  Model Summary: These findings suggest that the RNG105 heterozygous knockout leads to a reduction in sociality, response to novelty and flexibility in learning, which are implicated in ASD-like behavior.	RNA binding	Ani
Fkbp1b	FKBP1B	protein-coding	Mus musculus	ENSMUSG00000020635	12.6kDa|FKBP12.6|calstabin2	14226	Cognitive Disorders	12|12 A1.1	Knockout	129/SvEv;C57BL/6	26888649	403	Expeimentalparadigm: Morris water maze//Fear conditioning test//Open field test//Rotarod  /n  Model Generation: An FKBP12.6 genomic clone encoding the entire<U+00A0>FKBP12.6<U+00A0>gene was isolated from a murine 129/SvEv genomic DNA library (Stratagene) using mouse FKBP12.6 complementary DNA as a probe. The targeting vector contained PGK-neo flanked by<U+00A0>FKBP12.6<U+00A0>genomic DNA and an HSV-TK cassette30<U+00A0>and resulted in replacement of exon 3 with the<U+00A0>neor<U+00A0>expression cassette in homologous recombinants selected with G418 and gancyclovir. Chimaeric male mice obtained from two selected embryonic stem cell clones were bred to either 129/SvEv female mice to establish an inbred line, or to C57BL/6 female mice to establish a hybrid line. Homozygous null mice were obtained by heterozygous mating.  /n  Rescue: -  /n  Model Summary: Thus, these results suggest that neuronal RyR2 Ca2+<U+00A0>leak due to Calstabin2 deletion contributes to learning deficiency and memory impairment.	peptidyl-prolyl cis-trans isomerase activity,signaling receptor binding,protein binding,FK506 binding,isomerase activity,calcium channel inhibitor activity,cyclic nucleotide binding,transmembrane transporter binding	Ani
row	POGZ	protein-coding	Drosophila melanogaster		CG8092|Dmel\CG8092|ROW|Row|anon-WO0118547.194	36685	Autism Spectrum Disorder	51E5-51E7|2-74 cM	Knockdown	vdrc28196, vdrc60000	26942287	404	Expeimentalparadigm: Light-off jump reflex habituation assay  /n  Model Generation: The inducible RNAi line against the POGZ Drosophila ortholog row (vdrc28196, no predicted off-targets) and its genetic background control line (vdrc60000) were obtained from the Vienna Drosophila Resource Center.39 For the habituation experiments, RNAi was induced with the GAL4-UAS system and the panneuronal elav-Gal4 driver line w1118; 2xGMR-wIR; elav-Gal4, UAS-Dicer-2. The genetic elements in this line suppress eye color as required for the light-off jump response (2xGMR-wIR)40, 41 and increase RNAi efficiency (UAS-Dicer2), respectively.39 Flies were reared and tested at 25°C and 70% humidity. For qPCR experiments, RNAi was induced with the ubiquitous actin-Gal4 driver line (w1118; actin-Gal4/CyOGFP).  /n  Rescue: -  /n  Model Summary: Intellectual disability (ID) and autism spectrum disorders (ASD) are genetically heterogeneous, and a significant number of genes have been associated with both conditions. A few mutations in POGZ have been reported in recent exome studies; however, these studies do not provide detailed clinical information. We conducted parallel studies in Drosophila by inducing conditional knockdown of the POGZ ortholog row, further confirming that dosage of POGZ, specifically in neurons, is essential for normal learning in a habituation paradigm.	chromatin binding,protein binding	Ani
Cxcl12	CXCL12	protein-coding	Mus musculus	ENSMUSG00000061353	Pbsf|Scyb12|Sdf1|Tlsf|Tpar1	20315	Anxiety Disorder	6 54.81 cM|6 F1	Overexpression	C57BL/6	26952745	405	Expeimentalparadigm: Elevated plus maze//Open field test//Nest-construction test  /n  Model Generation: Six- to eight-week-old C57BL/6 male mice were purchased and were individually housed in standard plastic cages. Adult C57BL/6 male mice were injected intraperitoneally with either LPS (0.05 or 0.5 mg/kg in 0.1 ml) or saline (0.1 ml per mouse). The animals were subjected to behavioral evaluations by elevated plus maze and open field test assessments 6 h after LPS or saline injection. Accordingly, the remaining animals underwent the measurement of brain regional CXCL12 levels after injections.  /n  Rescue: AMD3100, which is an antagonist for CXCL12 receptor CXCR4, prevented the anxiety behaviors induced by microinjection of CXCL12 into amygdala as well as injection i.p of LPS. Knockdown of CXCR4 expression in neurons using short hairpin RNAs (shRNAs) significantly blocked anxiety behaviors mediated by CXCL12 i.c injection.  /n  Model Summary: It is evidenced that inflammation is involved in the pathogenesis of anxiety disorder, as well as the dysfunction of glutamate neurotransmission in the central nervous system (CNS). Chemokine CXCL12 has been reported taking part in the regulation of neurotransmitter release, however, the roles of CXCL12 in the development of anxiety are still unclear. In this study, we found that intraperitoneal (i.p) injection of lipopolysaccharide (LPS) induced anxiety-like behaviors in adult mice as measured by elevated plus-maze test (EPM) and open field test (OFT). Astrocytes were responsible for CXCL12 induction upon LPS challenge in hippocampus and amygdala, and microinjection of CXCL12 into amygdala induced mice anxiety-like behaviors.	cytokine activity,integrin binding,chemokine activity,growth factor activity,chemokine receptor binding,CXCR chemokine receptor binding	Ani
stxbp1a	STXBP1	protein-coding	Zebrafish	ENSDARG00000001994	fj43h10|stxbp1|wu:fj36d12|wu:fj43h10|zgc:114171	574003	Neurodevelopmental Disorders	-	Mutated(CRISPR/Cas9)	TL;WIK	26963117	406	Expeimentalparadigm: Locomotion tracking  /n  Model Generation: CRISPR/Cas9 mutations were generated in wild-type (TL strain) zebrafish using published techniques [38, 39]. Sequence-specific sgRNA template plasmids were generated for each target site by modifying DR274 (Addgene Plasmid #42250). Plasmid Dr274 was modified to contain gene-specific sequences selected using ZiFit software [40]. In order to avoid off-target genomic mutagenesis effects, which can occur at sites that closely resemble the target site, we selected target sites that have a minimum of three mismatches with every other site in the genome. The sequences of the modified plasmids were verified by Sanger sequencing (Quintarabio). sgRNAs were transcribed from linearized template plasmids (Ambion MEGAscript T7/SP6), and purified (Ambion MegaClear Kit). Cas9 mRNA was transcribed in vitro from linearized template plasmid MLM3613 (Addgene Plasmid #42251). Fertilized 1–2 cell stage zebrafish eggs were injected with an injection mix containing approximately 300ng/μl Cas9 mRNA and 15 ng/μl sgRNA. After injected eggs were incubated for one day, some were harvested to check for mutagenesis at the target site. DNA was extracted from pools of 10 injected embryos and uninjected controls, gDNA including the target site was amplified, and the target site was checked via Sanger sequencing. Multiple sequencing peaks were confirmed to be present at the sgRNA target site before proceeding. Other Cas9/sgRNA-injected embryos were raised to adulthood. These F0-generation potential mutants were crossed, and DNA was extracted from pooled F1 embryos for PCR and sequencing, as performed on the injected embryos. To obtain stable lines with known mutations, F1 embryos were raised to adulthood and outcrossed to wild-type (WIK strain) zebrafish. For adult fish of each line, genomic DNA was extracted from tail tissue, amplified by PCR, cloned into TOPO pcr2.1 vector, and sequenced. Mutations were identified and multiple individuals from each line were sequenced to confirm that each individual carried the same mutation.  /n  Rescue: -  /n  Model Summary: To understand the functions of stxbp1a and stxbp1b, we generated loss-of-function mutations using CRISPR/Cas9 gene editing and studied brain electrical activity, behavior, development, heart physiology, metabolism, and survival in larval zebrafish. Homozygous stxbp1a mutants exhibited a profound lack of movement, low electrical brain activity, low heart rate, decreased glucose and mitochondrial metabolism, and early fatality compared to controls. On the other hand, homozygous stxbp1b mutants had spontaneous electrographic seizures, and reduced locomotor activity response to a movement-inducing "dark-flash" visual stimulus, despite showing normal metabolism, heart rate, survival, and baseline locomotor activity.	syntaxin-1 binding,syntaxin binding	Ani
Arhgap32	ARHGAP32	protein-coding	Mus musculus	ENSMUSG00000041444	3426406O18Rik|Gc-gap|Grit|Px-rics|Rics|mKIAA0712|p200Rhogap|p250Gap	330914	Autism Spectrum Disorder	9|9 A4	Knockout	C57BL/6N	26979507	407	Expeimentalparadigm: Three-chamber stest//Dyadic social interaction test//Social dominance tube test//Olfactory habituation-dishabituation test//Ultrasonic vocalizations//Repetitive behaviour//T-maze//Rotarod//Foot-clasping test//Seizure susceptibility test//Elevated plus maze  /n  Model Generation: PX-RICS-deficient mice were generated as described elsewhere21. Mutant mice were backcrossed to C57BL/6N (CLEA Japan) background to the F10 generation.<U+00A0>  /n  Rescue: -  /n  Model Summary: Our findings demonstrate a critical role of PX-RICS in cognition and suggest a causal link between<U+00A0>PX-RICS<U+00A0>deletion and ASD-like behaviour in JBS patients.	GTPase activator activity,protein binding,phosphatidylinositol binding,phosphatidylinositol phosphate binding	Ani
Ptchd1	PTCHD1	protein-coding	Mus musculus	ENSMUSG00000041552	9630036J22Rik|Gm387	211612	Attention-Deficit/Hyperactivity Disorder	X|X F3	Conditional Knockout	C57BL/6	27007844	408	Expeimentalparadigm: Sleep analysis//Visual detection task//Open field test//Grooming//Rotarod//Wire-hang test//Gait analysis//Hot plate test//Acoustic startle and prepulse inhibition//Three Chamber Social Test//Resident intruder//Inhibitory avoidance//Fear conditioning test//Morris water maze  /n  Model Generation: Ptchd1 conditional knockout mice were generated by homologous recombination in R1 embryonic stem cells and implanted in C57Bl/6J blastocysts using standard procedures. The targeting vector was designed to flank Exon 2 of the Ptchd1 gene with loxP sites and a NEO cassette. Chimaeric mice were crossed to C57Bl/6J females (Jackson Labs).  /n  Rescue: -  /n  Model Summary: Here we report that during early post-natal development, mouse Ptchd1 is selectively expressed in the thalamic reticular nucleus (TRN), a group of GABAergic neurons that regulate thalamocortical transmission, sleep rhythms, and attention. Ptchd1 deletion attenuates TRN activity through mechanisms involving small conductance calcium-dependent potassium currents (SK). TRN-restricted deletion of Ptchd1 leads to attention deficits and hyperactivity, both of which are rescued by pharmacological augmentation of SK channel activity. Global Ptchd1 deletion recapitulates learning impairment, hyper-aggression, and motor defects, all of which are insensitive to SK pharmacological targeting and not found in the TRN-restricted deletion mouse.	protein binding	Ani
Brinp1	BRINP1	protein-coding	Mus musculus	ENSMUSG00000028351	BRINP|Dbc1|Dbccr1|Fam5a	56710	Autism Spectrum Disorder	4|4 C1	Conditional Knockout	C57BL/6	27042284	409	Expeimentalparadigm: Visual placing test//Rotarod//Three-chamber social interaction test//Elevated plus maze//Y-maze//Acoustic startle and pre-pulse inhibition//Self-directed digging //Grooming behaviours//Morris water maze  /n  Model Generation: we generated conditional exon 3-deleted<U+00A0>Brinp1<U+2212>/<U+2212><U+00A0>mice, via the LoxP/Cre-recombinase system. A correctly targeted clone was injected into BALB/c blastocysts to generate chimeric mice, which were crossed to C57BL/6 Cre deleter transgenic mice Tg(CMV-cre)1Cgn to remove exon 3 and the neomycin cassette from the targeted allele. This produced animals carrying the Brinp1tm1.1Pib mutation (MGI: 5604542). In parallel, chimeric mice were crossed to C57BL/6 Flp deleter transgenic mice to remove the neomycin cassette only (Brinp1tm1.2Pib (MGI: 5604543)). ‘Floxed’ mice heterozygous for the Brinp1tm1.1Pib mutation were inter-crossed to generate mice of all three genotypes: Brinp1+/+ (wild type, WT); Brinp1+/tm1.1Pib (het); and Brinp1tm1.1Pib/tm1.1Pib (Brinp1<U+2212>/<U+2212>).  /n  Rescue: -  /n  Model Summary: Absence of<U+00A0>Brinp1<U+00A0>during development results in a behavioural phenotype resembling autism spectrum disorder (ASD), in which knock-out mice show reduced sociability and changes in vocalisation capacity. In addition,<U+00A0>Brinp1<U+2212>/<U+2212><U+00A0>mice exhibit hyper-locomotor activity, have impaired short-term memory, and exhibit poor reproductive success.	molecular_function	Ani
Bdnf	BDNF	protein-coding	Mus musculus	ENSMUSG00000048482	-	12064	Anorexia Nervosa	2 E3|2 56.63 cM	Knockin	tetO-TeTxLC-IRES-tau-lacZ	27045846	410	Expeimentalparadigm: Social isolation stress //Caloric restriction<U+00A0>  /n  Model Generation: A 370 bp fragment, located 5′ of the mouse<U+00A0>BDNF<U+00A0>coding region, was amplified from genomic mouse DNA using the following primers: 5′-ACAGATGTAGTAAAACGTTGGAG-3′, 5′-TTACTGATCCACTCCAGCTGC-3′. This fragment was subcloned into pGEMT (Promega) using T-A cloning and was used as a probe against a 129 Sv/Ev BAC library. One of the identified BAC clones was expanded for use in the generation of targeting constructs.  /n  Rescue: -  /n  Model Summary: We found that the Val66Met genotype markedly increases the likelihood and severity of abnormal feeding behavior triggered by CR, but only when CR is imposed in the peri-pubertal period.	signaling receptor binding,nerve growth factor receptor binding,neurotrophin TRKB receptor binding,protein binding,growth factor activity	Ani
Tacr1	TACR1	protein-coding	Mus musculus	ENSMUSG00000030043	Nk1r|Spr|Tac1r	21336	Attention-Deficit/Hyperactivity Disorder	6|6 C3	Knockout	129/Sv;C57BL/6J	27097734	411	Expeimentalparadigm: 5-Choice serial reaction time task  /n  Model Generation: A genomic DNA clone containing exon 1 of the mouse NK1receptor gene was isolated by screening a λ2001 mouse 129 library with a rat NK-1 cDNA probe3. A cassette containing an internal ribosome entry site and the<U+00A0>lacZ<U+00A0>coding sequence11, together with a neomycin-resistance gene expressed from its own promoter, was inserted into the unique<U+00A0>StuI site in exon 1. For negative selection, two copies of an HSV-tk<U+00A0>gene were inserted in the 5′ polylinker11. The vector was linearized and electroporated into HM1 ES cells. G418- and GANC-resistant clones were selected and identified. Two targeted clones were injected into C57BL/6 blastocysts, and chimaeric males were mated with C57BL/6 females. Transmission of the mutant allele was determined by Southern blot analysis of tail DNA. Mice homozygous for the NK1 mutation were produced by crossing heterozygotes.  /n  Rescue: -  /n  Model Summary: We have reported previously that genetically altered mice, lacking functional NK1R (NK1R–/–), express locomotor hyperactivity, which was blunted by the first-line treatment for ADHD, methylphenidate.	G protein-coupled receptor activity,tachykinin receptor activity,substance P receptor activity	Ani
Dcdc2	DCDC2	protein-coding	Rattus norvegicus	ENSRNOG00000017511	-	291130	Developmental Dyslexia	17p11	Knockdown(RNAi)	Wistar	27122044	412	Expeimentalparadigm: Auditory processes//Neural responses to sounds  /n  Model Generation: Transfection of<U+00A0>in utero<U+00A0>RNAi of dyx1c1 was performed by JB at the University of Connecticut. In all Dyx1c1 treatments, plasmids encoding short hairpin (pU6DyxHPB) RNA (Dyx1c1 RNAi) and plasmids encoding eGFP (green fluorescent protein) were co-transfected into the ventricular zone (VZ) by<U+00A0>in utero<U+00A0>electroporation. Sham subjects received transfection only with plasmids (pCAGGS-RFP) encoding mRFP (red fluorescent protein). Transfection occurred around E14 in time–mated dams.  /n  Rescue: -  /n  Model Summary: Knockdown of Dyslexia-Gene<U+00A0>Dcdc2<U+00A0>Interferes with Speech Sound Discrimination in Continuous Streams	kinesin binding	Ani
Ctnnb1	CTNNB1	protein-coding	Mus musculus	ENSMUSG00000006932	Bfc|Catnb|Mesc	12387	Autism Spectrum Disorder	9 F4|9 72.19 cM	Conditional Knockout	B6.129-CTNNB1<U+00A0>tm2Kem/KnwJ;B6; 129P2-Pvalb tm1(cre)Arbr/J	27131348	413	Expeimentalparadigm: Open field test//Elevated plus maze test//Novel object recognition test//Social interaction test//Morris water maze//Grooming//Marble burying test//Tail suspension test//Rotarod//Nest building test//Fear conditioning test  /n  Model Generation: The CTNNB1flox/flox<U+00A0>mice (B6.129-CTNNB1tm2Kem/KnwJ) and the PV-Cre mice (B6; 129P2-Pvalbtm1(cre)Arbr/J) from the Jackson Laboratory (Bar Harbor, ME) were used to produce the heterozygous offspring. PV-Cre; CTNNB1<U+00A0>flox/flox<U+00A0>mouse model were generated by backcrossing of F1 hybrids.<U+00A0>  /n  Rescue: -  /n  Model Summary: we generated CTNNB1 conditional knockout (cKO) mice in parvalbumin interneurons. The cKO mice had increased anxiety, but had no overall change in motor function. Interestingly, CTNNB1 cKO in PV-interneurons significantly impaired object recognition and social interactions and elevated repetitive behaviors, which mimic the core symptoms of patients with ASD.<U+00A0>	transcription coregulator binding,transcription corepressor binding,nucleic acid binding,chromatin binding,transcription coactivator activity,protein binding,beta-catenin binding,protein C-terminus binding,transcription factor binding,nuclear receptor binding,enzyme binding,kinase binding,protein kinase binding,protein phosphatase binding,nuclear estrogen receptor binding,ionotropic glutamate receptor binding,transmembrane transporter binding,protein-containing complex binding,alpha-catenin binding,cadherin binding,SMAD binding,nitric-oxide synthase binding,RNA polymerase II-specific DNA-binding transcription factor binding,delta-catenin binding,I-SMAD binding,disordered domain specific binding,DNA-binding transcription factor binding,molecular function activator activity,histone methyltransferase binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Neurodevelopmental Disorders	15|15 E3	Conditional Knockout	129/SvEv	27161151	414	Expeimentalparadigm: Spray test//Hole board test//Juvenile nest choice//Social dyadic test//Pup ultrasonic vocalizations//Adult ultrasonic vocalizations//Open field test//Light–dark box test//Reactivity in a novel environment//Rotarod//Continuous reinforcement training  /n  Model Generation: The targeting constructs were prepared using a previously described recombineering method60.The 129/SvEv BAC clone (bMQ457K21) covering the Shank3 gene was first identified in silico using the Ensembl mouse genome browser (www.ensembl. org) and the clone was obtained from Geneservice Ltd, UK61. Shank3Δe4-22 mice were generated by a two-step targeting strategy using the Cre-loxP system. The first (5′) construct inserted the loxP1 and loxP2 sites flanking exons 4–9 with a neomycin cassette. The second (3′) construct inserted the loxP3 at a 3′-site 5<U+2009>kb-downstream of exon 22 with a puromycin cassette (Fig. 1a and Supplementary Fig. 1b).  /n  Rescue: -  /n  Model Summary: Here, we describe a complete knockout mouse model of the autism-associated Shank3 gene, with a deletion of exons 4-22 (Δe4-22). Both mGluR5-Homer scaffolds and mGluR5-mediated signalling are selectively altered in striatal neurons. These changes are associated with perturbed function at striatal synapses, abnormal brain morphology, aberrant structural connectivity and ASD-like behaviour. In vivo recording reveals that the cortico-striatal-thalamic circuit is tonically hyperactive in mutants, but becomes hypoactive during social behaviour. Manipulation of mGluR5 activity attenuates excessive grooming and instrumental learning differentially, and rescues impaired striatal synaptic plasticity in Δe4-22(-/-) mice.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Dgkh	DGKH	protein-coding	Mus musculus	ENSMUSG00000034731	5930402B05Rik|D130015C16|DGK	380921	Manic Episodes	14|14 D3	Knockout	C57BL/6;CBA	27167678	415	Expeimentalparadigm: Open field test//Elevated plus maze//Tail suspension test//Barnes maze test  /n  Model Generation: DGKη-Knockout mice were originated from C57BL/6 and CBA background (RIKEN, Knockoutbe, Japan), and then backcrossed with C57BL/6 mice (Japan SLC, Hamamatsu, Japan) for at least five generations to eliminate any background effects on the observed phenotypes.  /n  Rescue: -  /n  Model Summary: Deficiency of diacylglycerol kinase η induces lithium-sensitive mania-like behavior	nucleotide binding,NAD+ kinase activity,diacylglycerol kinase activity,ATP binding,kinase activity,transferase activity,kinase binding,SAM domain binding,identical protein binding,protein homodimerization activity,metal ion binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6	27189882	416	Expeimentalparadigm: Touchscreen pairwise discrimination//Open field test//Three chamber test//Repetitive self-grooming  /n  Model Generation: The<U+00A0>Shank3B<U+00A0>line characterized by a mutation within the PDZ domain was originally generated by the Feng lab (Peca et al., 2011). A neo cassette replaced exons 13–16 of the<U+00A0>Shank3<U+00A0>gene, resulting in a deficiency of isoforms Shank3α and Shank3β, and a reduction in expression of the Shank3γ isoform. Breeding pairs were purchased from The Jackson Laboratory (Bar Harbor, Maine, stock #01768). Genotype was determined by standard PCR, with the following primers: primer F1b (GAGCTCTACTCCCTTAGGACTT) and R1b (TCCCCCTTTCACTGGACACCC) for the wild-type allele (316 base pairs), and F1b and R2 (TCAGGGT-TATTGTCTCATGAGC; in the neo cassette) for the mutant allele (360 base pairs). The neo cassette was not removed. Heterozygous (+/–) males and females were bred to generate subject mice used in the present study.  /n  Rescue: -  /n  Model Summary: These results indicate a deficit in discrimination learning in the<U+00A0>Shank3B<U+00A0>model of PMS and ASD, suggesting that this mouse model is a useful preclinical tool for studying neurobiological mechanisms behind cognitive impairments in PMS and ASD.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Gabra5	GABRA5	protein-coding	Mus musculus	ENSMUSG00000055078	A230018I05Rik	110886	Autism Spectrum Disorder	7 B5|7 33.52 cM	Knockout	C57BL/6J / Sv129Ev	27231709	417	Expeimentalparadigm: Social interaction//Social preference//Grooming//Executive function//Ultrasonic vocalization  /n  Model Generation: Gabra5<U+00A0><U+2212>/<U+2212><U+00A0>mice were generated using a C57BL/6J and Sv129Ev background,  /n  Rescue: -  /n  Model Summary: We found that deletion of the gene for the<U+00A0>α5 subunit of the GABAA<U+00A0>receptor caused robust autism‐like behaviors in mice, including reduced social contacts and vocalizations.<U+00A0>	transmembrane signaling receptor activity,GABA-A receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,inhibitory extracellular ligand-gated ion channel activity,chloride channel activity,protein binding,benzodiazepine receptor activity,GABA-gated chloride ion channel activity,neurotransmitter receptor activity,GABA receptor binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Autism Spectrum Disorder	X A7.1|X 34.83 cM	Knockout	C57BL/6J	27233938	418	Expeimentalparadigm: Direct social iInteraction//Motor stereotypes//Nest-building behavior//Skilled motor iearning//Novelty object recognition test  /n  Model Generation: Dgkκ mRNA is expressed throughout the brain (Fig. S3A), but its involvement in synaptic plasticity was unknown. We focused on the well-characterized CA1 region of mouse hippocampus. We performed Dgkκ silencing in organotypic slices with a validated shRNA (Fig. S3 B–D). We examined the effect of Dgkκ silencing on long-term potentiation (LTP) and long-term depression (LTD), two forms of synaptic plasticity that are altered in Fmr1-/y mice (5, 21, 22). Theta burst stimulation (TBS)-induced LTP at Schaffer collateral-CA1 region was reduced with shRNA–Dgkκ (112% ± 3% at 30–40 min, instead of 135% ± 6% with shRNA–scramble) (Fig. 3A), whereas low-frequency stimulation-induced LTD was increased (83% ± 3% at 30–40 min, instead of 95% ± 3% with shRNA–scramble) (Fig. 3B).  /n  Rescue: Overexpression of Dgkκ in neurons is able to rescue the dendritic spine defects of the Fragile X Mental Retardation 1 gene KO neurons.  /n  Model Summary: Here we show by cross-linking immunoprecipitation in cortical neurons that FMRP is mostly associated with one unique mRNA: diacylglycerol kinase kappa (Dgkκ), a master regulator that controls the switch between diacylglycerol and phosphatidic acid signaling pathways. The absence of FMRP in neurons abolishes group 1 metabotropic glutamate receptor-dependent DGK activity combined with a loss of Dgkκ expression. The reduction of Dgkκ in neurons is sufficient to cause dendritic spine abnormalities, synaptic plasticity alterations, and behavior disorders similar to those observed in the FXS mouse model.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Slc33a1	SLC33A1	protein-coding	Mus musculus	ENSMUSG00000027822	Acatn|D630022N01Rik	11416	Autism Spectrum Disorder	3|3 E1	Transgene	TRE-AT-1 Tg;C57BL/6	27242167	419	Expeimentalparadigm: Morri water maze//Novel object recognition test//Marble burying test//Social interaction test  /n  Model Generation: cDNA encoding human AT-1 was isolated by BamHI and EcoRV digestion from Topo-AT-1 constructs and subcloned into pTRE-Tight vector (Takara Bio Inc.). TRE-AT-1 Tg lines were generated by injection of linearized pTRE-Tight vector (Takara Bio Inc.) containing AT-1 cDNA into the pronucleus of fertilized eggs from FVB mice. Monogenic pTRE-AT-1 mice were backcrossed to WT C57BL/6 mice for five generations, and then bred to CamK2a-tTA mice (B6.Cg-Tg(Camk2a-tTA)1Mmay/DboJ; The Jackson Laboratory), generating nonTg WT, Camk2a-tTA monogenic, TRE-AT-1 monogenic, and CamK2a-tTA;TRE-AT-1 (referred to as AT-1 Tg) mice. Genotyping from tail DNA was performed using the following primers: AT-1 forward (5′-AATCTGGGAAACTGGCCTTCT-3′), AT-1 reverse (5′-TATTACCGCCTTTGAGTGAGCTGA-3′), Camk2a-tTA forward (5′-CGCTGTGGGGCATTTTACTTTAG-3′), and Camk2a-tTA reverse (5′-CATGTCCAGATCGAAATCGTC-3′).  /n  Rescue: -  /n  Model Summary: Mutations or duplications in AT-1/SLC33A1 have been linked to diseases such as familial spastic paraplegia, developmental delay with premature death, and autism spectrum disorder with intellectual disability. In this study, we generated an AT-1 Tg mouse model that selectively overexpresses human AT-1 in neurons. These animals demonstrate cognitive deficits, autistic-like social behavior, aberrations in synaptic plasticity, an increased number of dendritic spines and branches, and widespread proteomic changes.	acetyl-CoA transmembrane transporter activity,solute:proton symporter activity	Ani
Adgrl3	ADGRL3	protein-coding	Mus musculus	ENSMUSG00000037605	5430402I23Rik|CIRL-3|D130075K09Rik|Gm1379|LEC3|Lphn3|mKIAA0768	319387	Attention-Deficit/Hyperactivity Disorder	5|5 D- E1	Knockout	129S4/Sylvae;C57BL/6	27247960	420	Expeimentalparadigm: Instrumental responding for food reward on ascending fixed ratio schedules//Delayed response working memory task//Rotarod test//Forced swim test  /n  Model Generation: Mice originated from a colony of Lphn3 (129S4/Sylvae and C57 mixed background) (Gene ID: 319387) mutant mice maintained by heterozygous matings. All animals were genotyped from genomic DNA isolated from tails collected at weaning using Extract-N-Amp (Sigma Aldrich, St. Louis, MO).  /n  Rescue: -  /n  Model Summary: Behaviorally, loss of Lphn3 increases both reward motivation and activity levels. Lphn3 null mice display significantly greater instrumental responding for food than wild-type mice, particularly under high response ratios, and swim incessantly during a forced swim assay. However, loss of Lphn3 does not interfere with working memory or motor coordination. Primary hippocampal and cortical neuron cultures demonstrate that null neurons display comparatively enhanced neurite outgrowth after 2 and 3 days in vitro. Standard blood chemistry panels reveal that nulls have low serum calcium levels. Finally, analysis of the transcriptome from prefrontal cortical, striatal, and hippocampal tissue at different developmental time points shows that loss of Lphn3 results in genotype-dependent differential gene expression (DGE), particularly for cell adhesion molecules and calcium signaling proteins. Much of the DGE is attenuated with age, and is consistent with the idea that ADHD is associated with delayed cortical maturation.	transmembrane signaling receptor activity,G protein-coupled receptor activity,calcium ion binding,protein binding,carbohydrate binding,metal ion binding	Ani
Atp8a1	ATP8A1	protein-coding	Mus musculus	ENSMUSG00000037685	APLT|Atp3a2|B230107D19Rik|ClassI	11980	Autism Spectrum Disorder	5|5 C3.1	Overexpression	C57BL/6	27287255	421	Expeimentalparadigm: Three-chamber test//Novel object recognition task  /n  Model Generation: C57BL/6 wild-type (WT) mice and the C57BL/6<U+00A0>Atp8a1<U+00A0>(+/<U+2212>) mice were purchased from Taconic Farm and Jackson Laboratories, respectively. The heterozygous<U+00A0>Atp8a1<U+00A0>(+/<U+2212>) mice were paired and the offspring were genotyped as reported earlier to identify<U+00A0>Atp8a1<U+00A0>(<U+2212>/<U+2212>) mice<U+00A0>[12]. In order to prevent any genetic drift, after every fifth generation, the<U+00A0>Atp8a1<U+00A0>(<U+2212>/<U+2212>) were paired with fresh C57BL/6 wild-type mice to again produce<U+00A0>Atp8a1<U+00A0>(+/<U+2212>) mice which were subsequently bred and genotyped to generate<U+00A0>Atp8a1<U+00A0>(<U+2212>/<U+2212>) mice according to our previous report<U+00A0>[12]<U+00A0>(Fig. S1).  /n  Rescue: -  /n  Model Summary: Lentiviral – transduced Atp8a1 overexpression at p6 elicits autistic-like sociability behavior in adult mice.The Atp8a1 + mice may serve as an animal model for autism.	nucleotide binding,magnesium ion binding,transporter activity,protein binding,ATP binding,ATP hydrolysis activity,metal ion binding,ATPase-coupled intramembrane lipid transporter activity,phosphatidylserine flippase activity	Ani
Tert	TERT	protein-coding	Mus musculus	ENSMUSG00000021611	EST2|TCS1|TP2|TR|TRT	21752	Aggressive Behaviors	13 C1|13 40.12 cM	Knockout	FVB/N	27300262	422	Expeimentalparadigm: Resident–intruder test//Open field test//Fensive aggressive behavior test//Tail suspension test//Forced swim test//Sucrose preference test //Elevated maze test//Light–dark box test//Open field test  /n  Model Generation: The production of mTERT knockout mice (Tert-/-) and the lack of telomerase activity in these mice were previously described.16 Tert-/-mice were backcrossed to FVB/N mice to produce mice heterozygous for Tert. Tert+/- mice were intercrossed to produce the first generation of Tert-/- mice (F1). All subjects in the experiments were from the fourth or fifth generation after intercrossing F1 Tert-/- homozygotes.  /n  Rescue: In addition, increased serotonergic transmission by the 5-HTR1A agonist in the mPFC was sufficient to rescue the aggressive behavior of Tert(-/-) mice.  /n  Model Summary: The role of telomerase reverse transcriptase (TERT) has been extensively investigated in the contexts of aging and cancer. Interestingly, Tert(-/-) mice exhibit additional but unexpected aggressive and depressive behaviors, implying the potential involvement of TERT function in mood control.	tRNA binding,transcription coactivator binding,DNA binding,telomerase activity,telomerase RNA reverse transcriptase activity,RNA binding,RNA-directed DNA polymerase activity,RNA-dependent RNA polymerase activity,protein binding,protein C-terminus binding,transferase activity,nucleotidyltransferase activity,telomeric DNA binding,identical protein binding,protein homodimerization activity,metal ion binding,protein N-terminus binding,chaperone binding,telomerase RNA binding,template-free RNA nucleotidyltransferase	Ani
Mecp2	MECP2	protein-coding	Rattus norvegicus	ENSRNOG00000056659	-	29386	Neurodevelopmental Disorders	Xq37	Knockout	Sprague Dawley	27313794	423	Expeimentalparadigm: Grip strength test//Spontaneous locomotion test//Three-chamber test  /n  Model Generation: The experiments were performed on male<U+00A0>Mecp2<U+2212>/Y<U+00A0>rats because the male model offers a completely<U+00A0>Mecp2-null condition that is not always available in the female owing to random X-chromosome inactivation [26,<U+00A0>27]. To breed these males, the female heterozygous<U+00A0>Mecp2+/<U+2212><U+00A0>rat (SD-Mecp2tm1sage, strain code: TGRA6090) from the supplier company Horizon Discovery Group (Boyertown, PA) were crossbred with the male Sprague-Dawley wild-type rat (WT).<U+00A0>  /n  Rescue: -  /n  Model Summary: Mecp2<U+2212>/Y<U+00A0>rats displayed growth retardation, malocclusion, and lack of movements, while hindlimb clasping was not seen. They had weaker forelimb grip strength and a lower rate of locomotion than the WT littermates. Defects in social interaction with other rats were obvious. Breathing frequency variation and apnea in the null rats were significantly higher than in the WT. LC neurons in the null rats showed excessive firing activity. A half of the null rats died in 2<U+00A0>months.	four-way junction DNA binding,nucleic acid binding,DNA binding,chromatin binding,DNA-binding transcription factor activity,transcription corepressor activity,mRNA binding,protein binding,methyl-CpG binding,double-stranded methylated DNA binding,enzyme binding,protein domain specific binding,chromatin DNA binding,siRNA binding,histone deacetylase binding,unmethylated CpG binding,protein N-terminus binding,molecular adaptor activity,molecular condensate scaffold activity,promoter-specific chromatin binding	Ani
Slc30a3	SLC30A3	protein-coding	Mus musculus	ENSMUSG00000029151	Znt3	22784	Autism Spectrum Disorder	5 B1|5 16.97 cM	Mutated	C57Bl/129Sv	27352957	424	Expeimentalparadigm: Three-chamber test//Reciprocal social interaction test//Open field test//Marble burying test  /n  Model Generation: ZnT3 null mice and their wild-type (WT) littermates, hybrid of C57Bl/129Sv, were a generous gift from Professor Richard D. Palmiter at University of Washington.  /n  Rescue: Consistent with known roles for MMPs in BDNF upregulation, 2.5-week treatment with minocycline, an MMP inhibitor, significantly attenuated BDNF levels as well as megalencephaly and autistic-like behaviors.  /n  Model Summary: To investigate the role of synaptic zinc in the ASD pathogenesis, we examined zinc transporter 3 (ZnT3) null mice. At 4-5 weeks of age, male but not female ZnT3 null mice exhibited autistic-like behaviors. Cortical volume and neurite density were significantly greater in male ZnT3 null mice than in WT mice. In male ZnT3 null mice, consistent with enhanced neurotrophic stimuli, the level of BDNF as well as activity of MMP-9 was increased.	zinc ion transmembrane transporter activity,cation transmembrane transporter activity,metal ion binding	Ani
Pnoc	PNOC	protein-coding	Rattus norvegicus	ENSRNOG00000014231	N23K|Npnc1	25516	Drug Abuse	15p11	Knockout	Wistar-Han	27562376	425	Expeimentalparadigm: Conditioned place preference//Saccharin self-administration  /n  Model Generation: NOP receptor (<U+2212>/<U+2212>) rats were in-licenced from Genoway (Lion, France) and were bred at the University of Camerino. This rat line was originally generated at the Hubrecht Institute (The Netherlands) by target-selected ENU-induced mutagenesis on a Brown Norway background (Homberg<U+00A0>et al, 2009). Heterozygous mutants were then outcrossed onto a Wistar Han to eliminate confounding effects from other mutations that may have been induced by the ENU mutagenesis. Biochemical characterization revealed that the NOP receptor is completely absent in homozygous knock-out rats, and no adaptive change in other opioid receptor levels and distribution has occurred  /n  Rescue: NOP receptor antagonism as a potential treatment option for drug addiction.  /n  Model Summary: Genetic Deletion of the Nociceptin/Orphanin FQ Receptor in the Rat Confers Resilience to the Development of Drug Addiction	opioid peptide activity,opioid receptor binding	Ani
Cdh13	CDH13	protein-coding	Mus musculus	ENSMUSG00000031841	4932416G01Rik|Cdht|Tcad	12554	Attention-Deficit/Hyperactivity Disorder	8 E1|8 65.97 cM	Conditional Knockout	C57BL/6	27579475	426	Expeimentalparadigm: Conditioned place preference//Rotarod//Morris water maze//5-choice serial reaction time task//Anxiety test  /n  Model Generation: Conditional CDH13 knockout mice. CDH13loxP mice were produced as described (20) and bred with UBC-Cre/ERT2 mice (Jackson Laboratory; #008085) to obtain homozygous CDH13loxP/loxP; UBC-Cre/ERT2 ± and CDH13loxP/loxP; UBC-Cre/ERT2 mice.-/-.  /n  Rescue: -  /n  Model Summary: In control and comparison behavioral assessments, knockout mice display modestly-quicker acquisition of rotarod and water maze tasks, with a trend toward faster acquisition of 5 choice serial reaction time tasks that otherwise displayed no genotype-related differences. They display significant differences in locomotion in some settings, with larger effects in males. In assessments of brain changes that might contribute to these behavioral differences, there are selective alterations of dopamine levels, dopamine/metabolite ratios, dopaminergic fiber densities and mRNA encoding the activity dependent transcription factor npas4 in cerebral cortex of knockout mice.	calcium ion binding,protein binding,low-density lipoprotein particle binding,identical protein binding,protein homodimerization activity,cadherin binding,metal ion binding,adiponectin binding,lipoprotein particle binding	Ani
Mdga2	MDGA2	protein-coding	Mus musculus	ENSMUSG00000034912	6720489L24Rik|9330209L04Rik|Adp|Mamdc1|Tg(Prnp-PFN1*G118V)838Kiaei	320772	Autism Spectrum Disorder	12 C2|12 27.63 cM	Targeted	C57BL/6	27608760	427	Expeimentalparadigm: Spontaneous physical activity//Rotarod and fixed bar test//Morris water maze//Fear conditioning test//Social affiliation//Three-chamber test//Novel object recognition test  /n  Model Generation: Mouse genomic DNA including the first  exon of Mdga2 was obtained from a C57BL/6 BAC clone (Invitrogen). The coding sequence in the exon was  replaced by a LacZ-pA-PGK-Neo-pA cassette from DT-A/LacZ/Neo plasmid (http://www2.clst.riken.jp/arg/cassette.html) to construct the targeting vector, which was electroporated into TT2  embryonic stem (ES) cells (Yagi et al., 1993). The successful recombinants were identified by PCR (5’ACCGCTTCCTCGTGCTTTACGGTATC-3’ and 5’CTCAAACTATCTAGATCCAGCATGAGC-3’), and further confirmed by Southern blot analysis. The recombinant ES cells were injected into ICR 8-cell stage embryos to generate chimeric founders, which were crossed to C57BL/6 females to obtain the mice carrying the disrupted allele (http://www2.clst.riken.jp/arg/Methods.html). The resultant mice (Accession No. CDB0740K: http://www2.clst.riken.jp/arg/mutant%20mice%20list.html) were backcrossed to C57BL/6 mice for more than 10 generations. The presence of the wild-type allele, and LacZ-pA-PGK-Neo-pA allele was verified by PCR using the following primer sets: 5’-GTACGGTCTCGTGTGGCT-3’ and 5’-AGACTGCAAGAGCCCATGTTTC-3’ for wild type (363bp); 5’-ACCGCTTCCTCGTGCTTTACGGTATC-3’ and 5’- AGACTGCAAGAGCCCATGTTTC-3’ for LacZ-pA-PGK-Neo-pA (883bp). Mice were housed in environmentally controlled rooms of an animal facility, and handled according to the institute’s guidelines.  /n  Rescue: -  /n  Model Summary: Mutations in a synaptic organizing pathway contribute to autism. Autism-associated mutations in MDGA2 (MAM domain containing glycosylphosphatidylinositol anchor 2) are thought to reduce excitatory/inhibitory transmission. However, we show that mutation of Mdga2 elevates excitatory transmission, and that MDGA2 blocks neuroligin-1 interaction with neurexins and suppresses excitatory synapse development. Mdga2(+/-) mice, modeling autism mutations, demonstrated increased asymmetric synapse density, mEPSC frequency and amplitude, and altered LTP, with no change in measures of inhibitory synapses. Behavioral assays revealed an autism-like phenotype including stereotypy, aberrant social interactions, and impaired memory. In vivo voltage-sensitive dye imaging, facilitating comparison with fMRI studies in autism, revealed widespread increases in cortical spontaneous activity and intracortical functional connectivity.	molecular_function	Ani
Tph2	TPH2	protein-coding	Mus musculus	ENSMUSG00000006764	Ntph	216343	Attention-Deficit/Hyperactivity Disorder	10|10 D2	Conditional Knockout	C57BL/6	27656022	428	Expeimentalparadigm: Open field test//Elevated plus maze// LD box testing//Home cage monitoring//Circadian activity monitoring  /n  Model Generation: Here, we have developed a genetic approach that reproducibly achieves near-complete elimination of 5-HT synthesis from the adult ascending 5-HT system by stereotaxic injection of an adeno-associated virus expressing Cre recombinase (AAV-Cre) into the midbrain/pons of mice carrying a loxP-conditional<U+00A0>tryptophan hydroxylase 2 (Tph2) allele.  /n  Rescue: -  /n  Model Summary: Using this technique, we discovered that adult 5-HT deficiency led to a novel compound phenotype consisting of hyperactivity, disrupted circadian behavior patterns, and elimination of siestas, a period of increased sleep during the active phase.	monooxygenase activity,tryptophan 5-monooxygenase activity,iron ion binding,oxidoreductase activity,oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced pteridine as one donor, and incorporation of one atom of oxygen,metal ion binding	Ani
Tshz3	TSHZ3	protein-coding	Mus musculus	ENSMUSG00000021217	A630038G13Rik|Tsh3|Zfp537|mKIAA1474|teashirt3	243931	Autism Spectrum Disorder	7|7 B2	Targeted	Tshz3lacZ;C57BL/6J	27668656	429	Expeimentalparadigm: Sociability and social novelty preference test//Open field test//Hole board test//Marble burying test//Elevated plus maze//Sensory functions//Visual performance//Auditory performance//Olfactory  /n  Model Generation: Male chimeras, generated after injection of Tshz3lacZ/+ ES cells into C57BL/6J blastocysts, were mated to C57BL/6J females. Offspring (n=249) were assayed for germline transmission of the Tshz3lacZ allele but no transmission was PCR detected. Male chimeras were then mated to CD1 females. F1 Tshz3lacZ/+ animals were intercrossed to obtain Tshz3lacZ/lacZ mutant mice. Alternatively, F1 Tshz3lacZ/+ males were crossed to CD1 females to generate Tshz3lacZ/+, and mutant mice were analysed after six generations on the CD1 background. Genomic DNA was PCR-genotyped.  /n  Rescue: -  /n  Model Summary: TSHZ3, which encodes a zinc-finger transcription factor, was recently positioned as a hub gene in a module of the genes with the highest expression in the developing human neocortex, but its functions remained unknown. Here we identify TSHZ3 as the critical region for a syndrome associated with heterozygous deletions at 19q12-q13.11, which includes autism spectrum disorder (ASD). In Tshz3-null mice, differentially expressed genes include layer-specific markers of cerebral cortical projection neurons (CPNs), and the human orthologs of these genes are strongly associated with ASD. Furthermore, mice heterozygous for Tshz3 show functional changes at synapses established by CPNs and exhibit core ASD-like behavioral abnormalities.	DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,chromatin binding,protein binding,metal ion binding	Ani
Brinp2	BRINP2	protein-coding	Mus musculus	ENSMUSG00000004031	6430517E21Rik|Fam5b|mKIAA1747	240843	Neurodevelopmental Disorders	1|1 H1	Knockout	C57BL/6	27826231	430	Expeimentalparadigm: Visual placing test//Olfaction test//Rotarod//Elevated plus maze//Y-maze//Acoustic startle and prepulse inhibition //Three chamber social interaction test  /n  Model Generation: A targeting vector was constructed to alter the<U+00A0>Brinp2<U+00A0>locus in mouse embryonic stem (ES) cells by homologous recombination following the general strategy outlined in Teoh et al. (2014). Separately, a targeting vector was constructed to alter the<U+00A0>Brinp3<U+00A0>locus in ES cells.  /n  Rescue: -  /n  Model Summary: Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice differ in their behavior:<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>mice are hyperactive, whereas<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice exhibit marked changes in anxiety-response on the elevated plus maze.<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice also show evidence of altered sociability. Both<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice have normal short-term memory, olfactory responses, pre-pulse inhibition, and motor learning.<U+00A0>	molecular_function	Ani
Brinp3	BRINP3	protein-coding	Mus musculus	ENSMUSG00000035131	B830045N13Rik|Fam5c	215378	Neurodevelopmental Disorders	1 F|1 63.24 cM	Knockout	C57BL/6	27826231	431	Expeimentalparadigm: Visual placing test//Olfaction test//Rotarod//Elevated plus maze//Y-maze//Acoustic startle and pre-pulse inhibition //Three chamber social interaction test  /n  Model Generation: The vectors were built using bacterial artificial chromosome (BAC) clones RP23-97A3 and RP23-213F2 as the source of<U+00A0>Brinp2<U+00A0>DNA, and BACs RP23-146N23/RP23-301J4 as the source of<U+00A0>Brinp3<U+00A0>DNA. Both the<U+00A0>Brinp2<U+00A0>and<U+00A0>Brinp3<U+00A0>vectors comprised a neomycin transcriptional unit flanked by flippase (Flp) recognition target (FRT) elements placed in intron 3.  /n  Rescue: -  /n  Model Summary: -	molecular_function	Ani
Brd1	BRD1	protein-coding	Mus musculus	ENSMUSG00000022387	1110059H06Rik|mKIAA4191	223770	Schizophrenia	15|15 E3	Transgene	C57BL/6-Ntac	27837920	432	Expeimentalparadigm: Social interaction//Three-chamber test//Fear conditioning test//Preference for novelty test//Spontaneous alternation//Continuous alternation//Associative memory retrieval//Prepulse inhibition  /n  Model Generation: A mouse line heterozygous for a targeted deletion of the Brd1 gene, Brd1tm1569.2Arte (Brd1+/-) was  generated by TaconicArtemis GmbH (Cologne, Germany) using a targeting vector (pBrd1 Final cl 1 (UP0257)) with loxP sites flanking exon 3-5 of the Brd1 gene. A homologous recombinant clone of C57BL/6NTac embryonic stem (ES) cells (TaconicArtemis GmbH) was obtained by electroporation, counter-selected for by Gancyclovir (2 μM) and verified for correct homologous recombination and single integration by extended Southern blotting analysis. Balb/c blastocysts were microinjected with targeted C57BL/6NTac ES cells and transferred to pseudo-pregnant NMRI females. Chimeras were then bred to female FLPe-deleter mice (strain C57BL/6-Tg(ACTBFlpe)ARTE) (TaconicArtemis GmbH). Germline transmission was apparent by black, strain C57BL/6, coat color (G1). To obtain in vivo CRE-mediated deletion of exon 3-5 of the targeted allele, offspring were bred to CRE-deleter mice (strain C57BL/6-Gt(ROSA)26Sortm16(Cre)ARTE) (TaconicArtemis GmbH). After breeding with CRE-deleter mice the Tg(ACTB-Flpe) and Gt(ROSA)26Sortm16(Cre) loci were subsequently eliminated from the strain by selective breeding and the targeted allele was maintained on a congenic C57BL/6-NTac genetic background by continuous crossing of heterozygous Brd1+/- male mice with C57BL/6-NTac female mice (Taconic, Ejby, Denmark).  /n  Rescue: -  /n  Model Summary: Brd1 mice displayed cerebral histone H3K14 hypoacetylation and a broad range of behavioral changes with translational relevance to schizophrenia. These behaviors were accompanied by striatal dopamine/serotonin abnormalities and cortical excitation-inhibition imbalances involving loss of parvalbumin immunoreactive interneurons. RNA-sequencing analyses of cortical and striatal micropunches from Brd1 and wild-type mice revealed differential expression of genes enriched for schizophrenia risk, including several schizophrenia genome-wide association study risk genes (e.g., calcium channel subunits [Cacna1c and Cacnb2], cholinergic muscarinic receptor 4 [Chrm4)], dopamine receptor D+/-+/-2 [Drd2], and transcription factor 4 [Tcf4]).	histone H3K14 acetyltransferase activity,histone binding,histone H4K5 acetyltransferase activity,histone H4K8 acetyltransferase activity,histone H4K12 acetyltransferase activity,metal ion binding,histone reader activity	Ani
Slc7a5	SLC7A5	protein-coding	Mus musculus	ENSMUSG00000040010	4F2LC|D0H16S474E|Gm42049|LAT1|TA1	20539	Autism Spectrum Disorder	8 E1|8	Conditional Knockout	C57BL/6J	27912058	433	Expeimentalparadigm: Open field test//Three-chamber test//Juvenile social interaction//Walking beam test//Isolation-induced ultrasonic vocalizations in mouse pups//Gait measurement test//Marble burying test//Hind limb clasping test//Kyphosis test  /n  Model Generation: Generation of the Tie2-Cre and Slc7a5 floxed lines has been described previously (Kisanuki et al., 2001; Sinclair et al., 2013). For all experiments we made use of littermates derived from crossing Cre negative Slc7a5fl/fl females with Cre positive Slc7a5fl/+ males. Mice were backcrossed to the N10 generation in C57BL/6J mice. Overall, Tie2Cre;Slc7a5fl/fl transgenic animals were viable and fertile.  /n  Rescue: -  /n  Model Summary: Here, we show that the solute carrier transporter 7a5 (SLC7A5), a large neutral amino acid transporter localized at the blood brain barrier (BBB), has an essential role in maintaining normal levels of brain BCAAs. Here we studied a mouse model in which Slc7a5 was deleted from the BBB and found that Slc7a5 is particularly important to set brain BCAA levels within a normal range. Mice with defective BCAA transport at the BBB show abnormal activation of the amino acid response (AAR) pathway and a corresponding reduction in mRNA translation along with neuronal activity imbalance and behavioral problems.	amino acid transmembrane transporter activity,aromatic amino acid transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,L-amino acid transmembrane transporter activity,L-leucine transmembrane transporter activity,L-tryptophan transmembrane transporter activity,antiporter activity,thyroid hormone transmembrane transporter activity,transmembrane transporter activity	Ani
Spred2	SPRED2	protein-coding	Mus musculus	ENSMUSG00000045671	-	114716	Obsessive Compulsive Disorder	11|11 A3.1	Knockout	129/Ola×C57BL/6	28070119	434	Expeimentalparadigm: Open field test//Elevated plus maze//Light-dark box test  /n  Model Generation: SPRED2 KO mice were generated by a gene trap approach as described previously.34, 35 To generate mice with a disrupted, non-functional Spred2 gene, the embryonic stem cell line XB228 (International Gene Trap Consortium, Davis, CA, USA) was used. It contained the pGT0 gene trap vector, which functionally disrupted the Spred2 gene (Figure 1b).  /n  Rescue: Using the MEK inhibitor selumetinib, we suppressed TrkB/ERK-MAPK pathway activity in vivo and reduced OCD-like grooming in SPRED2 KO mice.  /n  Model Summary: Here we show that OCD-like behavior in mice is caused by deficiency of SPRED2, a protein expressed in various brain regions and a potent inhibitor of Ras/ERK-MAPK signaling. Excessive self-grooming, reflecting OCD-like behavior in rodents, resulted in facial skin lesions in SPRED2 knockout (KO) mice.	stem cell factor receptor binding,protein binding,protein kinase binding,protein serine/threonine kinase inhibitor activity	Ani
Tubb5	TUBB	protein-coding	Mus musculus	ENSMUSG00000001525	B130022C14Rik|M(beta)5	22154	Motor Disorders	17|17 B1	Knockin	C57BL/6J<U+00A0>	28130172	435	Expeimentalparadigm: Open field test//Elevated plus maze//Accelerating rotarod//Startle response and prepulse inhibition<U+00A0>//Multiple static rods//Rotarod//Four limb hanging wire test//Balance beam test//Coat-hanger test  /n  Model Generation: Targeting constructs were generated by modifying a BAC containing the Tubb5 gene (RP24-330C1) with the Red/ET system (Gene Bridges).<U+00A0>These were linearised and electroporated into A9 embryonic stem cells (ESCs) derived from 129/Ola and C57BL/6J hybrids.Positive ESC clones were injected into C57BL/6J blastocysts to generate chimeras.  /n  Rescue: -  /n  Model Summary: These animals do not show any significant impairment in general activity, anxiety, or in the acoustic<U+00A0>startle response, however, present with notable defects in motor coordination.<U+00A0>	nucleotide binding,structural constituent of cytoskeleton,GTP binding,protein domain specific binding,ubiquitin protein ligase binding,GTPase activating protein binding,MHC class I protein binding,protein-containing complex binding,metal ion binding	Ani
Camk2a	CAMK2A	protein-coding	Mus musculus	ENSMUSG00000024617	CaMKII|mKIAA0968	12322	Autism Spectrum Disorder	18 E1|18 34.41 cM	Knockin	C57BL/6J (B6);DBA/2J (D2)	28130356	436	Expeimentalparadigm: Open-field locomotor activity//Three-chambered test//Marble burying test  /n  Model Generation: All mice were on a mixed B6D2 (C57BL/6J (B6) x DBA/2J (D2)) background and were housed (2–5 per cage) on a 12 h light-dark cycle with food and water<U+00A0>ad libitum. Breeding cages (HETXHET) used to generate wild-type (Camk2aWT/WT; E/E), heterozygous (Camk2aWT/E183V; E/V), and homozygous (Camk2aE183V/E183V; V/V) mice for experiments were maintained on a high-fat diet.  /n  Rescue: -  /n  Model Summary: A Novel Human<U+00A0>CAMK2A<U+00A0>Mutation Disrupts Dendritic Morphology and Synaptic Transmission, and Causes ASD-Related Behaviors	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,calmodulin-dependent protein kinase activity,protein binding,calmodulin binding,ATP binding,calcium-dependent protein serine/threonine kinase activity,kinase activity,transferase activity,GTPase activating protein binding,glutamate receptor binding,identical protein binding,protein homodimerization activity,metal ion binding	Ani
Dlg4	DLG4	protein-coding	Mus musculus	ENSMUSG00000020886	Dlgh4|PSD-95|PSD95|SAP90|SAP90A	13385	Autism Spectrum Disorder	11|11 B3	Knockout	C57BL/6J	28189758	437	Expeimentalparadigm: Social interaction in pairs//Resident-intruder test//Ultrasonic vocalization//Homecage activity test//open field test  /n  Model Generation: PSD95+/- and PSD95+/+ as well as PSD93-/-, PSD93+/- and PSD93+/+ littermate mice with C57BL/6J background were used for the experiments of the present study. They were bred as reported previously  /n  Rescue: -  /n  Model Summary: The aberrant social behaviors of both male and female heterozygous PSD95 deficient mice and partially also of homozygous PSD93 knockout mice might be most parsimoniously explained by a deficit in the processing and response to social stimuli leading to lack of social distance. As such, heterozygous PSD95 deficient mice could be used to model some aspects of the social disinhibition phenotype that is observed in a number of neuropsychiatric diseases including various forms of mental retardation.	signaling receptor binding,frizzled binding,structural molecule activity,protein binding,protein C-terminus binding,immunoglobulin binding,kinesin binding,kinase binding,protein kinase binding,protein phosphatase binding,PDZ domain binding,beta-1 adrenergic receptor binding,beta-2 adrenergic receptor binding,D1 dopamine receptor binding,P2Y1 nucleotide receptor binding,acetylcholine receptor binding,glutamate receptor binding,ionotropic glutamate receptor binding,neurexin family protein binding,protein-containing complex binding,neuroligin family protein binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Dlg2	DLG2	protein-coding	Mus musculus	ENSMUSG00000052572	A330103J02Rik|B230218P12Rik|B330007M19Rik|Dlgh2|Gm1197|Gm21505|PSD93	23859	Autism Spectrum Disorder	7 E1|7 51.07 cM	Knockout	C57BL/6J	28189758	438	Expeimentalparadigm: Social interaction in pairs//Resident-intruder test//Ultrasonic vocalization//Homecage activity test//open field test  /n  Model Generation: PSD95+/- and PSD95+/+ as well as PSD93-/-, PSD93+/- and PSD93+/+ littermate mice with C57BL/6J background were used for the experiments of the present study. They were bred as reported previously  /n  Rescue: -  /n  Model Summary: The aberrant social behaviors of both male and female heterozygous PSD95 deficient mice and partially also of homozygous PSD93 knockout mice might be most parsimoniously explained by a deficit in the processing and response to social stimuli leading to lack of social distance. As such, heterozygous PSD96 deficient mice could be used to model some aspects of the social disinhibition phenotype that is observed in a number of neuropsychiatric diseases including various forms of mental retardation.	protein binding,protein C-terminus binding,kinase binding,protein phosphatase binding,PDZ domain binding,protein-containing complex binding,structural constituent of postsynaptic density	Ani
Shroom4	SHROOM4	protein-coding	Rattus norvegicus	ENSRNOG00000002959	RGD1563434	317391	Cognitive Disorders	Xq12	Knockdown	Wistar	28262662	439	Expeimentalparadigm: Spontaneous motor activity test//Elevated plus maze//Marble burying test//Sociability and social novelty test//Tube test  /n  Model Generation: The human<U+00A0>KIAA1202<U+00A0>open reading frame 1 was subcloned into: pcDNA4/V5-HisB (Invitrogen) to obtain Shrm4-V5; pEGFP-C1 (Clontech) to obtain GFP-Shrm4; and pTL1-HA3 to obtain HA-Shrm4 (gift from Vera Kalscheuer). Flag-tagged GABAB2, myc-tagged full-length GABAB1a, GABAB1a-Δ859–961, GABAB1a-Δ922–961 and GABAB1a-Δ870–961 were cloned into the pRK5 plasmid for expression in HEK293 cells to identify the minimal GABAB1<U+00A0>sequence that interacts with Shrm4  /n  Rescue: -  /n  Model Summary: Our data highlights a role for Shrm4 in synaptogenesis and in maintaining GABABR-mediated inhibition, perturbation of which may be responsible for the involvement of Shrm4 in cognitive disorders and epilepsy.	molecular_function,myosin II binding,actin filament binding	Ani
Cic	CIC	protein-coding	Mus musculus	ENSMUSG00000005442	1200010B10Rik|mKIAA0306	71722	Neurodevelopmental Disorders	7|7 A3	Conditional Knockout	FVB;C57BL/6	28288114	440	Expeimentalparadigm: Open field test//Elevated plus maze//Fear conditioning//Three-chamber test//Partition test//Resident-intruder test  /n  Model Generation: Generation of<U+00A0>Cicflox<U+00A0>and<U+00A0>Cicnull<U+00A0>alleles were carried out as follow. ES cells with<U+00A0>Cictm1a(KOMP)Wtsi<U+00A0>allele were obtained from EUCOMM and were injected into C57BL/6 blastocysts. The<U+00A0>Cicflox<U+00A0>mice were then generated by breeding to<U+00A0>Actin-FLP<U+00A0>mice to remove the genetrap cassette, and the<U+00A0>Cicnull<U+00A0>allele was generated by crossing to<U+00A0>CMV-Cre<U+00A0>mice  /n  Rescue: -  /n  Model Summary: Informed by these neurobehavioral features in mouse mutants, we identified five patients with<U+00A0>de novo<U+00A0>heterozygous truncating mutations in<U+00A0>CIC<U+00A0>that share similar clinical features, including intellectual disability, attention deficit/hyperactivity disorder (ADHD), and autism spectrum disorder.<U+00A0>	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,chromatin binding,protein binding	Ani
Ube3a	UBE3A	protein-coding	Mus musculus	ENSMUSG00000025326	4732496B02|5830462N02Rik|A130086L21Rik|Hpve6a	22215	Autism Spectrum Disorder	7 B5|7 33.95 cM	Overexpression	FVB/NJ	28297715	441	Expeimentalparadigm: Three chamber test//Ultrasonic vocalizations//Grooming//Open field test//Elevated plus maze//Buried food test//Rotarod  /n  Model Generation: Ube3a transgenic mice were generated using bacterial artificial chromosome (BAC) recombineering techniques as described previously4,43,44. For Ube3aNLS mice, three FLAG tags were added to the C-terminal end of this construct followed by two in-frame nuclear localization signals from the SV40 large antigen, followed by two stop codons.Ube3amKO mice5 (Jackson Labs) were backcrossed 9 generations to FVB/NJ before behavioral testing. Both p-Ube3amKO and m-Ube3amKO mice were generated based on the breeding scheme described in Fig. 1b. <U+00A0>  /n  Rescue: We provide preclinical evidence that viral-vector-based chemogenetic activations of, or<U+00A0>Cbln1<U+00A0>restorations in VTA glutamatergic neurons rescues sociability deficits induced by<U+00A0>Ube3a<U+00A0>and/or seizures.<U+00A0>  /n  Model Summary: Here, using<U+00A0>in vivo<U+00A0>mouse genetics, we show that increasing UBE3A in the nucleus down-regulates glutamatergic synapse organizer cerebellin-1 (Cbln1) that is needed for sociability in mice. Epileptic seizures also repress<U+00A0>Cbln1<U+00A0>and are found to expose sociability impairments in mice with asymptomatic increases of UBE3A.	transcription coactivator activity,ubiquitin-protein transferase activity,protein binding,transferase activity,metal ion binding,ubiquitin protein ligase activity	Ani
slgA	PRODH	protein-coding	Drosophila melanogaster		CG1417|Dmel\CG1417|EE85|PRODH|sl|slg|tu3	33117	Aggressive Behaviors	19F6-20A1|1-65 cM	Overexpression	Canton-S	28331058	442	Expeimentalparadigm: Locomotion test//Starvation resistance//Sleep and circadian rhythmicity  /n  Model Generation: PRODH1 cDNA (Image clone 40108133) was obtained from Source BioScience (Cambridge, UK). Drosophila slgA isoform A cDNA (LD10578) was obtained from the Drosophila Genomics Resource Center (Bloomington, IN, USA). The Kozak sequence for PRODH was generated with the following primers: F, CGTGCGGCCGCCAACATGAAGATGACCTTCTATGGGC; R, GAAGGCCCGGTGGGCCTGGTATTG. This region was directionally cloned into the PRODH cDNA using NotI and BglI. The Kozak sequence for the A, B, D and E isoforms was generated with the following primers: F, CGTGAATTCCAACATGGCTCTACTCCG; R, ATAAGGCCTGCAGCGGCCGGTCGCCG. This region was cloned into slgA isoform A cDNA (LD10578) using EcoRI and StuI. The region specific for the B and D isoforms (CTGGCGCGCAACCTGCTCGGCCAGAAGCTCTTCGTCCTGCTGATGAAGTCCAGCTTCTACGGACACTTTGTGGCCGGCGAGAATCGTCACACGATCGTGCCCGCC) was generated using the following primers: F1, ATTAG GCCTCCACTCTGGTCCAAC; R1, AGTGTCCGTAGAAGCTGGACTTCATCAGCAGGACGAAGAGCTTCTGGCCGAGCAGGTTGCGCGCCAGTTTCATAAGCGTCATGTTGT; F2, TGCTGATGAAGTCCAGCTTCTACGGACACTTTGTGGCCGGCGAGAATCGTCACACGATCGTGCCCGCCCTGGAAAGGCTAAGATCCTT; R2, GCATGCTGCCCTCCTCCTTTTTG. The region specific for the B and D isoforms was cloned into slgA isoform A cDNA using StuI and SphI. The region specific for the C, D and E isoforms (GATGATGATCGCAAGGCGCCCCGGGCAGTGGCCACG) was generated using the following primers: F1, ATCGCATGCCGCAGTACCATGTG; R1, CACTGCCCGGGGCGCCTTGCGATCAT CATCCGAAACAGCCTCCAGACACT; F2, GATCGCAAGGCGCCCCGGGCAGTGGCCACGGGCGCCACCTTTGGAACTGG; R2, GACGTCCTTATTGTCGCCCAG. The region specific for the C, D and E isoforms was cloned into slgA isoform A cDNA using SphI and AatII. Isoform C, including the Kozak sequence was generated using the following primers: F, TGGGAATTCCAACATGCGCACACGCAAGTACATGG; R, ATTGCGGCCGCTTAGATGGGCACGTAATTGCC. All slgA isoforms were cloned from pCR<U+2122>-Blunt II-TOPO (Life Technologies, Ghent, Belgium) to pUAST using EcoRI and NotI. PRODH was cloned from pCR<U+2122>-Blunt II-TOPO (Life Technologies, Ghent, Belgium) to pUASt using NotI and BamHI. Injections to generate transgenic flies were carried out as a service by Model Systems Genomics, Duke University, Durham, NC, USA.<U+00AE><U+00AE>  /n  Rescue: -  /n  Model Summary: PRODH has been associated with different psychiatric disorders that are characterized by alterations in social behavior (Jacquet et al., 2002; Li et al., 2004; Liu et al., 2002). In the current study, we show that the Drosophila PRODH homolog slgA is broadly expressed in the adult brain and that altering PRODH in LNv results in abnormal behavior, namely increased aggression. Downregulation of endogenous slgA and overexpression of distinct isoforms of slgA both lead to hyperaggressive behavior. These results suggest that proline metabolism needs to be precisely regulated to drive normal behavior. We also show that the human PRODH exerts a comparable aggression-promoting effect in Drosophila, hence indicating that the mechanisms by which slgA regulates aggression depend on evolutionarily conserved functions of the protein. These results identify Drosophila aggression as a model behavior for studying mechanisms relevant for neuropsychiatric disorders.	proline dehydrogenase activity,FAD binding	Ani
disc1	DISC1	protein-coding	Zebrafish	ENSDARG00000021895	-	407621	Neurodevelopmental Disorders	-	Mutated	NA	28334933	443	Expeimentalparadigm: Locomotion test  /n  Model Generation: Both lines of disc1 mutant zebrafish were identified in an ENU mutagenesis-based screening programme and have been reported elsewhere (43). We obtained them as an F3 outcross from Dr Cecilia Moens (Fred Hutchison Cancer Research Center, Seattle, WA) and all fish used in this study were outcrossed with the TL strain to F7/F8 generations prior to in-crossing. We refer to the disc1fh291 allele as L115X and the disc1fh292 allele as Y472X throughout. Larvae were obtained from in-crosses of disc1 wild type and in-crosses of disc1 homozygous mutant adult siblings.  /n  Rescue: -  /n  Model Summary: Our studies reveal that in the embryo, disc1 is expressed in neural progenitor cells of the hypothalamus, a conserved region of the vertebrate brain that centrally controls responses to environmental stressors. In disc1 mutant embryos, proliferating rx3+ hypothalamic progenitors are not maintained normally and neuronal differentiation is compromised: rx3-derived ff1b+ neurons, implicated in anxiety-related behaviours, and corticotrophin releasing hormone (crh) neurons, key regulators of the stress axis, develop abnormally, and rx3-derived pomc+ neurons are disorganised. Abnormal hypothalamic development is associated with dysfunctional behavioural and neuroendocrine stress responses. In contrast to wild type siblings, disc1 mutant larvae show altered crh levels, fail to upregulate cortisol levels when under stress and do not modulate shoal cohesion, indicative of abnormal social behaviour. These data indicate that disc1 is essential for normal development of the hypothalamus and for the correct functioning of the HPA/HPI axis.	NA	Ani
mecp2	MECP2	protein-coding	Zebrafish	ENSDARG00000014218	wu:fk96a04|zgc:111857	335250	Neurodevelopmental Disorders	-	Knockdown(MO)	NA	28371371	444	Expeimentalparadigm: Touch response test  /n  Model Generation: Antisense morpholino oligonucleotides (AMOs; Gene Tools, LLC) were designed as described below. Mecp2 AMO targets the first initiation codon of mecp2 mRNA: mecp2 AMO 5′-TCCGCTCTCTGCGGCGGCCATTTTT-3′ (the translation initiation codon is underlined); mecp2 splicing-block AMO targets the intron1/exon2 boundary of mecp2 mRNA: mecp2 splicing-block AMO 5′-ACTTCCTGTAACTTGTACTAACTTG-3′; mecp2 5mis AMO 5′-TCgGCTCTCTcCGaCGGCgATTaTT-3′. 5-base-pair-mismatched AMO was used to perform a control experiment. bdnf AMO 5′-CCAGTCGTAAAGGAGACCATTCAGC-3′. For rescue experiment of mecp2 morphants, we synthesized the human MECP2 mRNA and the human ⊿ MBD MECP2 mRNA using mMessage mMachine kit (Ambion, Austin, TX) by using these expression vectors (Miyake et al., 2011). Approximately 1 nL of AMOs (0.5 μg/μL mecp2 AMO) were injected into 1-to-2-cell-stage embryos (Nasevicius and Ekker, 2000). For rescue experiments, 200 ng of mRNAs were coinjected with Mecp2 AMO. 35 ng/μL BDNF mRNA was injected for overexpression. For double knockdown experiment, 0.8 μg/μL bdnf AMO was coinjected with 0.5 μg/μL mecp2 AMO.  /n  Rescue: -  /n  Model Summary: In this study, we investigated the function of Mecp2 in neuronal development using zebrafish embryos. Mecp2 expression was detected ubiquitously in the central nervous system and muscles at 28 h postfertilization (hpf). We injected an antisense morpholino oligonucleotide (AMO) to induce Mecp2 knockdown phenotype. In mecp2 morphants (embryos with Mecp2 knockdown by AMO) at 28 and 72 hpf, we found an increase in abnormal axonal branches of caudal primary motor neurons and a decrease in motor activity. In mecp2 morphants at 24 hpf, we observed an increase in the expression of an mecp2 downstream candidate gene, brain derived neurotrophic factor (bdnf). In mecp2 morphants at 72 hpf, the presynaptic area stained by an anti-SV2 antibody was increased at the neuromuscular junction (NMJ).	DNA binding,chromatin binding,DNA-binding transcription factor activity,methyl-CpG binding,double-stranded methylated DNA binding	Ani
Ptchd1	PTCHD1	protein-coding	Mus musculus	ENSMUSG00000041552	9630036J22Rik|Gm387	211612	Cognitive Disorders	X|X F3	Knockout	C57BL/6N	28416808	445	Expeimentalparadigm: Rotarod//Grip strength test//Hot plate test//Circadian activity and ingestive behaviours//Open field test//Elevated plus maze//Social recognition test//Auditory startle reflex reactivity and pre-pulse inhibition//Object recognition task//Y-maze//Pavlovian fear conditioning  /n  Model Generation: The targeting vector PRPGS00100_C_H03 was purchased from KOMP (www.komp.org) and amplified at the ICS. This vector contains a flipped STOP cassette that comprises an Engrailed 2 (En2) splice acceptor follow by an IRES sequence and a LacZ cDNA as well as a floxed human b-actin promoter driven Neo resistance cassette. The critical Ptchd1 exon 2 is flanked by loxP site (Fig. 2a). The linearized construct was electroporated in C57BL/6N mouse embryonic stem (ES) cells.Resulting male  chimeras  were  bred  with  wild  type  C57BL/6N  females  in order to obtain germline transmission of the tm1a allele. The complete deletion in the Tm1b allele, 
keeping the lacZ reporter with a polyA inserted was recovered by breeding F1 Tm1a/y males with a Cre delete line1.  /n  Rescue: -  /n  Model Summary: We find that<U+00A0>Ptchd1<U+00A0>deficiency in male mice (Ptchd1<U+2212>/y) induces global changes in synaptic gene expression, affects the expression of the immediate-early expression genes<U+00A0>Egr1<U+00A0>and<U+00A0>Npas4<U+00A0>and finally impairs excitatory synaptic structure and neuronal excitatory activity in the hippocampus, leading to cognitive dysfunction, motor disabilities and hyperactivity.<U+00A0>	protein binding	Ani
micall2a	MICALL2	protein-coding	Zebrafish	ENSDARG00000102366	fd16d06|micall2|wu:fd16d06|wu:fd16d07|zgc:55358	327198	Attention-Deficit/Hyperactivity Disorder	-	Knockdown	Tübingen	28416812	446	Expeimentalparadigm: Swimming distance test  /n  Model Generation: The wild-type Tübingen strain zebrafishes used in this study were provided by the College of Life Science at the Peking University. The animal experiments were approved by the Institutional Animal Care and Use Committee of Peking University (LSC-LiuD-01). A Micall2b splice-blocking morpholino oligonucleotide (MO) was designed to bind exon 2/intron 2 to inhibit Micall2b splicing after transcription (Figure 3a). Another MO with 5<U+2009>bp mismatches was used as a control (hereafter called MIS).  /n  Rescue: Hyperactive-impulsive-like behavior was induced by reducing the expression of the zebrafish gene that is homologous to MICALL2, which could be rescued by tomoxetine (atomoxetine), a clinical medication for ADHD.  /n  Model Summary: Further behavioral testing showed that micall2b morphants displayed a marked increase in total swimming distance over 15<U+2009>min and a higher mean swimming speed.	metal ion binding	Ani
Slc1a1	SLC1A1	protein-coding	Mus musculus	ENSMUSG00000024935	D130048G10Rik|EAAC1|EAAC2|EAAT3|MEAAC1	20510	Obsessive Compulsive Disorder	19|19 C1	Targeted	129S6/SvEvTac	28507136	447	Expeimentalparadigm: Spontaneous locomotor activity//Elevated zero maze//Light–dark box test//Startle response and prepulse inhibition//Home cage scan//Grooming  /n  Model Generation: We constructed a pNeoSTOP-tetO plasmid using BAC recombineering (40). Our targeting vector has a 10-kb 5′-homology arm, the NeoSTOPtetO cassette, a 1.7-kb 3′-homology arm, and a diphtheria toxin A subunit. We inserted the STOP-tetO cassette just upstream of the Slc1a1 translation initiation site (Fig. 1A). Multicloning site 1 (MCS1) (PacI/NotI/ BamHI), loxP, FRT, PGK-EM7-Neo-HSV thymidine kinase poly(A) minigene, STOP sequence, FRT, tetO sequence, loxP, and MCS2 (EcoRV/EcoRI/PacI/SalI) were connected in tandem. DNA fragments (400 bp) upstream and downstream of the translation initiation site were amplified with PCR primers containing appropriate restriction enzyme sites and were respectively inserted into each MCS of the pNeoSTOP-tetO plasmid. To perform BAC recombination, the linearized NeoSTOP-tetO cassette with 400-bp homology arms was transferred into bacteria carrying the pBADTcTypeG plasmid and the BAC encompassing the Slc1a1 coding frame; BAC genomic clones containing Slc1a1 promoter and regulatory regions were obtained from BacPac (RP23-475B5). The targeting vector was isolated from the recombined, kanamycin-resistant clone using a retrieving technique and was inserted into the pMCS-DTA plasmid. Eight colonies were found to be kanamycin resistant, and two of the eight were found to contain the NeoSTOP-tetO cassette via colony direct PCR. Expected band sizes based on primer positions and on the location of the NeoSTOP-tetO sequence were seen: 685 bp (5′ arm) and 644 bp (3′ arm). The targeting vector was electroporated into a 129/SvEvTac mouse ES cell line in the Duke Embryonic Stem Cell Core. Homologous recombinants were detected using PCR for the 3′ arm of the targeting vector using a primer complementary to the 3′ homology arm and an external primer complementary to the genomic sequence located 3′ of the 3′ homology arm of the targeting vector. A subset of positive clones was tested by PCR for homologous targeting of the 5′ arm. Transgene incorporation was verified using Southern blot with probe position from -11,256 to -10,717 bases upstream of the translation initiation site, outside the homology arm, which generated the predicted band sizes of 15 kb (WT) and 18 kb (Slc1a1-STOP-tetO). Positive ES clones were injected into C57BL/6J blastocysts to obtain chimeric mice, which were crossed to 129S6/SvEvTac females to obtain germline transmission. Germline-transmitted offspring were then established as Slc1a1 STOP-tetO heterozygous knockins on a pure 129S6/SvEvTac background.  /n  Rescue: -  /n  Model Summary: Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in (i) locomotor activity, (ii) stereotypy, and (iii) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1-STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D1 receptor binding in the dorsal striatum of Slc1a1-STOP mice. Slc1a1-STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1/EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1-STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function.	anion channel activity,L-glutamate transmembrane transporter activity,high-affinity L-glutamate transmembrane transporter activity,protein binding,chloride transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,L-aspartate transmembrane transporter activity,symporter activity,glutamate:sodium symporter activity,glutamate binding,cysteine transmembrane transporter activity,identical protein binding,metal ion binding,D-aspartate transmembrane transporter activity	Ani
MECP2	MECP2	protein-coding	Macaca fascicularis	ENSMMUG00000018704	-	700174	Autism Spectrum Disorder	-	Gene Editing(TALEN)	Macaca fascicularis	28525759	448	Expeimentalparadigm: Sleep pattern//Pain threshold test//Active avoidance test//Activity levels assessment//Eye-tracking  /n  Model Generation: The monkey MECP2 gene contains 4 exons, similar to that of humans and mice (Figure 1A), with the methyl-CpG binding domain (MBD) encoded by both exon 3 and exon 4 (Nan et al., 1998). We decided to target exon 3 with three pairs of TALEN constructs (Figure 1A) because exon 3 is the 5’ most common exon for the A and B form MECP2 transcripts, and our aim was to disrupt the gene. These sites are conserved in humans, so we initially used a luciferase reporter assay in 293T cells to evaluate the efficacy of our TALEN-mediated mutagenesis approach (Figure S1A-C). In addition, when these TALEN pairs were transfected individually into Macaca fascicularis mesenchymal stem cells (MSCs) as well as human MSCs, MECP2 mutagenesis occurred (Figure S1D-E). After that, we generated another six live monkeys (four female mutants and two non-affected wild-type [WT] males) and five spontaneously aborted fetuses (two male mutants, two female mutants, one non-affected WT female). The fact that all male mutant monkeys were embryonic lethal recapitulated the human disease (Chen et al., 2001; Guy et al., 2001) but different from Mecp2 knockout mice. In this study, we gathered all available animals, i.e., five female mutants and five spontaneously aborted male fetuses from 41 surrogate recipients, and carried out the following studies (Figures 1A and 1B; Table S1).  /n  Rescue: -  /n  Model Summary: Gene-editing technologies have made it feasible to create nonhuman primate models for human genetic disorders. Here, we report detailed genotypes and phenotypes of TALEN-edited MECP2 mutant cynomolgus monkeys serving as a model for a neurodevelopmental disorder, Rett syndrome (RTT), which is caused by loss-of-function mutations in the human MECP2 gene. Male mutant monkeys were embryonic lethal, reiterating that RTT is a disease of females. Through a battery of behavioral analyses, including primate-unique eye-tracking tests, in combination with brain imaging via MRI, we found a series of physiological, behavioral, and structural abnormalities resembling clinical manifestations of RTT. Moreover, blood transcriptome profiling revealed that mutant monkeys resembled RTT patients in immune gene dysregulation. Taken together, the stark similarity in phenotype and/or endophenotype between monkeys and patients suggested that gene-edited RTT founder monkeys would be of value for disease mechanistic studies as well as development of potential therapeutic interventions for RTT.	NA	Ani
Lrfn2	LRFN2	protein-coding	Mus musculus	ENSMUSG00000040490	5730420O05Rik|SALM1|mKIAA1246	70530	Autism Spectrum Disorder	17|17 C	Conditional Knockout	C57BL/6J	28604739	449	Expeimentalparadigm: Classical fear conditioning//Morris water maze//Open field test//Home cage activity measurement//Light-dark box test//Wheel-running activity//Reciprocal social interaction test//Three-chamber test//Ultrasonic vocalization analysis//Marble burying test//Acoustic startle response and prepulse inhibition test//Rotarod//Elevated plus maze//Hidden-cookie test  /n  Model Generation: A BAC clone containing Lrfn2 was purchased from BACPAC resources of the Children's Hospital Oakland Research Institute. An Lrfn2 targeting vector was constructed to replace exon 2, which contains the ATG translation initiation codon, with a neomycin resistance gene cassette flanked by a loxP sequence (Neo). Homologous genomic DNA with the Neo cassette was joined with a diphtheria toxin—a cassette for negative selection. Linearized targeting vectors were electroporated into E14 ES cells, and homologous recombinants were isolated by G418 selection. The ES clones were screened by Southern blot analysis. Correctly targeted ES clones were injected into blastocysts of C57BL/6J mice, which were then used to produce chimeric mice. After confirmation of germline transmission, the Neo cassette was removed by crossing mice that had germline transmission with transgenic mice expressing Cre recombinase in germ cells64. The Cre recombination was confirmed by PCR and Southern blot analyses. Lrfn2-heterozygous (Lrfn2+/-) mice were backcrossed into the C57BL/6J inbred background for at least six generations before the behavioural experiments were started. Mutant animals were genotyped by PCR using DNA and the following primers: forward primer F1 for WT and KO allele (5′-CACATGGTGCGTGCAATTTAGG-3′); Reverse primers R1 for WT allele (5′-GGCAATTGCCCTTATCAAGAGC-3′) and R2 for KO allele (5′-TTGAGTAAGAGCAAGAACCCAGC-3′).  /n  Rescue: -  /n  Model Summary: Lrfn2/SALM1 is a PSD-95-interacting synapse adhesion molecule, and human LRFN2 is associated with learning disabilities. However its role in higher brain function and underlying mechanisms remain unknown. Here, we show that Lrfn2 knockout mice exhibit autism-like behavioural abnormalities, including social withdrawal, decreased vocal communications, increased stereotyped activities and prepulse inhibition deficits, together with enhanced learning and memory.	protein binding	Ani
Chd5	CHD5	protein-coding	Mus musculus	ENSMUSG00000005045	4930532L22Rik|B230399N07Rik|CHD-5	269610	Autism Spectrum Disorder	4|4 E2	Conditional Knockout	C57BL/6 J	28608855	450	Expeimentalparadigm: Open field // novel object recognition//ultrasonic vocalization (USV) task//Three-chamber social approach//Social fear behaviors//  /n  Model Generation: Chd5<U+2212>/<U+2212><U+00A0>mice were generated using conditional (Chd5fl/+) embryonic stem cells (C57BL/6<U+2009>J) obtained from the EUCOMM consortium.Mice harboring a conditional deletion of exon two of the Chd5 gene were first crossed with FlpE transgenic mice to remove the targeting/selection construct (Figure 1a). Conditional (Chd5fl/+) mice were then crossed with nestin-Cre transgenic mice, allowing for restricted Cre-recombinase activity and Chd5 allele deletion within neural tissue.  /n  Rescue: -  /n  Model Summary: Paralleling ASD nosology, Chd5<U+2212>/<U+2212><U+00A0>mice exhibited abnormal sociocommunicative behavior and a strong preference for familiarity. Chd5<U+2212>/<U+2212><U+00A0>mice further showed deficits in responding to the distress of a conspecific, a mouse homolog of empathy. Thus, dysregulated chromatin remodeling produces a pattern of transcriptional, neuronal and behavioral effects consistent with the presentation of ASDs.	nucleotide binding,DNA binding,DNA helicase activity,chromatin binding,helicase activity,protein binding,ATP binding,hydrolase activity,ATP hydrolysis activity,histone binding,histone deacetylase binding,metal ion binding,H3K27me3 modified histone binding,ATP-dependent chromatin remodeler activity	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Autism Spectrum Disorder	15|15 E3	Knockout	C57BL/6J	28638591	451	Expeimentalparadigm: Juvenile reciprocal social interactions//Elevated plus maze//Light-dark box test//Open field test//Novel object recognition test//Acoustic startle threshold and prepulse inhibition test//Repetitive self-grooming//Marble burying test//Three-chamber test//Olfactory//Hot plate test//Male-female social interaction test//Fear conditioning test//Morris water maze  /n  Model Generation: Heterozygous breeding pairs of<U+00A0>Shank3B<U+00A0>mice (Shank3tm2Gfng, catalogue #017688) were obtained from The Jackson Laboratory (JAX) Repository, Bar Harbor, Maine, USA. This line, in which the<U+00A0>Shank3<U+00A0>mutation is at the PDZ site, was originally generated by Guoping Feng and colleagues at Duke University [16], and is maintained at JAX on a C57BL/6J background. Breeding colonies were independently developed at Boston Children’s Hospital, Boston, Massachusetts and the University of California Davis MIND Institute in Sacramento, California.<U+00A0>  /n  Rescue: -  /n  Model Summary: Relative to WT mice,<U+00A0>Shank3B<U+00A0>KO mice displayed a dramatic resistance to PTZ seizure induction and an enhancement of gamma band oscillatory EEG activity indicative of enhanced inhibitory tone. These findings replicated in two separate cohorts. Behaviorally,<U+00A0>Shank3B KO<U+00A0>mice exhibited repetitive grooming, deficits in aspects of reciprocal social interactions and vocalizations, and reduced open field activity, as well as variable deficits in sensory responses, anxiety-related behaviors, learning and memory.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Meis1	MEIS1	protein-coding	Mus musculus	ENSMUSG00000020160	C530044H18Rik|Evi8	17268	Restless Legs Syndrome	11 A3.1|11 11.11 cM	Knockout	C57BL/6JOlaHsd	28645892	452	Expeimentalparadigm: Open field test//Startle response and prepulse inhibition//Hotplate test//Social discrimination test//Rotarod//Locomotor activity//Voluntary wheel running  /n  Model Generation: The<U+00A0>Meis1tm1Mtor<U+00A0>mice used in the experiments were created in Madrid, Spain (Azcoitia et al., 2005) and have been bred on the C57BL/6JOlaHsd (Envigo, Horst, The Netherlands) background. In this strain,<U+00A0>Meis1<U+00A0>has been inactivated by knocking in a modified ERT2 domain. The result is predicted to encode an inactive protein product. The mouse line has been bred in Munich, Germany, backcrossing to wild-type C57BL/6JOlaHsd every generation.<U+00A0>  /n  Rescue: -  /n  Model Summary: In conclusion, the<U+00A0>Meis1-deficient mice fulfill some of the hallmarks of an RLS animal model, and revealed the role of Meis1 in sensorimotor gating and in the dopaminergic systems modulating it.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,chromatin binding,protein binding,sequence-specific DNA binding	Ani
Chd8	CHD8	protein-coding	Mus musculus	ENSMUSG00000053754	5830451P18Rik|Chd-8|Duplin|HELSNF1|mKIAA1564	67772	Cognitive Disorders	14|14 C2	Mutated	C56BL/6N	28671691	453	Expeimentalparadigm: Open field test//General health//Self-grooming//Marble burying//Three-chamber test//Male-female social interactions//Novel object recognition test//Fear conditioning test  /n  Model Generation: We used Cas9-mediated mutagenesis of C56BL/6N oocytes to generate two mouse lines harboring frameshift deletions (5-bp and 14-bp) in mouse<U+00A0>Chd8<U+00A0>exon 5. Guide RNA was designed and synthesized according to described methods39, and pooled with Cas9 mRNA and injected into mouse oocytes. We scanned the<U+00A0>Chd8<U+00A0>coding sequence for unique gRNA target sites, identifying one in exon 5 with sequence GAGGAGGAGGTCGATGTAAC.<U+00A0>  /n  Rescue: -  /n  Model Summary: Chd8+/del5<U+00A0>mice displayed normal social interactions with no repetitive behaviors but exhibited cognitive impairment correlated with increased regional brain volume, validating that phenotypes of<U+00A0>Chd8+/del5<U+00A0>mice overlap pathology reported in humans with<U+00A0>CHD8<U+00A0>mutations.<U+00A0>we validated increased neuronal proliferation and developmental splicing perturbation in Chd8+/del5 mice.	nucleotide binding,p53 binding,DNA binding,chromatin binding,helicase activity,protein binding,ATP binding,beta-catenin binding,hydrolase activity,ATP hydrolysis activity,methylated histone binding,histone binding,armadillo repeat domain binding,ATP-dependent chromatin remodeler activity	Ani
Meis1	MEIS1	protein-coding	Mus musculus	ENSMUSG00000020160	C530044H18Rik|Evi8	17268	Insomnia Disorder	11 A3.1|11 11.11 cM	Knockout	C57BL/6JOlaHsd<U+00A0>	28695622	454	Expeimentalparadigm: EEG//EMG  /n  Model Generation: The original Meis1tm1Mtor<U+00A0>mice used in the experiments were generated in Dr Torres's laboratory in Madrid, Spain (Azcoitia<U+00A0>et<U+00A0>al.,<U+00A0>2005) on a C57BL/6JOlaHsd background. The mouse line harbours an in-frame insertion of the ERT2 domain within the coding region of<U+00A0>Meis1, resulting in a non-functional Meis1 protein in the absence of tamoxifen. We obtained these mice to breed heterozygous mice and their wild-type littermates in Helmholtz Zentrum München, Munich, Germany, housed under a standard 12-h light–dark cycle in a pathogen-free environment. The transgenic line was maintained by back-crossing it to wild-type C57BL/6JOlaHsd every generation for 9–10 generations  /n  Rescue: -  /n  Model Summary: In conclusion, our data demonstrate that Meis1 haploinsufficiency has no direct major effect on sleep architecture, but may have an effect on qualitative sleep in mice. This suggests that Meis1 does not play an imperative role in RLS-related hyperarousal or sleep fragmentation.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,chromatin binding,protein binding,sequence-specific DNA binding	Ani
Arid1b	ARID1B	protein-coding	Mus musculus	ENSMUSG00000069729	8030481M12|9330189K18Rik|Ardi1b|B230217J03Rik|BAF250B|mKIAA1235	239985	Neurodevelopmental Disorders	17|17 A1	Conditional Knockout	C57BL/6J	28695822	455	Expeimentalparadigm: Grip strength test//Ultrasonic vocalization recordings//Juvenile social interaction test//Grooming//Marble burying test//Locomotor activity//Open field test//Elevated plus maze//Light-dark box test//Morris water maze//Fear conditioning test//Footshock sensitivity  /n  Model Generation: Constitutive and conditional<U+00A0>Arid1b<U+00A0>knockout mice were generated by the UTSW Transgenic Core using CRISPR/Cas9 genome editing. Guide RNAs were designed to target sequences before and after exon 5 of<U+00A0>Arid1b, creating a frame-shift mutation to induce nonsense-mediated decay. Guide RNAs, S. pyogenes<U+00A0>Cas9<U+00A0>mRNA, and oligo donors containing LoxP sequences were injected into single celled zygotes. C57BL/6J mice were used to generate these mice. To generate WT and<U+00A0>Arid1b+/-<U+00A0>study mice, C57BL/6J WT females were crossed to<U+00A0>Arid1b+/-<U+00A0>males  /n  Rescue: -  /n  Model Summary: We generated<U+00A0>Arid1b<U+00A0>heterozygous mice, which showed social behavior impairment, altered vocalization, anxiety-like behavior, neuroanatomical abnormalities, and growth impairment.<U+00A0>	DNA binding,protein binding,nucleosome binding	Ani
scn1lab	SCN2A	protein-coding	Zebrafish	ENSDARG00000062744	-	559447	Neurodevelopmental Disorders	-	Mutated	Tg(1.4dlx5a-dlx6a:GFP);scn1labs552 line;TL	28812061	456	Expeimentalparadigm: Diurnal activity//Open field test  /n  Model Generation: The Tg(1.4dlx5a-dlx6a:GFP) fish line has been previously described (Ghanem et al., 2003) and was generously provided by the laboratory of Dr. Marc Ekker. The scn1labs552 line has been previously described (Schoonheim et al., 2010) and was generously provided by the laboratory of Dr. Herwig Baier. Zebrafish of the TL strain were obtained from the Zebrafish International Resource Center (ZIRC).  /n  Rescue: Both clemizole and diazepam, but not trazodone or valproic acid, decreased distance moved and increased time spent in the center of the arena.  /n  Model Summary: Here, we developed in vivo assays using scn1labs552 mutants between 3 and 6 d postfertilization (dpf). To evaluate sleep disturbances, we monitored larvae for 24 h with locomotion tracking software. Locomotor activity during dark (night phase) was significantly higher in mutants than in controls. Among anticonvulsant drugs, clemizole and diazepam, but not trazodone or valproic acid, decreased distance moved at night for scn1labs552 mutant larvae. To monitor exploratory behavior in an open field, we tracked larvae in a novel arena. Mutant larvae exhibited impaired exploratory behavior, with increased time spent near the edge of the arena and decreased mobility, suggesting greater anxiety.	ion channel activity,voltage-gated ion channel activity,voltage-gated sodium channel activity,cation channel activity,sodium channel activity	Ani
Adora2a	ADORA2A	protein-coding	Mus musculus	ENSMUSG00000020178	A2AAR|A2aR|AA2AR|ARA2A	11540	Cognitive Disorders	10|10 C1	Knockout	CD1	28844595	457	Expeimentalparadigm: Spontaneous alternation Y maze test//Radial arm maze//Electrical nociceptive threshold//Passive avoidance test//Active avoidance test  /n  Model Generation: The A2aR gene was cloned from a 129/Sv mouse genomic library by using a dog cDNA probe2,3. Seven clones spanning the locus were obtained, and the two exons were mapped and sequenced. A PGK-Neo cassette was inserted between the<U+00A0>Ncol and<U+00A0>EcoRI restriction sites within the first exon. The cassette replaced the first 102 codons of the gene, encoding transmembrane segments 1 to 3, and was flanked by 4.5 kb of 5′ and 10.5 kb of 3′ mouse gene fragments. Homologous recombination was carried out in the R1 ES cell line (129/Sv × 129/Sv-CP derived)25. ES cells were electroporated (BioRad Gene Pulser; 240 V and 500μF) with 84 μg targeting construct DNA, and plated onto γ-irradiated STP OB500 feeder cells. G418(250 μg ml<U+2212>1)-resistant colonies were collected after 11 days of selection, and recombinant clones were screened by Southern blotting after<U+00A0>DraI digestion and hybridization with a<U+00A0>32P-labelled 2,800-bp<U+00A0>EcoR1 fragment (Fig. 1). After mild trypsinization, clumps of ES cells were allowed to aggregate overnight in M16 medium with single CD1 eight-cell stage embryos after removal of the zona pellucida by treatment with acidic Tyrode's buffer26. Embryos were transferred into the uterus of pseudopregnant recipients (2.5 d.p.c.). Fetuses were recovered by caesarean section on day 20. Chimaeras were mated with CD1 mice and heterozygous mutants were bred for four generations with wild-type CD1 mice in order to dilute out the 129/Sv background. Heterozygotes were then bred together to generate wild-type homozygotes (A2aR+/+), heterozygotes (A2aR+/<U+2212>) and knockout (A2aR<U+2212>/<U+2212>) animals.  /n  Rescue: -  /n  Model Summary: Deletion of A2AR induces overall cognitive deficits in adult and middle-aged mice.A2AR deletion induces changes in synaptic proteins in the PFC and hippocampus.	G protein-coupled adenosine receptor activity,G protein-coupled receptor activity,lipid binding,enzyme binding,type 5 metabotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,alpha-actinin binding	Ani
Ank3	ANK3	protein-coding	Mus musculus	ENSMUSG00000069601	2900054D09Rik|Ank-3|AnkG|Ankyrin-3|Ankyrin-G	11735	Bipolar Disorder	10 B5.3|10 36.1 cM	Conditional Knockout	C57BL/6J	28894008	458	Expeimentalparadigm: Open field test//Elevated plus maze//Y maze//Novel object recognition test//Prepulse inhibition//Forced swim test//Tail suspension test  /n  Model Generation: Homozygous ankyrin-G flox mice (Ank3flox/flox) with loxP sites flanking exons 22 and 23 of both alleles of the Ank3 gene were provided by Vann Bennett, Duke University, Durham, NC (21). The Camk2a-Cre (T29-1) mice expressing Cre recombinase driven by the Camk2a promoter were purchased from The Jackson Laboratory (stock no. 005359). Both mouse lines were maintained on a C57BL6/J background. Mice with conditional (forebrain specific) deletion of ankyrin-G (Camk2a-Cre; Ank3flox/flox) (named Ank-G cKO) were generated by crossing Ank3flox/flox mice with Camk2a-Cre mice, so that exons 22 and 23 of both alleles of the Ank3 gene were excised. Sex- and age-matched littermates that did not express Cre were used as controls (Ank3flox/flox).  /n  Rescue: -  /n  Model Summary: ANK3 encodes ankyrin-G, which organizes the neuronal axon initial segment (AIS). We generated a mouse model with conditional disruption of ANK3 in pyramidal neurons of the adult forebrain (Ank-G cKO). This resulted in the expected loss of pyramidal neuron AIS voltage-gated sodium and potassium channels. There was also dramatic loss of markers of afferent GABAergic cartridge synapses, resembling the cortical microcircuitry changes in brains from psychotic patients, and suggesting disinhibition. Expression of c-fos was increased in cortical pyramidal neurons, consistent with increased neuronal activity due to disinhibition. The mice showed robust behavioral phenotypes reminiscent of aspects of human mania, ameliorated by antimania drugs lithium and valproate. Repeated social defeat stress resulted in repeated episodes of dramatic behavioral changes from hyperactivity to "depression-like" behavior, suggestive of some aspects of human bipolar disorder.	structural constituent of cytoskeleton,protein binding,cytoskeletal protein binding,spectrin binding,protein-macromolecule adaptor activity,transmembrane transporter binding,cadherin binding,phosphorylation-dependent protein binding	Ani
Vrk3	VRK3	protein-coding	Mus musculus	ENSMUSG00000002205	-	101568	Autism Spectrum Disorder	7|7 B3	Knockout	C57BL/6	28899869	459	Expeimentalparadigm: Passive avoidance//Novel object recognition test//Barnes maze//Stereotyped behavior//Three-chamber test//Pup retrieval//Nesting behavior test//Open field test//Elevated plus maze//Light–dark box test  /n  Model Generation: The gene-trapped embryonic stem cell line YTA189 (http://www.informatics.jax.org/allele/MGI:3880442) was obtained from BayGenomics (Stryke et al., 2003). This cell line was generated using a gene trap protocol with the pGT0Lxf construct, which contains the intron from engrailed 2 upstream of a gene encoding β-galactosidase/neomycin resistance, β-geo (http://www.genetrap.org). The embryonic stem cell clone was injected into a C57BL/6 blastocyst according to standard procedures (Stryke et al., 2003; Bult et al., 2010). Male chimeras were bred with C57BL/6 mice to create animals with a germline transmission of the mutant allele. Heterozygous mice were backcrossed with C57BL/6 mice for a minimum of six generations before the study. Genotyping was performed by PCR and Southern blot using DNA extracted from mouse tails. Insertion of the neomycin phosphotransferase cassette was verified by PCR (neomycin primer: sense, 5′-GTTCTTTTTGTCAAGACCGACCT-3′; antisense, 5′-CTCTTCAGCAATATCACGGGTAG-3′; Int7 primer: sense, 5′-TTTATGAAGTGACCAAAGACCTGA-3′; antisense, 5′-GGGCTAGCATCTCAACTACTACCT-3′).  /n  Rescue: Notably, TrkB stimulation with 7,8-dihydroxyflavone reversed the altered synaptic structure and function and successfully restored autism-like behavior in VRK3-deficient mice.  /n  Model Summary: Vaccinia-related kinases (VRKs) are multifaceted serine/threonine kinases that play essential roles in various aspects of cell signaling, cell cycle progression, apoptosis, and neuronal development and differentiation. However, the neuronal function of VRK3 is still unknown despite its etiological potential in human autism spectrum disorder (ASD). Here, we report that VRK3-deficient mice exhibit typical symptoms of autism-like behavior, including hyperactivity, stereotyped behaviors, reduced social interaction, and impaired context-dependent spatial memory.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,ATP binding,protein phosphatase binding	Ani
Slc1a1	SLC1A1	protein-coding	Mus musculus	ENSMUSG00000024935	D130048G10Rik|EAAC1|EAAC2|EAAT3|MEAAC1	20510	Obsessive Compulsive Disorder	19|19 C1	Knockout	C57BL/6J	28927446	460	Expeimentalparadigm: Open field test//Elevated plus maze//Marble burying//Locomotor activity  /n  Model Generation: Male mice carrying a targeted knockout Slc1a1 gene were generated at the NIMH Transgenic Core Facility using a construct obtained from Knockout Mouse Project Consortium (KOMP) (clone ID: PG00093 Z_1_807) under a standard protocol. Briefly, linearized construct was electroporated in embryonic stem (ES) cells; after selection screening, targeted ES cells were injected into C57BL/6N blastocysts and chimeric mice were bred with C57BL/6J to test for germ line transmission and to establish the targeted lines. The official designation of these mice is B6-Slc1a1tm1a(KOMP)Wtsi. By the time of experimental procedures, 10 crosses onto C57BL/6J have been made.  /n  Rescue: -  /n  Model Summary: Compared to wild-type littermates, EAAT3 heterozygous male mice have unaltered baseline anxiety-like, compulsive-like behavior and locomotor activity. Administration of acute amphetamine (5 mg/kg intraperitoneally) increased locomotion with no differences across genotypes. Tissue levels of glutamate, GABA, dopamine and serotonin did not vary between EAAT3 heterozygous and wild-type mice. Our results indicate that reduced EAAT3 expression does not impact neurotransmitter content in the corticostriatal circuit nor alter anxiety or compulsive-like behaviors.	anion channel activity,L-glutamate transmembrane transporter activity,high-affinity L-glutamate transmembrane transporter activity,protein binding,chloride transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,L-aspartate transmembrane transporter activity,symporter activity,glutamate:sodium symporter activity,glutamate binding,cysteine transmembrane transporter activity,identical protein binding,metal ion binding,D-aspartate transmembrane transporter activity	Ani
Upf3b	UPF3B	protein-coding	Mus musculus	ENSMUSG00000036572	5730594O13Rik|RENT3B|UPF3X	68134	Autism Spectrum Disorder	X|X A3.3	Conditional Knockout	C57BL/6	28948974	461	Expeimentalparadigm: Y-maze//Fear conditioning test//Sleep behaviors//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: To generate Upf3b-mutant mice, we first screened two ESC clones harboring gene trap insertions for Upf3b expression. One ESC clone had the cassette insertion in intron 1 (IST14619B5) and the other in intron 4 (IST10135A8) (Supplementary Figure S1a). In both clones, use of the splice accepter (SA) sequence in the cassette leads to the generation of a fusion transcript predicted to encode a truncated form of UPF3B protein. We analyzed the expression level of these two ESC clones and found that clone IST14619B5 had >90% reduced level of Upf3b mRNA relative to that in control ESCs, whereas clone IST10135A8 exhibited only a ~50% reduction in Upf3b mRNA levels (Supplementary Figure S1b). Of note, the reduction in Upf3b mRNA level is likely to be an underestimate, as there were probably some feeder fibroblasts (which express wild-type Upf3b) still remaining, even though we passaged the ESCs 3 times in the absence of fresh feeder cells. We selected the IST14619B5 clone to inject into donor blastocysts for the generation of chimeric Upf3b-mutant mice.  /n  Rescue: -  /n  Model Summary: Indeed, loss or depletion of NMD factors have been shown to disrupt developmental events in organisms spanning the phylogenetic scale. In humans, mutations in the NMD factor gene, UPF3B, cause intellectual disability (ID) and are strongly associated with autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD) and schizophrenia (SCZ). Here, we report the generation and characterization of mice harboring a null Upf3b allele. These Upf3b-null mice exhibit deficits in fear-conditioned learning, but not spatial learning. Upf3b-null mice also have a profound defect in prepulse inhibition (PPI), a measure of sensorimotor gating commonly deficient in individuals with SCZ and other brain disorders. Consistent with both their PPI and learning defects, cortical pyramidal neurons from Upf3b-null mice display deficient dendritic spine maturation in vivo.	mRNA binding	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockin	129S6;C57BL/6J	28964912	462	Expeimentalparadigm: 5-Choice serial reaction time task// Go-No go task//Peak Interval Task//Progressive Ratio//Sucrose Preference Test  /n  Model Generation: Homozygous DAT Val559 and wildtype (WT) littermate mice used in the study were bred from heterozygous breeders on the hybrid background used in our prior studies19<U+00A0>(75% 129S6 and 25% C57BL/6J).<U+00A0>  /n  Rescue: -  /n  Model Summary: DAT Val559 mouse a relevant model for understanding ADHD and related disorders.Model shows alterations in motivation, cognition, and impulsivity	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
dyrk1aa	DYRK1A	protein-coding	Zebrafish	ENSDARG00000063570	dyrk1a|im:6962097|zgc:158359	100005019	Autism Spectrum Disorder	-	Knockout(TALEN)	Tg(fli1:efgp)y1;Tg(gata1:dsred)sd2	29021890	463	Expeimentalparadigm: Dark flash test//Sleep and waking activity//Novel tank assay//Social interaction assay//Shoaling bowl assay  /n  Model Generation: The<U+00A0>dyrk1aa<U+00A0>(7<U+00A0>bp deletion) KO fish was generated using TALEN, as previously reported [34]. A TALEN pair targeting exon 5 of<U+00A0>dyrk1aa<U+00A0>(left target site: 5′-tgg gtc gcc atc aag atc at-3′; right target site: 5′- gcc ttc ctg aat cag gct ca-3′) was designed and assembled by ToolGen Inc. (http://toolgen.com/). In vitro-transcribed RNA of the TALEN pair (100<U+00A0>ng each) was microinjected into 1~2 cell stage of fertilized zebrafish eggs, which were then grown to 4-month-old adulthood.The progeny were propagated through a series of out-crossings with wild type (WT) fish; these animals were eventually in-crossed to obtain homozygous KOs.  /n  Rescue: -  /n  Model Summary: In this study, we established a zebrafish model to validate a candidate gene for autism in a vertebrate animal. These results illustrate the functional deficiency of<U+00A0>DYRK1A<U+00A0>as an underlying disease mechanism for autism. We also propose simple social behavioral assays as a tool for the broader study of autism candidate genes.	nucleotide binding,transcription coactivator activity,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,ATP binding,kinase activity,transferase activity	Ani
Itgb3	ITGB3	protein-coding	Mus musculus	ENSMUSG00000020689	CD61|GP3A|INGRB3	16416	Autism Spectrum Disorder	11 E1|11 67.84 cM	Knockin	C57BL/6<U+00A0>	29038237	464	Expeimentalparadigm: Open field test//Elevated zero maze//Forced swim test//Tail suspension test//Marble burying//Three Chamber Social Test//Social preference test//Social reciprocity test//Olfaction test  /n  Model Generation: All animals used in this study were male mice (8–20 weeks of age) generated from crosses of heterozygous for the Pro32Pro33 knock-in<U+00A0>Itgb3<U+00A0>allele made on the C57BL/6 background (Oliver et al., 2014).<U+00A0>  /n  Rescue: Inhibition of focal adhesion kinase (FAK) rescued SERT function in synapses of KI mice, demonstrating that constitutive active FAK signaling downstream of the Pro32Pro33 integrin αvβ3 suppresses SERT activity.  /n  Model Summary: Here, we used knock-in (KI) mice expressing an聽Itgb3聽variant that phenocopies the human Pro33 variant to elucidate the consequences of constitutively enhanced 伪v尾3 signaling to the 5-HT system in the brain. KI mice displayed deficits in multiple behaviors, including anxiety, repetitive, and social behaviors.	fibronectin binding,protease binding,protein disulfide isomerase activity,protein kinase C binding,integrin binding,protein binding,fibroblast growth factor binding,enzyme binding,C-X3-C chemokine binding,insulin-like growth factor I binding,neuregulin binding,identical protein binding,vascular endothelial growth factor receptor 2 binding,cell adhesion molecule binding,extracellular matrix binding,fibrinogen binding	Ani
D130043K22Rik	KIAA0319	protein-coding	Mus musculus	ENSMUSG00000006711	4930451E12Rik|Kiaa0319	210108	Developmental Dyslexia	13|13 A3.1	Double Knockout	C57BL/6J	29045729	465	Expeimentalparadigm: Locomotion test//ABR//Light-dark box test//Accelerating rotarod//Olfactory preference task//Y-maze//T-maze//Startle reflex and prepulse inhibition//Open field test//Acoustic startle//Silent gap detection  /n  Model Generation: ES cells targeted with a “knockout-first” (KO1, reporter-tagged insertion with conditional potential) allele (C57BL/6 N-AU040320tm1a(EUCOMM)Wtsi) (Skarnes et al. 2011) were purchased from the European Conditional Mouse Mutagenesis Program (EUCOMM,<U+00A0>www.eucomm.org) and used for C57BL/6 J blastocyst injections. C57BL/6 J-AU040320tm1a(EUCOMM)Wtsi<U+00A0>(AU040320-KO1) mice were obtained after breeding of a male chimera with C57BL/6 J females. Other mouse lines carrying alleles<U+00A0>tm1b, tm1c, and<U+00A0>tm1d<U+00A0>(Skarnes et al. 2011) were obtained: C57BL/6 J-AU040320tm1b(EUCOMM)Wtsi<U+00A0>(lacZ-tagged null allele;<U+00A0>-del), C57BL/6 J-AU040320tm1c(EUCOMM)Wtsi<U+00A0>(floxed, conditional allele;<U+00A0>-Flx), and C57BL/6 J-AU040320tm1d(EUCOMM)Wtsi<U+00A0>(null allele;<U+00A0>-Null) (Fig.<U+00A0><U+200B>(Fig.11A). All lines were maintained on a C57BL/6J background, in which the C57BL/6N background from the original ES cells had been diluted during the successive backcrosses.<U+00A0>  /n  Rescue: -  /n  Model Summary: Knockout Mice for Dyslexia Susceptibility Gene Homologs<U+00A0>KIAA0319<U+00A0>and<U+00A0>KIAA0319L<U+00A0>have Unaffected Neuronal Migration but Display Abnormal Auditory Processing	molecular_function	Ani
AU040320	KIAA0319L	protein-coding	Mus musculus	ENSMUSG00000028830	A730047D20Rik|AAVR|Kiaa0319l	100317	Developmental Dyslexia	4|4 D2.2	Double Knockout	C57BL/6J	29045729	466	Expeimentalparadigm: Locomotion test//ABR//Light-dark box test//Accelerating rotarod//Olfactory preference task//Y-maze//T-maze//Startle reflex and prepulse inhibition//Open field test//Acoustic startle//Silent gap detection  /n  Model Generation: ES cells targeted with a “knockout-first” (KO1, reporter-tagged insertion with conditional potential) allele (C57BL/6 N-AU040320tm1a(EUCOMM)Wtsi) (Skarnes et al. 2011) were purchased from the European Conditional Mouse Mutagenesis Program (EUCOMM,<U+00A0>www.eucomm.org) and used for C57BL/6 J blastocyst injections. C57BL/6 J-AU040320tm1a(EUCOMM)Wtsi<U+00A0>(AU040320-KO1) mice were obtained after breeding of a male chimera with C57BL/6 J females. Other mouse lines carrying alleles<U+00A0>tm1b, tm1c, and<U+00A0>tm1d<U+00A0>(Skarnes et al. 2011) were obtained: C57BL/6 J-AU040320tm1b(EUCOMM)Wtsi<U+00A0>(lacZ-tagged null allele;<U+00A0>-del), C57BL/6 J-AU040320tm1c(EUCOMM)Wtsi<U+00A0>(floxed, conditional allele;<U+00A0>-Flx), and C57BL/6 J-AU040320tm1d(EUCOMM)Wtsi<U+00A0>(null allele;<U+00A0>-Null) (Fig.<U+00A0><U+200B>(Fig.11A). All lines were maintained on a C57BL/6J background, in which the C57BL/6N background from the original ES cells had been diluted during the successive backcrosses.<U+00A0>  /n  Rescue: -  /n  Model Summary: Knockout Mice for Dyslexia Susceptibility Gene Homologs<U+00A0>KIAA0319<U+00A0>and<U+00A0>KIAA0319L<U+00A0>have Unaffected Neuronal Migration but Display Abnormal Auditory Processing	molecular_function	Ani
Ndrg2	NDRG2	protein-coding	Mus musculus	ENSMUSG00000004558	Ndr2|SYLD	29811	Attention-Deficit/Hyperactivity Disorder	14|14 C2	Knockout	B6.C-Tg(CMV-cre)1Cgn/J;C57BL/6J	29058689	467	Expeimentalparadigm: Open field test//5-Choice serial reaction time task//Novel object recognition  /n  Model Generation: We generated<U+00A0>Ndrg2–/–<U+00A0>mice by targeting exons 2–6.Ndrg2fl/fl mice (a gift of Libo Yao, Fourth Military Medical University) were crossed to B6.C-Tg(CMV-cre)1Cgn/J mice (Jackson Laboratory) to generate Ndrg2–/– mice. The line was backcrossed to C57BL/6J a minimum of 8 times before use in any experiments in this study.  /n  Rescue: Additionally, NDRG2 peptide treatment rescued ADHD-like hyperactivity in the Ndrg2-/- mice, while routine methylphenidate treatment had no effect on hyperactivity in these animals.  /n  Model Summary: Ndrg2-knockout (Ndrg2–/–) mice exhibited ADHD-like symptoms characterized by attention deficits, hyperactivity, impulsivity, and impaired memory. Furthermore, interstitial glutamate levels and excitatory transmission were markedly increased in the brains of<U+00A0>Ndrg2–/–<U+00A0>mice due to reduced astroglial glutamate clearance.	NA	Ani
Ube3a	UBE3A	protein-coding	Mus musculus	ENSMUSG00000025326	4732496B02|5830462N02Rik|A130086L21Rik|Hpve6a	22215	Autism Spectrum Disorder	7 B5|7 33.95 cM	Overexpression	C57BL/6	29076503	468	Expeimentalparadigm: Self-grooming test//Three-chamber test//Open field test//Elevated plus maze//Rotarod  /n  Model Generation: Mice used for all experiments in this study were male, with C57BL/6 genetic background (SLAC, China).Three-week-old mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and placed in a stereotaxic apparatus (RWD Life Science) to infuse virus. PBS-diluted AAVs (1 μl) were bilaterally injected into mPFC regions of the brain at a constant rate of 0.2 μl/min using a syringe pump (Stoelting).  /n  Rescue: retinoic acid(RA) supplements significantly alleviated excessive UBE3A dosage-induced ASD-like phenotypes.<U+00A0>  /n  Model Summary: ASD-like symptoms were recapitulated in mice by overexpressing UBE3A in the prefrontal cortex or by administration of an ALDH1A antagonist, whereas RA supplements significantly alleviated excessive UBE3A dosage-induced ASD-like phenotypes.<U+00A0>	transcription coactivator activity,ubiquitin-protein transferase activity,protein binding,transferase activity,metal ion binding,ubiquitin protein ligase activity	Ani
Ptchd1	PTCHD1	protein-coding	Mus musculus	ENSMUSG00000041552	9630036J22Rik|Gm387	211612	Autism Spectrum Disorder	X|X F3	Knockout	C57BL/6N	29118110	469	Expeimentalparadigm: Open field<U+00A0>test//Novel object recognition test  /n  Model Generation: Ptchd1<U+00A0>mutant mice were generated in the C57BL/6N background in collaboration with the Mouse Biology Project at the University of California–Davis. Targeting vector PRPGS00100_C_H03 (KOMP) was electroporated into<U+00A0>JM8.N4<U+00A0>ES cell and colonies selected. The targeting cassette is based on the KO first vector design, replacing exon 2 of the<U+00A0>Ptchd1<U+00A0>gene. Mice with germline transmission were mated with ROSA26-Flpe females (Jax stock no: 003946), backcrossed over 10 generations with C57BL/6N mice, to remove FRT-flanked genetrap/LacZ sequences, yielding a conditional allele. Germline ablation of exon 2 was created by crossing with CMV-cre mice (Jax stock no: 006054).<U+00A0>  /n  Rescue: -  /n  Model Summary: Ptchd1<U+00A0>knock-out (KO) male mice exhibit cognitive alterations, including defects in a novel object recognition task.In the absence of Ptchd1, we observed profound disruption in excitatory/inhibitory balance despite normal dendritic spine density on dentate granule cells.	protein binding	Ani
Ccr3	CCR3	protein-coding	Mus musculus	ENSMUSG00000035448	CC-CKR3|CKR3|Cmkbr1l2|Cmkbr3	12771	Narcolepsy	9 F4|9 75.05 cM	Knockout	BALB/c<U+00A0>	29186205	470	Expeimentalparadigm: EEG//EMG<U+00A0>  /n  Model Generation: Male<U+00A0>Ccr3<U+00A0>Knockout mice on the BALB/c background (C.129S4-Ccr3<tm1Cge>/J, Stock Number 005440) (The Jackson Laboratory, Bar Harbor, ME, USA) were used for all experiments. Mice were housed in groups of 2–6 in a SPF animal facility at Tokyo Metropolitan Institute of Medical Science.<U+00A0>  /n  Rescue: -  /n  Model Summary: We found abnormalities in sleep patterns in the resting phase and in the number of Hcrt neurons in<U+00A0>Ccr3<U+00A0>Knockout mice. These observations suggest a role for CCR3 in sleep-wake regulation in narcolepsy patients.	G protein-coupled receptor activity,chemokine receptor activity,protein binding,C-C chemokine receptor activity,C-C chemokine binding	Ani
Dpysl3	DPYSL3	protein-coding	Mus musculus	ENSMUSG00000024501	CRMP-4|DRP-3|TUC4|ULIP-1|Ulip|Ulip1	22240	Autism Spectrum Disorder	18|18 B3	Knockout	C57BL/6N<U+00A0>	29196732	471	Expeimentalparadigm: Open-field test//Elevated plus maze test//Novel object recognition test//Three-chamber test//Social interaction test//Tube test for social dominance//Food exploring test//Hot plate test  /n  Model Generation: WT and<U+00A0>Crmp4-KO mice18<U+00A0>were generated by mating<U+00A0>Crmp4<U+00A0>+/<U+2212><U+00A0>heterozygotes backcrossed onto the C57BL/6N background for at least 10 generations.<U+00A0>  /n  Rescue: -  /n  Model Summary: Crmp4-KO mice showed decreased social interaction and several alterations of sensory responses. Most of these changes were more severe in male<U+00A0>Crmp4-KO mice than in females.<U+00A0>These results indicate a functional link between a case-specific, rare variant of one gene, Crmp4, and several characteristics of ASD, including sexual differences.	dihydropyrimidinase activity,protein binding,hydrolase activity,hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds,SH3 domain binding,filamin binding,chondroitin sulfate binding,identical protein binding,phosphoprotein binding	Ani
Nat8l	NAT8L	protein-coding	Mus musculus	ENSMUSG00000048142	1110038O08Rik|Shati	269642	Attention-Deficit/Hyperactivity Disorder	5|5 B2	Knockout	C57BL/6J	29203337	472	Expeimentalparadigm: Locomotion test//Cliff avoidance test//Object-based attention test  /n  Model Generation: We entrusted Unitech (Chiba, Japan) to produce knockout mice in which<U+00A0>Shati/Nat8l<U+00A0>DNA (NM_001001985.3)<U+00A0>[13]<U+00A0>was absent in the entire body. Briefly, the entire exons coding SHATI were deleted by a targeting vector including neomycin resistance sequence. The<U+00A0>Shati-knockout mice were created via homologous recombinant ES cells of C57BL/6J mice.<U+00A0>  /n  Rescue: Moreover, we evaluated the effects of atomoxetine (ATX) and methylphenidate (MPH) on the behavioral deficits in Shati/Nat8l KO mice. As the result, almost all behavioral deficits were improved by the treatment of both ATX and MPH.  /n  Model Summary: Shati/Nat8l<U+00A0>knockout (KO) mice showed hyperactivity in locomotor activity test.Shati/Nat8l KO mice showed shortened jumping latency in cliff avoidance test.Shati/Nat8l KO mice displayed a significantly lower recognition index in object-based attention test.	N-acetyltransferase activity,transferase activity,acyltransferase activity,aspartate N-acetyltransferase activity	Ani
Dcdc2a	DCDC2	protein-coding	Mus musculus	ENSMUSG00000035910	AW492955|Dcdc2|RU2	195208	Developmental Dyslexia	13|13 A3.1	Knockout	129SJ;C57BL/6J	29232042	473	Expeimentalparadigm: Visual discrimination  /n  Model Generation: Dcdc2<U+00A0>Knockout mice (Dcdc2del2/del2) carried a constitutive homozygous deletion of exon 2 (del2) within the<U+00A0>Dcdc2<U+00A0>gene region of a 129SJ<U+2009>×<U+2009>C57BL/6J hybrid background backcrossed to C57BL/6J for 10 generations. Our subjects were generated from the<U+00A0>Dcdc2<U+00A0>colony maintained by J.J.L. at the University of Connecticut, using a heterozygous-heterozygous (Dcdc2wt/del2<U+2009>×<U+2009>Dcdc2wt/del2) mating scheme, with resultant genotypes recovered in the expected mendelian ratios (1:2:1).<U+00A0>  /n  Rescue: -  /n  Model Summary: Initial studies showed that Dcdc2 Knockouts display deficits in auditory processing and working memory. The current study was designed to evaluate the association between DCDC2 and motion perception, as these skills have not yet been assessed in the Dcdc2 Knockout mouse model. We developed a novel motion perception task, utilizing touchscreen technology and operant conditioning. Dcdc2 Knockouts displayed deficits on the Pairwise Discrimination task specifically as motion was added to visual stimuli.<U+00A0>	molecular_function,kinesin binding	Ani
Rapgef3	RAPGEF3	protein-coding	Mus musculus	ENSMUSG00000022469	2310016P22Rik|9330170P05Rik|Epac|Epac1	223864	Aggressive Behaviors	15|15 F1	Knockout	C57BL/6 CBA;C57BL/6 FVB<U+00A0>	29289659	474	Expeimentalparadigm: Visual placing//Contact placing//Limb clasping//Auditory function test//Grip strength test//Find the Hidden Cookie Test//Open field test// Elevated plus maze//Marble burying test//Rotorod test//Sucrose anhedonia test//Y-maze//Digging Test//Porsolt Forced Swim Test//Aggression Against and Intruder Test//Hot Plate Test  /n  Model Generation: TPO-cre;<U+00A0>Prkar1aloxP/loxP<U+00A0>(Pringle et al., 2012) were mated with<U+00A0>Epac1<U+00A0>KO mice (Suzuki et al., 2010), provided kindly by the Ishikawa group at Yokohama City University, Japan, to produce a double knockout, R1A-Epac1KO. All experiments were performed in a C57BL/6 CBA and FVB mixed background. All experimental mice were derived from the same parents of origin and inbred to produce each of the four genetic models:<U+00A0>TPO-cre; Prkar1aloxp/loxp<U+00A0>(R1A),<U+00A0>TPO-cre; Prkar1aloxp/loxp; Epac1<U+2212>/<U+2212><U+00A0>(R1A-Epac1KO), Prkar1aloxp/loxp;<U+00A0>Epac1<U+2212>/<U+2212><U+00A0>(Epac1KO), and<U+00A0>Prkar1aloxp;loxp<U+00A0>(WT Control).  /n  Rescue: -  /n  Model Summary: Mice with a genetic background of<U+00A0>Tpo-Cre;Prkar1aflox/flox;Epac1<U+2212>/<U+2212><U+00A0>are aggressive, and both the thyroid-specific knockout of<U+00A0>Prkar1a<U+00A0>and global knockout of<U+00A0>Epac1<U+00A0>likely contribute to this aggressive behavior. This study supports the hypothesis that altered thyroid signaling and aggressive behavior are linked.	nucleotide binding,guanyl-nucleotide exchange factor activity,protein binding,protein domain specific binding,cAMP binding,transmembrane transporter binding	Ani
Prkar1a	PRKAR1A	protein-coding	Mus musculus	ENSMUSG00000020612	1300018C22Rik|RIalpha|Tse-1|Tse1	19084	Aggressive Behaviors	11 E1|11 72.33 cM	Conditional Knockout	C57BL/6 CBA;C57BL/6 FVB<U+00A0>	29289659	475	Expeimentalparadigm: Visual placing//Contact placing//Limb clasping//Auditory function test//Grip strength test//Find the Hidden Cookie Test//Open field test// Elevated plus maze//Marble burying test//Rotorod test//Sucrose anhedonia test//Y-maze//Digging Test//Porsolt Forced Swim Test//Aggression Against and Intruder Test//Hot Plate Test  /n  Model Generation: TPO-cre;<U+00A0>Prkar1aloxP/loxP<U+00A0>(Pringle et al., 2012) were mated with<U+00A0>Epac1<U+00A0>KO mice (Suzuki et al., 2010), provided kindly by the Ishikawa group at Yokohama City University, Japan, to produce a double knockout, R1A-Epac1KO. All experiments were performed in a C57BL/6 CBA and FVB mixed background. All experimental mice were derived from the same parents of origin and inbred to produce each of the four genetic models:<U+00A0>TPO-cre; Prkar1aloxp/loxp<U+00A0>(R1A),<U+00A0>TPO-cre; Prkar1aloxp/loxp; Epac1<U+2212>/<U+2212><U+00A0>(R1A-Epac1KO), Prkar1aloxp/loxp;<U+00A0>Epac1<U+2212>/<U+2212><U+00A0>(Epac1KO), and<U+00A0>Prkar1aloxp;loxp<U+00A0>(WT Control).  /n  Rescue: -  /n  Model Summary: -	nucleotide binding,cAMP-dependent protein kinase inhibitor activity,protein binding,cAMP-dependent protein kinase regulator activity,protein domain specific binding,cAMP binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding	Ani
Prkar1a	PRKAR1A	protein-coding	Mus musculus	ENSMUSG00000020612	1300018C22Rik|RIalpha|Tse-1|Tse1	19084	Aggressive Behaviors	11 E1|11 72.33 cM	Knockout	C57BL/6 CBA;FVB	29289659	476	Expeimentalparadigm: Sensorimotor test//Memory test//Affective behavioral test//Compulsive behavior test//Pain tolerance test//Aggression test  /n  Model Generation: TPO-cre; Prkar1aloxP/loxP (Pringle et al., 2012) were mated with Epac1 KO mice (Suzuki et al., 2010), provided kindly by the Ishikawa group at Yokohama City University, Japan, to produce a double knockout, R1A-Epac1KO. All experiments were performed in a C57BL/6 CBA and FVB mixed background. All experimental mice were derived from the same parents of origin and inbred to produce each of the four genetic models: TPO-cre; Prkar1aloxp/loxp (R1A), TPO-cre; Prkar1aloxp/loxp; Epac1-/- (R1A-Epac1KO), Prkar1aloxp/loxp; Epac1-/- (Epac1KO), and Prkar1aloxp;loxp (WT Control).  /n  Rescue: -  /n  Model Summary: The Tpo-Cre;Prkar1aflox/flox;Epac1 (R1A-Epac1KO) mice, originally bred to investigate the role of exchange protein directly activated by cAMP (Epac1) in follicular thyroid cancer, displayed self-mutilating and aggressive behaviors during casual observation. To assess these atypical responses, behavioral testing was conducted with the R1A-Epac1KO mice, as well as their single knockout counterparts, the thyroid-specific Prkar1a and global Epac1 mice. Mice of all three genotypes demonstrated increased aggressive behavior against an intruder mouse. In addition, Epac1 mice increased response to an auditory stimulus, and the Prkar1a and R1A-Epac1KO mice increased swimming behavior in the Porsolt forced swim test. Both Prkar1a mice and R1A-Epac1KO mice have increased circulating thyroxine and corticosterone concentrations. Although hyperthyroidism has not been previously associated with aggression, increased thyroid hormone signaling might contribute to the increased aggressive response to the intruder mouse, as well as the increased swimming response. Mice with a genetic background of Tpo-Cre;Prkar1a-/--/--/--/--/--/-flox/flox;Epac1 are aggressive, and both the thyroid-specific knockout of Prkar1a and global knockout of Epac1 likely contribute to this aggressive behavior.	nucleotide binding,cAMP-dependent protein kinase inhibitor activity,protein binding,cAMP-dependent protein kinase regulator activity,protein domain specific binding,cAMP binding,ubiquitin protein ligase binding,protein kinase A catalytic subunit binding	Ani
Rapgef3	RAPGEF3	protein-coding	Mus musculus	ENSMUSG00000022469	2310016P22Rik|9330170P05Rik|Epac|Epac1	223864	Aggressive Behaviors	15|15 F1	Knockout	C57BL/6 CBA;FVB	29289659	477	Expeimentalparadigm: Sensorimotor test//Memory test//Affective behavioral test//Compulsive behavior test//Pain tolerance test//Aggression test  /n  Model Generation: TPO-cre; Prkar1aloxP/loxP (Pringle et al., 2012) were mated with Epac1 KO mice (Suzuki et al., 2010), provided kindly by the Ishikawa group at Yokohama City University, Japan, to produce a double knockout, R1A-Epac1KO. All experiments were performed in a C57BL/6 CBA and FVB mixed background. All experimental mice were derived from the same parents of origin and inbred to produce each of the four genetic models: TPO-cre; Prkar1aloxp/loxp (R1A), TPO-cre; Prkar1aloxp/loxp; Epac1-/- (R1A-Epac1KO), Prkar1aloxp/loxp; Epac1-/- (Epac1KO), and Prkar1aloxp;loxp (WT Control).  /n  Rescue: -  /n  Model Summary: The Tpo-Cre;Prkar1aflox/flox;Epac1 (R1A-Epac1KO) mice, originally bred to investigate the role of exchange protein directly activated by cAMP (Epac1) in follicular thyroid cancer, displayed self-mutilating and aggressive behaviors during casual observation. To assess these atypical responses, behavioral testing was conducted with the R1A-Epac1KO mice, as well as their single knockout counterparts, the thyroid-specific Prkar1a and global Epac1 mice. Mice of all three genotypes demonstrated increased aggressive behavior against an intruder mouse. In addition, Epac1 mice increased response to an auditory stimulus, and the Prkar1a and R1A-Epac1KO mice increased swimming behavior in the Porsolt forced swim test. Both Prkar1a mice and R1A-Epac1KO mice have increased circulating thyroxine and corticosterone concentrations. Although hyperthyroidism has not been previously associated with aggression, increased thyroid hormone signaling might contribute to the increased aggressive response to the intruder mouse, as well as the increased swimming response. Mice with a genetic background of Tpo-Cre;Prkar1a-/--/--/--/--/--/-flox/flox;Epac1 are aggressive, and both the thyroid-specific knockout of Prkar1a and global knockout of Epac1 likely contribute to this aggressive behavior.	nucleotide binding,guanyl-nucleotide exchange factor activity,protein binding,protein domain specific binding,cAMP binding,transmembrane transporter binding	Ani
Slc6a3	SLC6A3	protein-coding	Rattus norvegicus	ENSRNOG00000017302	Dat1	24898	Attention-Deficit/Hyperactivity Disorder	1p11	Knockout	Wistar-Han	29348190	478	Expeimentalparadigm: Locomotor activity in a novel environment<U+00A0>//Twenty-four-hour spontaneous locomotor activity in a home cage//Y-maze spontaneous alternation test //Startle response and prepulse inhibition  test  /n  Model Generation: ZFN design, construction,<U+00A0>in vitro<U+00A0>validation, microinjection, and founder selection were performed as described previously (Geurts et al., 2009;<U+00A0>Carbery et al., 2010). The ZFN target site was as follows: CTCATCAACCCGCCACAGAcaccaGTGGAGGCTCAAGAG in the Exon 2 of Slc6a3 gene (NCBI Gene ID: 24898; Genomic NCBI Ref Seq: NC_005100.3; mRNA NCBI Ref Seq:<U+00A0>NM_012694.2). The KO rat lines were created in the outbred Wistar–Han background at SAGE Labs.  /n  Rescue: -  /n  Model Summary: Here, we present a newly developed strain of rats in which the gene encoding the dopamine transporter (DAT) has been disrupted (Dopamine Transporter Knockout rats [DAT-KO rats]). DAT-KO rats display functional hyperdopaminergia accompanied by pronounced spontaneous locomotor hyperactivity.<U+00A0>	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,monoamine transmembrane transporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Kirrel3	KIRREL3	protein-coding	Mus musculus	ENSMUSG00000032036	1500010O20Rik|2900036G11Rik|NEPH2|SST4|mKIAA1867	67703	Autism Spectrum Disorder	9|9 A4	Conditional Knockout	C57BL/6	29362445	479	Expeimentalparadigm: Three-chamber test//Social recognition test//USV recording//Open field test//Light-dark box test//Elevated plus maze//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: The targeting construct was designed to replace the exon 1 of the Kirrel3 coding sequence containing a lacZ (β-galactosidase) reporter with a mouse nuclear localisation signal (NLS) upstream of a phosphoglycerine kinase (PGK) promoter driving a neomycin (Neo) selection marker. The PGK-Neo gene with polyadenylation site was flanked by loxP sites and could be later deleted by Cre recombinase (Cre). The deleted part of the Kirrel3 gene includes the entire Kirrel3 coding region starting with the translation initiation codon in exon 1 and ending downstream of exon 16, the last exon. The targeting construct was assembled from the Kirrel3 5’ and 3’ homology arms and NLS-lacZ restriction fragments, which were each amplified by PCR, subcloned into pPCR, and characterised by DNA sequencing. The final targeting construct was linearised and electroporated into embryonic stem (ES) cells, and colonies were selected for resistance to G418. Genomic DNA isolated from ES cell colonies were digested with XbaI before hybridisation with 5’ flanking probe. The wild-type allele produced a band of 6.8 kb, whereas the targeted allele produced a band of 9.7 kb. Mutant ES cell clones were injected into C57BL/6 blastocysts to produce chimeric mice. The chimeric mice were mated with C57BL/6 mice to obtain heterozygous mice carrying the targeted allele. Heterozygous offspring were mated with B6 Cre delete mice (Ozgene Pty Ltd) to remove the loxP-flanked selectable marker cassette. The founder mice were bred for more than 10 generations onto a C57BL/6J background. From cross-breeding of Kirrel3+/- mice, we obtained Kirrel3-/- and wild-type littermate mice for anatomical, histological and behavioural analyses.  /n  Rescue: -  /n  Model Summary: To elucidate the causal relationship between KIRREL3 deficiency and behavioural abnormalities relevant to neurodevelopmental disorders, we generated global Kirrel3-knockout (Kirrel3) mice and investigated the detailed behavioural phenotypes. In the three-chambered social approach test, Kirrel3 mice displayed a significant preference for a mouse over a non-social object but no significant preference for a stranger mouse over a familiar mouse. Ultrasonic communications, including pup-to-mother calls, male-female courtship vocalisation and resident responses to intruder, were significantly impaired in Kirrel3 mice. Significant increases in locomotor activity and repetitive rearing were also observed in Kirrel3 mice. Furthermore, the performance of Kirrel3 mice in the rotarod test was significantly better than that of wild-type mice. In the acoustic startle test, Kirrel3 mice were significantly hypersensitive to acoustic stimuli. Anxiety-related behaviours and spatial or fear memory acquisition were normal in Kirrel3 mice. These findings suggest that Kirrel3 mice exhibit autistic-like behaviours, including social and communicative deficits, repetitive behaviours, and sensory abnormalities, as well as hyperactivity.	protein binding,PDZ domain binding,cell adhesion molecule binding	Ani
Shank3	SHANK3	protein-coding	Rattus norvegicus	ENSRNOG00000052296	Prosap2|Spank-2	59312	Autism Spectrum Disorder	7q34	Knockout	NA	29377611	480	Expeimentalparadigm: Ultrasonic vocalizations<U+00A0>//Three-chamber test//Juvenile social play//Open field test  /n  Model Generation: All experiments were performed on<U+00A0>Shank3<U+00A0>wildtype (+/+), heterozygous (+/-), and null mutant (-/-) littermates that were offspring of<U+00A0>Shank3 +/-<U+00A0>by<U+00A0>+/-<U+00A0>breeding pairs.<U+00A0>  /n  Rescue: -  /n  Model Summary: We report, for the first time, a call and response acoustic playback assay of bidirectional social communication in juvenile<U+00A0>Shank3<U+00A0>rats. Interestingly, we found that<U+00A0>Shank3-deficient males did not demonstrate the enhanced social approach behavior typically exhibited following playback of pro-social USV.<U+00A0>We further discovered that male Shank3-deficient pups emitted fewer isolation-induced USV than Shank3 wildtype controls. Postnatal whole brain anatomical phenotyping was applied to visualize anatomical substrates that underlie developmental phenotypes. The data presented here lend support for the important role of Shank3 in social communication, the core symptom domain of ASD.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
Dlgap1	DLGAP1	protein-coding	Mus musculus	ENSMUSG00000003279	4933422O14Rik|9630002F18|D17Bwg0511e|GKAP/SAPAP|GKPA/SAPAP|Gkap|Sapap1|mKIAA4162	224997	Autism Spectrum Disorder	17 E1.3|17 40.85 cM	Knockout	129/C57BL/6 J<U+00A0>	29396406	481	Expeimentalparadigm: Open field test//Prepulse inhibition//Forced swim test//Nest building test//Social approach//Sucrose preference test  /n  Model Generation: Dlgap1<U+00A0>KO mice on a mixed 129/C57BL/6<U+2009>J background were obtained from Dr. Seth Grant at Edinburgh University. Mice were backcrossed to C57BL/6<U+2009>J mice for one generation and then HT × HT breeding produced experimental cohorts.  /n  Rescue: -  /n  Model Summary: Dlgap1<U+00A0>KO<U+00A0>mice were most notable for disruption of protein interactions in the PSD, and deficits in sociability. Other behavioral measures were largely unaffected. Our data suggest that<U+00A0>Dlgap1<U+00A0>knockout leads to PSD disruption and reduced sociability, consistent with reports of<U+00A0>DLGAP1<U+00A0>haploinsufficient variants in schizophrenia and ASD.	protein binding,protein domain specific binding,protein-containing complex binding,molecular adaptor activity,structural constituent of postsynaptic density	Ani
Slc6a3	SLC6A3	protein-coding	Rattus norvegicus	ENSRNOG00000017302	Dat1	24898	Attention-Deficit/Hyperactivity Disorder	1p11	Knockout	Wistar-Han	29406596	482	Expeimentalparadigm: Novelty-seeking task  /n  Model Generation: The ZFN target site was as follows: CTCATCAACCCGCCACAGAcaccaGTGGAGGCTCAAGAG in the Exon 2 of Slc6a3 gene (NCBI Gene ID: 24898; Genomic NCBI Ref Seq: NC_005100.3; mRNA NCBI Ref Seq:<U+00A0>NM_012694.2). The KO rat lines were created in the outbred Wistar–Han background at SAGE Labs.  /n  Rescue: -  /n  Model Summary: In conclusion, DAT-KO rats may show some inattention while more novelty-seeking traits appear in DAT-HET rats.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,monoamine transmembrane transporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Slc6a4	SLC6A4	protein-coding	Rattus norvegicus	ENSRNOG00000003476	SERT	25553	Posttraumatic Stress Disorder	10q24	Knockout	Wistar	29427306	483	Expeimentalparadigm: Condition freezing//Fear extinction  /n  Model Generation: Experimental animals were derived from crossings between 5‐HTT+/<U+2212><U+00A0>rats. 5‐HTT knocKnockoutut rats (5‐HTT<U+2212>/<U+2212>, Slc6a41Hubr) were generated on a Wistar background by ENU‐induced mutagenesis  /n  Rescue: -  /n  Model Summary: In sum, we show that early‐immediate 5‐hmC modification in the amygdala is involved in impaired fear extinction in 5‐HTT<U+2212>/<U+2212><U+00A0>rats, which is independent of c‐Fos activation. As 5‐HTT<U+2212>/<U+2212><U+00A0>rats model the 5‐HTTLPR s‐allele,15<U+00A0>this finding may add a new dimension to the understanding of individual differences in risk for PTSD, as conferred by the 5‐HTTLPR s‐allele	neurotransmitter transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine transmembrane transporter activity,syntaxin-1 binding,cocaine binding,identical protein binding,metal ion binding,nitric-oxide synthase binding,actin filament binding,serotonin binding	Ani
Cdh13	CDH13	protein-coding	Mus musculus	ENSMUSG00000031841	4932416G01Rik|Cdht|Tcad	12554	Autism Spectrum Disorder	8 E1|8 65.97 cM	Conditional Knockout	GlyT2:Cre;Rosa::lox‐stop‐lox‐eYFP	29446202	484	Expeimentalparadigm: Open field<U+00A0>test//Rotarod//Odor habituation-dishabituation test//Marble burying//Resident-intruder test//Two‐choice digging task //Reciprocal social interaction //Gait analysis  /n  Model Generation: The following mice were used in this study:<U+00A0>GlyT2::Cre (line 122.2),35<U+00A0>Rosa::lox‐stop‐lox‐eYFP (The Jackson Laboratory),36<U+00A0>and<U+00A0>Cdh13<U+00A0>fl/fl<U+00A0>mice were generated with embryonic stem (ES) cells containing the<U+00A0>Cdh13<U+00A0>allele with<U+00A0>loxP<U+00A0>sites flanking exon 3 from the European Mouse Mutant Cell Repository (Jm8A3.N1).<U+00A0>GlyT2::Cre;<U+00A0>Cdh13<U+00A0>fl/fl<U+00A0>(GlyT2‐Cdh13<U+00A0><U+2212>/<U+2212>) mice were generated by crossing male<U+00A0>GlyT2::Cre;<U+00A0>Cdh13<U+00A0>fl/+<U+00A0>or<U+00A0>GlyT2::Cre;<U+00A0>Cdh13<U+00A0>fl/fl<U+00A0>with female<U+00A0>Cdh13<U+00A0>fl/fl<U+00A0>mice.  /n  Rescue: -  /n  Model Summary: At the behavioral level, loss of<U+00A0>Cdh13<U+00A0>in the cerebellum, piriform cortex and endopiriform claustrum have no impact on gross motor coordination or general locomotor behaviors, but leads to deficits in cognitive and social abilities. Mice lacking<U+00A0>Cdh13<U+00A0>exhibit reduced cognitive flexibility and loss of preference for contact region concomitant with increased reciprocal social interactions.	calcium ion binding,protein binding,low-density lipoprotein particle binding,identical protein binding,protein homodimerization activity,cadherin binding,metal ion binding,adiponectin binding,lipoprotein particle binding	Ani
Arhgef10	ARHGEF10	protein-coding	Mus musculus	ENSMUSG00000071176	6430549H08Rik|mKIAA0294	234094	Autism Spectrum Disorder	8|8 A1.1	Knockout	129S1/Sv;C57BL/6J	29456827	485	Expeimentalparadigm: Elcetrofoot shock aversive water drinking test//Open field test//Elevated plus maze//Three-chamber test//Tail suspension test//Forced swim test//Pre-pulse inhibition test//Morris water maze  /n  Model Generation: Arhgef10<U+00A0>knockout mice were generated by the deletion of exon 4 and exon 5 using the Cre-loxP site-specific knockout<U+00A0>.In brief, exons 4 and 5 of ARHGEF10 in embryonic stem cells from the 129S1/Sv mouse strain were replaced with a construct containing ARHGEF10 exons 4 and 5 interposed between two loxP sites and a NEO cassette to produce Cre-induced homologous recombination. Arhgef10 knockout mice were then backcrossed for at least ten generations with C57BL/6J mice.  /n  Rescue: -  /n  Model Summary: These results suggest that<U+00A0>ARHGEF10<U+00A0>is a candidate risk gene for ASD and that the<U+00A0>Arhgef10<U+00A0>knockout model could be a tool for studying the mechanisms of neurotransmission in ASD.	guanyl-nucleotide exchange factor activity,kinesin binding	Ani
Dagla	DAGLA	protein-coding	Mus musculus	ENSMUSG00000035735	Nsddr	269060	Autism Spectrum Disorder	19|19 A	Conditional Knockout	C57Bl/6j	29458998	486	Expeimentalparadigm: Light-dark box test//Open-field test//Balance-beam test//Rotarod//Water-induced grooming//Three-chamber test  /n  Model Generation: Floxed<U+00A0>Dagla<U+00A0>mice (DGLαflx/flx) harboring loxP sites that flank exon 8 of<U+00A0>Dagla<U+00A0>(DGLα) were generated<U+00A0>and were crossed with Drd1-Cre (D1-Cre; GENSAT Project; MGI ID: 3836633) or Adora2a-Cre (A2a-Cre; GENSAT Project; MGI ID: 4361654) mouse lines to generate DGLαflx/flx/Cre<U+2212> (DGLαflx/flx) and D1-Cre+/DGLαflx/flx (DGLαD1-Cre+) or A2a-Cre+/DGLαflx/flx (DGLαA2A-Cre+) mice for experiments.  /n  Rescue: -  /n  Model Summary: These data suggest a role for 2-AG deficiency in social deficits and repetitive behavior, and demonstrate a key role for 2-AG in regulating striatal direct pathway MSNs.	lipoprotein lipase activity,triglyceride lipase activity,protein binding,lipase activity,hydrolase activity,metal ion binding	Ani
adgrl3.1	ADGRL3	protein-coding	Zebrafish	ENSDARG00000061121	lphn3|lphn3.1|si:ch211-209p5.2|wu:fj36g07	560631	Attention-Deficit/Hyperactivity Disorder	-	Knockdown	AB	29496512	487	Expeimentalparadigm: Locomotion test  /n  Model Generation: All experiments were performed on embryos of the AB zebrafish wildtype strain. We used an lphn3.1 splice morpholino oligonucleotide (MO) to block splicing at the exon2/intron2 boundary of lphn3.1 (sequence ATGTGAGTGTATCTCTGTACCTGAA).  /n  Rescue: We applied dopamine agonists (Apomorphine, Quinpirole, SKF-38393) and antagonists (Haloperidol, Eticlopride, SCH-23390) to Lphn3.1 morpholino-injected or control-injected animals. The percentage of change in locomotor activity was then determined at three different time periods (10-20 min, 30-40 min and 60-70 min). Our results show that drugs targeting dopamine receptors appear to elicit similar effects on locomotion in zebrafish larvae and mammals.  /n  Model Summary: Transient down-regulation of latrophilin3.1 (lphn3.1), the zebrafish LPHN3 homologue, causes hyperactivity. Zebrafish injected with a lphn3.1-specific morpholino are hyperactive and display an impairment in dopaminergic neuron development. In the present study we used lphn3.1 morphants to further characterize the changes to dopaminergic signaling that trigger hyperactivity.	transmembrane signaling receptor activity,G protein-coupled receptor activity,carbohydrate binding	Ani
Atf3	ATF3	protein-coding	Mus musculus	ENSMUSG00000026628	LRG-21	11910	Panic Disorder	1 H6|1 96.28 cM	Knockout	129SV;C57BL/6	29515366	488	Expeimentalparadigm: Locomotion test//Sensory function tests//Fear conditioning//Morris water maze//Radial arm maze  /n  Model Generation: C57BL/6J wild-type male mice, originally provided by the National Laboratory Animal Center, were purchased and maintained undisturbed in the Lab Animal Center at Tzu Chi University until the behavioral tasks were performed. The Atf3+/- and Atf3-/- mice, originally generated by T. Hai (Hartman et al., 2004) and provided by Dr. Hen Lin at Taipei Medical University, Taiwan, were used in the experiment. The Atf3-/- mice were generated in the 129SVJ background, which contained the clone of ATF3 gene. And the exon B of the Atf3 was replaced with Neomycin by direct targeting. Three primers were used in PCR for genotyping and differentiating knockout allele from wild-type allele: 5′-AGAGCTTCAGCAATGGTTTGC-3′ (primer 1), 5′-TGAAGAAGGTAAACACACCGTG-3′ (primer 2), and 5′-ATCAGCAGCCTCTGTTCCAC-3′ (primer 3). And the Atf3-/- mice were congenic in the background of C57BL/6 for 10 generations (Hartman et al., 2004; Li et al., 2010).  /n  Rescue: -  /n  Model Summary: Because activating transcription factor 3 (ATF3) is induced under stress conditions and is highly expressed in the hippocampus, we hypothesize that ATF3 plays a role in fear memory formation. We used fear conditioning and various other paradigms to test Atf3 knockout mice and study the role of ATF3 in processing fear memory. The results demonstrated that the lack of ATF3 specifically enhanced the expression of fear memory, which was indicated by a higher incidence of the freeze response after fear conditioning, whereas the occurrence of spatial memory including Morris Water Maze and radial arm maze remained unchanged. The enhanced freezing behavior and normal spatial memory of the Atf3 knockout mice resembles the fear response and numbing symptoms often exhibited by patients affected with posttraumatic stress disorder. Additionally, we determined that after fear conditioning, dendritic spine density was increased, and expression of Gelsolin, the gene encoding a severing protein for actin polymerization, was down-regulated in the bilateral hippocampi of the Atf3 knockout mice.	transcription cis-regulatory region binding,RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,identical protein binding,protein homodimerization activity,protein heterodimerization activity,sequence-specific double-stranded DNA binding	Ani
Slc6a3	SLC6A3	protein-coding	Rattus norvegicus	ENSRNOG00000017302	Dat1	24898	Obsessive Compulsive Disorder	1p11	Knockout	Wistar-Han	29520239	489	Expeimentalparadigm: Sucrose preference test//Exposure to a highly appetitive food//Intolerance-to-Delay Task  /n  Model Generation: These animals were obtained from Istituto Italiano di Tecnologia (IIT) (Genova, Italy), with the purpose of setting a colony at Istituto Superiore di Sanità (ISS) (Rome, Italy). Animals were born in IIT from the breeding of DAT–HET males and females, weaned on PND 21 and shipped to ISS at adult age  /n  Rescue: -  /n  Model Summary: During these tests, DAT KO rats appeared less sensitive to rewarding stimuli than wild-type (WT) and HET rats: they also showed a prominent hyperactive behavior with a rigid choice pattern and a wide number of compulsive stereotypies.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,monoamine transmembrane transporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Crbn	CRBN	protein-coding	Mus musculus	ENSMUSG00000005362	2610203G15Rik|2900045O07Rik|piL	58799	Cognitive Disorders	6|6 E1	Knockout	C57BL/6	29530986	490	Expeimentalparadigm: Passive avoidance test//Novel object recognition test//Elevated plus maze  /n  Model Generation: For generation of<U+00A0>Crbn<U+00A0>Knockout mice, heterozygous F1 animals were provided by the knocKnockoutut mouse service (Macrogen, Seoul, Knockoutrea). The targeting vector used to delete a segment containing exon 1 of the<U+00A0>Crbn<U+00A0>gene (1.1 kb) was constructed using a 5′ short arm fragment (2.6 kb) and a 3′ long arm fragment (7.3 kb), which were ligated into the pOsdupdel vector. The targeting vector was constructed by replacing the 1.1-kb genomic segment with the neomycin cassette. Heterozygous F1 animals were backcrossed with C57BL/6N mice over at least 10 generations before this study. Heterozygous males and females were then bred to produce<U+00A0>Crbn<U+00A0>Knockout mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: Here, we found that<U+00A0>Crbn<U+00A0>Knockout animals showed cognitive deficits caused by enhanced BK channel activity and reduced presynaptic glutamate release.	transmembrane transporter binding,metal ion binding	Ani
Gad1	GAD1	protein-coding	Mus musculus	ENSMUSG00000070880	EP10|Gad-1	14415	Attention-Deficit/Hyperactivity Disorder	2 C2|2 41.63 cM	Knockin	C57BL/6	29556956	491	Expeimentalparadigm: Locomotion test//Elevated plus maze  /n  Model Generation: Gad67-GFP+/<U+2212><U+00A0>and control mice were obtained from breeding<U+00A0>Gad67-GFP+/<U+2212><U+00A0>males or females to a GFP negative mate, yielding 50% offspring with the<U+00A0>Gad67-GFP<U+00A0>allele and 50% control offspring.  /n  Rescue: -  /n  Model Summary: We have examined whether mice with a disrupted Gad67 allele, the Gad67 GFP knock-in mice (Gad67-GFP+/<U+2212>), display abnormal locomotor behavior, or altered anxiety behavior on the elevated plus maze. We found that Gad67-GFP+/<U+2212> mice displayed a mild hyperactivity compared to control littermates.	catalytic activity,glutamate decarboxylase activity,glutamate binding,lyase activity,carbon-carbon lyase activity,carboxy-lyase activity,pyridoxal phosphate binding,identical protein binding,protein-containing complex binding,protein N-terminus binding	Ani
Gpr88	GPR88	protein-coding	Mus musculus	ENSMUSG00000068696	Strg	64378	Alcohol Use Disorder	3|3 G1	Knockout	C57BL/6J;129Sv	29580570	492	Expeimentalparadigm: Two-bottle choice paradigm//Open field test//Righting reflex//Conditioned place preference  /n  Model Generation: Gpr88 floxed mice (Gpr88fl/fl) were generated at the Institut Clinique de la Souris using Cre-LoxP technology. Briefly, exon 2 was flanked by loxP sites and a Lox-FRT neomycin-resistance cassette was inserted downstream exon 2 using homologous recombination (Figure 1A and Supplement 1). F1 heterozygous Gpr88fl/+ mice were bred with CMV-Flip mice in order to remove the neomycin cassette, and produce a conditional Gpr88 floxed line. For this study, we further created constitutive knocKnockoutut animals by breeding conditional animals with a general CMV-Cre driver line (16, 17). This led to germ-line deletion of Gpr88 exon 2 on a hybrid 50% C57BL/6J–50% 129Sv genetic background.  /n  Rescue: -  /n  Model Summary: Gpr88<U+00A0>deletion disrupts executive, reward and emotional networks in a configuration that reduces alcohol reward and promotes alcohol seeking and drinking. The FC signature is reminiscent of alterations observed in individuals at-risk for AUDs.	cytoskeletal motor activity,transmembrane signaling receptor activity,G protein-coupled receptor activity,G protein-coupled photoreceptor activity	Ani
shank3b	SHANK3	protein-coding	Zebrafish	ENSDARG00000063054	si:dkey-153k10.1	566152	Autism Spectrum Disorder	-	Knockout	Tübingen	29619162	493	Expeimentalparadigm: Larval activity//Light-dark test//Open field test//Shoaling test//Social preference test//Kin preference test  /n  Model Generation: The detailed procedure for CRISPR/Cas9 editing in zebrafish was described previously [21,<U+00A0>22]. The<U+00A0>shank3b<U+00A0>target in this study was 5′-GGGCGTGTTGTTGCCACGGCCGG-3′ (Additional<U+00A0>file<U+00A0>1: Table S1). Injection mixtures included 500<U+00A0>pg of Cas9 mRNA and 120<U+00A0>pg of gRNA. Eighty zebrafish were screened to identify a founder, and the germline mutation frequency was approximately 35%. Mutant sites were verified by comparison to the WT unaffected sequences (chimerism). Chimeric zebrafish were mated onto a Tu background for three generations to obtain<U+00A0>shank3b+/<U+2212><U+00A0>zebrafish. We crossed<U+00A0>shank3b+/<U+2212><U+00A0>males and<U+00A0>shank3b+/<U+2212><U+00A0>females to obtain<U+00A0>shank3b+/+,<U+00A0>shank3b+/<U+2212>, and<U+00A0>shank3b<U+2212>/<U+2212><U+00A0>littermates for all experiments of phenotypic analyses.  /n  Rescue: -  /n  Model Summary: We generated the first inheritable shank3b mutant zebrafish model using CRISPR/Cas9 gene editing approach. shank3b<U+2212>/<U+2212> zebrafish displayed robust autism-like behaviors and altered levels of the synaptic proteins homer1 and synaptophysin.	synaptic receptor adaptor activity,ionotropic glutamate receptor binding	Ani
Nos2	NOS2	protein-coding	Mus musculus	ENSMUSG00000020826	MAC-NOS|NOS-II|Nos-2|Nos2a|i-NOS|iNOS	18126	Trichotillomania	11 B5|11 46.74 cM	Knockout	C57BL6/j	29682419	494	Expeimentalparadigm: Locomotor activity//Repetitive behaviors  /n  Model Generation: Male and female NOS2 knocKnockoutut (NOS2 Knockout; matrixes purchased from Jackson Lab #2596, Bar Harbor, ME, USA), rederived into C57BL6/j background (WT, used as controls), were bred in the colony established in the Department of Genetics—Ribeir<U+00E3>o Preto School of Medicine at the University of S<U+00E3>o Paulo.  /n  Rescue: The expression of BB was attenuated by repeated treatment with clomipramine, a clinically approved drug to treat TTM in humans, or memantine, an antagonist of NMDA receptors, as well as partial rescue of NOS2 expression in haploinsufficient animals.<U+00A0>  /n  Model Summary: Inducible nitric oxide synthase (NOS2) knocKnockoutut mice as a model of trichotillomania	actin binding,nitric-oxide synthase activity,protein binding,calmodulin binding,beta-catenin binding,cAMP-dependent protein kinase regulator activity,FMN binding,oxidoreductase activity,protein kinase binding,heme binding,tetrahydrobiopterin binding,arginine binding,identical protein binding,protein homodimerization activity,cadherin binding,metal ion binding,flavin adenine dinucleotide binding,NADP binding,nitric-oxide synthase binding,Hsp90 protein binding	Ani
Shank3	SHANK3	protein-coding	Mus musculus	ENSMUSG00000022623	Spank-2|proSAP2	58234	Neurodevelopmental Disorders	15|15 E3	Conditional Knockout	B6.Cg-Tg (Drd1a-Cre)EY262Gsat/Mmcd, B6.Cg-Tg(Drd2-Cre)ER44Gsat/Mmcd	29700290	495	Expeimentalparadigm: Three-chamber social test//Sociability assay//Ultrasonic vocalizations//Self-grooming//Holeboard exploration//Startle response and prepulse inhibition//Elevated zero maze//Open field//Instrumental Learning//Conditioned fear//Rotarod  /n  Model Generation: Shank3 Δe4-22 mice were generated using CMV-Cre to delete Shank3 in the germ-line45. Drd1-Shank3 and Drd2-Shank3 mice were generated by crossing the e4-22flox/flox mice with dopamine (DA) D1 receptor (Drd1) Cre mice (B6.Cg-Tg (Drd1a-Cre)EY262Gsat/Mmcd) and DA D2 receptor (Drd2) Cre mice (B6.Cg-Tg(Drd2-Cre)ER44Gsat/Mmcd) [from The Gene Expression Nervous System Atlas (GENSAT) Project]48. Dlx5/6-Shank3 mice were generated by crossing e4-22flox/flox mice with Distaless5a/6a (Dlx5/6) Cre mice [Stock No. 008199; Jackson Laboratories, Bar Harbor, ME]49. NEX-Shank3 mice were generated by crossing e4-22flox/flox mice with NeuroD6 (NEX) Cre mice50. For each experiment, conditional knockout animals (Cre-positive, e4-22flox/flox) were compared to their own littermate control or “wild-type” animals (either Cre-negative e4-22flox/flox or Cre+e4-22). No differences were observed between these two genotypes from pilot data, so the genotypes were pooled into one control group for analysis. Drd1a-tdTomato mice were obtained from Dr. Nicole Calakos (Duke University, Durham, NC) and crossed to Drd1-Shank3 and Drd2-Shank3 mice for use in guiding the cell-type specific electrophysiological recordings. The natural Disc1 mutation in 129/SvEv mice was segregated from the Shank3 targeted mutation during the backcrossing+/+35.  /n  Rescue: -  /n  Model Summary: We generated mice with Shank3 selectively deleted in forebrain, striatum, and striatal D1 and D2 cells. These mice were used to interrogate the circuit/brain-region and cell-type specific role of Shank3 in the expression of autism-related behaviors. Whole-cell patch recording and biochemical analyses were used to study the synaptic function and molecular changes in specific brain regions. We found perseverative exploratory behaviors in mice with deletion of Shank3 in striatal inhibitory neurons. Conversely, self-grooming induced lesions were observed in mice with deletion of Shank3 in excitatory neurons of forebrain. However, social, communicative, and instrumental learning behaviors were largely unaffected in these mice, unlike what is seen in global Δe4-22 mice.	actin binding,protein binding,protein C-terminus binding,zinc ion binding,SH3 domain binding,synaptic receptor adaptor activity,ionotropic glutamate receptor binding,identical protein binding,protein self-association,protein-containing complex binding,scaffold protein binding,structural constituent of postsynaptic density	Ani
depdc5	DEPDC5	protein-coding	Zebrafish	ENSDARG00000078105	si:dkey-106l3.5	562995	Attention-Deficit/Hyperactivity Disorder	-	Knockdown	AB;TL	29761115	496	Expeimentalparadigm: Global activity measurements//Touch-evoked escape response (TEER) measurements  /n  Model Generation: Experiments were performed on wild-type embryos from AB and TL strains. Antisense Morpholino oligonucleotides (AMOs) (GeneTools Philomath, OR) were used to knockdown the expression of the sole orthologue of the DEPDC5 gene in zebrafish.  /n  Rescue: -  /n  Model Summary: Here we report a zebrafish model of Depdc5 loss-of-function that displays a measurable behavioral phenotype, including hyperkinesia, circular swimming, and increased neuronal activity. These phenotypic features persisted throughout embryonic development and were significantly reduced upon treatment with the mTORC1 inhibitor, rapamycin, as well as overexpression of human WT DEPDC5 transcript. No phenotypic rescue was obtained upon expression of epilepsy-associated DEPDC5 mutations (p.Arg487* and p.Arg485Gln), indicating that these mutations cause a loss of function of the protein.	GTPase activator activity	Ani
Fez1	FEZ1	protein-coding	Mus musculus	ENSMUSG00000032118	UNC-76|UNC76	235180	Attention-Deficit/Hyperactivity Disorder	9|9 A4	Knockout	C57BL/6J	29888233	497	Expeimentalparadigm: Locomotion test//Elevated plus maze//Cliff Avoidance test  /n  Model Generation: The<U+00A0>Fez1<U+00A0>locus was amplified by PCR from the genome of E14 (embryonic day 14) mouse ES cells with the use of LA-Taq<U+00A0>polymerase (TaKaRa). The targeting vector was constructed by the replacement of a 1.4-kb fragment of genomic DNA containing exon 2 of<U+00A0>Fez1<U+00A0>with a PGK-lox-neo-poly(A) cassette. The vector thus contained 1.6- and 6.5-kb regions of homology located at 5′ and 3′, respectively, relative to the neomycin resistance gene (neo). A PGK-tk-poly(A) cassette was ligated at the 3′ end of the targeting construct. The maintenance, transfection and selection of ES cells were performed as described previously (51). The recombination event was confirmed by Southern blot analysis with a 0.4-kb fragment of genomic DNA that flanked the 5′ homology region (Fig.<U+00A0>2A). The expected sizes of hybridizing fragments after digestion of genomic DNA with<U+00A0>BglII were 6.2 and 9.5 kb for the wild-type and mutant<U+00A0>Fez1<U+00A0>alleles, respectively. Mutant ES cells were microinjected into C57BL/6 blastocysts, and the resulting male chimeras were mated with female C57BL/6 mice.<U+00A0>  /n  Rescue: Which are ameliorated by administering methylphenidate (MPH) or guanfacine (GFC), two pharmacological agents used for ADHD treatment.  /n  Model Summary: Here, we report that mice deficient in<U+00A0>Fez1, a gene specifically expressed in the nervous system with documented functions in neurodevelopment, show hyperactivity and impulsivity phenotypes, which are ameliorated by administering methylphenidate (MPH) or guanfacine (GFC), two pharmacological agents used for ADHD treatment.	protein kinase C binding,protein binding,gamma-tubulin binding,protein N-terminus binding	Ani
Lrrc4	LRRC4	protein-coding	Mus musculus	ENSMUSG00000049939	MBAG1|NGL-2|NGL2|NLG-2|Nag14	192198	Autism Spectrum Disorder	6|6 A3.3	Mutated	129S5/Sv;C57BL/6	29949768	498	Expeimentalparadigm: Social interaction//Grooming//Three-chamber test//Ultrasonic vocalization//Light-dark box test//Morris water maze  /n  Model Generation: We received Lrrc4-/- mice from Mutant Mouse Resource and Research Center (MMRRC) (032443_UCD), which were generated using the 129S5/SvEvBrd-derived embryonic stem cell. The whole single exon was targeted by homologous recombination using the β-geo (lacZ/neo) cassette. The chimeric mice were crossed with C57BL/6-Tyrc-Brd albino mice to generate F1 generation, followed by backcrossing with C57BL/6N. Lrrc4-/- mice received from MMRRC were crossed with C57BL/6J for more than five generations to perform experiments.  /n  Rescue: -  /n  Model Summary: Here, we report that mice lacking NGL-2 (Lrrc4 mice) show suppressed N-Methyl-D-aspartate receptor (NMDAR)-dependent synaptic plasticity in the hippocampus. NGL-2 associates with NMDARs through both PSD-95-dependent and -independent mechanisms. Moreover, Lrrc4 mice display mild social interaction deficits and repetitive behaviors that are rapidly improved by pharmacological NMDAR activation. These results suggest that NGL-2 promotes synaptic stabilization of NMDARs, regulates NMDAR-dependent synaptic plasticity, and prevents autistic-like behaviors from developing in mice, supporting the hypothesis that NMDAR dysfunction contributes to autism spectrum disorders.	protein binding	Ani
Fgfr2	FGFR2	protein-coding	Mus musculus	ENSMUSG00000030849	Bek|Fgfr-2|Fgfr-7|Fgfr2b|Fgfr7|KGFR|KGFRTr|svs	14183	Autism Spectrum Disorder	7|7 F3	Knockdown	CD1;C57BL/6J<U+00A0>	30059965	499	Expeimentalparadigm: Ultrasonic vocalization analysis//Hot plate test//Social interaction//Self-grooming test  /n  Model Generation: For animals (CD1 mice) electroporated with the experimental siRNA (Negr1<U+00A0>siRNA or<U+00A0>Fgfr2<U+00A0>siRNA), littermates electroporated with control plasmids were used in the same session as controls. Negr1 siRNA-electroporated littermates were used as controls for the Negr1 siRNA/FGFR2cDNA animals. For<U+00A0>Negr1<U+2212>/<U+2212><U+00A0>animals, wild-type littermates were used as controls. The<U+00A0>Negr1<U+2212>/<U+2212><U+00A0>animals are in a C57BL6/J background.<U+00A0>  /n  Rescue: FGFR2 overexpression rescues all defects due to<U+00A0>Negr1<U+00A0>knockdown<U+00A0>in vivo  /n  Model Summary: We found that downregulation of the cell adhesion molecule NEGR1 or the receptor tyrosine kinase fibroblast growth factor receptor 2 (FGFR2) similarly affects neuronal migration and spine density during mouse cortical development<U+00A0>in vivo<U+00A0>and results in impaired core behaviours related to autism spectrum disorders.<U+00A0>	nucleotide binding,protein kinase activity,protein tyrosine kinase activity,transmembrane receptor protein tyrosine kinase activity,fibroblast growth factor receptor activity,protein binding,ATP binding,heparin binding,kinase activity,transferase activity,fibroblast growth factor binding,identical protein binding,protein homodimerization activity	Ani
Atxn7	ATXN7	protein-coding	Mus musculus	ENSMUSG00000021738	A430107N12Rik|Sca7|ataxin-7	246103	Attention-Deficit/Hyperactivity Disorder	14|14 A1	Overexpression	C57BL/6	30125623	500	Expeimentalparadigm: Open field test//Rotarod test//Y-maze test//Elevated plus maze test//Novel object recognition test//Delay-discounting task  /n  Model Generation: The full-length mouse<U+00A0>Atxn7a<U+00A0>open reading frame, containing<U+00A0>DrdI sites at either end, was cloned into the pEGFP-N3 vector driven by a neuron-specific enolase promoter (Fig. 1A). The expression cassette was prepared for microinjection by digesting the recombinant vector with<U+00A0>restriction enzymes. After microinjecting the transgene construct into the embryos of C57BL/6 mice, embryos were transferred into the pseudopregnant female<U+00A0>ICR mice.  /n  Rescue: Interestingly, treatment with the ADHD drug, atomoxetine (3<U+202F>mg/kg, intraperitoneal), attenuated ADHD-like behaviors and reduced Atxn7 gene expression in the PFC and STR of these mice.  /n  Model Summary: The Atxn7 OE mice show hyperactivity and impulsivity, but not inattention.The Atxn7 OE mice may represent the hyperactive-impulsive subtype of ADHD.	chromatin binding,protein binding	Ani
Kirrel3	KIRREL3	protein-coding	Mus musculus	ENSMUSG00000032036	1500010O20Rik|2900036G11Rik|NEPH2|SST4|mKIAA1867	67703	Neurodevelopmental Disorders	9|9 A4	Knockout	129 Sv/J;C57BL/6	30133126	501	Expeimentalparadigm: Homecage activity test//Open field test//Odor test//Startle test//Rotarod test//Object recognition test  /n  Model Generation: A conditional knockin mouse line of the<U+00A0>Neph2<U+00A0>locus was generated by homologous recombination in 129 Sv/J (129S7/SvEvBrd) embryonic stem cells. Briefly, exon 2 of the endogenous<U+00A0>Neph2<U+00A0>locus was replaced by a cDNA consisting of exon 2-17 flanked by loxP sites that was followed by an internal ribosomal entry site to enable expression of beta-galactosidase from the bacterial lacZ gene.18<U+00A0>Resulting chimaeras were tested for germline transmission, interbred with C57BL/6 mice and the positive selection neomycin/kanamycin cassette removed by mating with a flip-recombinase expressing mouse line. Resulting mice (Neph2flox/+) were then bred to a Cytomegalovirus (CMV)-promoter driven cre-transgenic mouse line in C57BL/6 background to generate a constitutive knockout (Neph2Δ/Δ, ie, Neph2flox/flox; CMV.cretg/+)  /n  Rescue: -  /n  Model Summary: Knockout mice display defects in auditory sensory processing, motor skills, and hyperactivity in the home-cage analysis. Olfactory, memory and metabolic testing did not differ from controls.<U+00A0>Neph2-knockout mice may provide a valuable rodent model for research on autism spectrum diseases and neurodevelopmental disorders.	protein binding,PDZ domain binding,cell adhesion molecule binding	Ani
Thrsp	THRSP	protein-coding	Mus musculus	ENSMUSG00000035686	S14|SPOT14	21835	Attention-Deficit/Hyperactivity Disorder	7|7 E1	Overexpression	C57BL/6;ICR	30138648	502	Expeimentalparadigm: Open-field test//Novel object recognition test//Y-maze test//Elevated plus maze test//Cliff avoidance test//Rotarod test//Delay-discounting task  /n  Model Generation: In brief,<U+00A0>THRSP<U+00A0>sequence information was obtained by conducting a<U+00A0>polymerase chain reaction<U+00A0>(PCR) with suitable primers on the brain tissue cDNA of C57BL/6 mice from the THRSP OE animal model.The obtained vector was cut with AfiIII/DrdI, and a linear transgene was prepared and microinjected into embryos of C57BL/6 mice; subsequently, this was transplanted into fertile female ICR mice.The identified four male mice were mated to C57BL/6J female to produce a transgenic mouse line.<U+00A0>  /n  Rescue: Treatment with methylphenidate (5<U+202F>mg/kg), the most commonly used medication for ADHD, improved attention and normalized expression levels of dopamine-related genes in THRSP OE mice.  /n  Model Summary: Thyroid-hormone responsive (THRSP) overexpressing (OE) mice exhibits inattention, but not hyperactivity and impulsivity.THRSP OE mice can be a potential mouse model for ADHD-inattentive type.	protein binding,identical protein binding,protein homodimerization activity,molecular function inhibitor activity	Ani
Rgs4	RGS4	protein-coding	Mus musculus	ENSMUSG00000038530	ESTM48|ESTM50	19736	Schizophrenia	1 H2.3|1 76.84 cM	Knockdown	C57BL/6J	30279737	503	Expeimentalparadigm: Open field test//Elevated plus-maze//Pre-pulse inhibition test//Social interaction test//A delayed non-match to place task//Nesting behavior test  /n  Model Generation: The full-length mouse RGS4 (clone ID NM_009062.3, GeneScript) was amplified in a reaction with Platinum Taq DNA polymerase (Invitrogen) and was subcloned into pAS2.EYFP.puro (National RNAi core facility, Academia Sinica, Taiwan) at the NheI and EcoRI sites. The construct was confirmed by DNA sequencing. Lentiviral vectors carrying short hairpin RNA (shRNA)-targeting mouse RGS4 (5′-CCGGGAAGTCAAGAAATGGGCTGAACTCGAGTTCAGCCCATTTCTTGACTTCTTTTTG-3′) and scrambled shRNA (http://rnai.genmed.sinica.edu.tw/file/vector/C6-7/17.1.pLAS.Void.pdf) were provided by National RNAi core facility, Academia Sinica in Taiwan. Lentiviral particles were generated by transiently cotransfecting 293T cells with the plasmids coding for RGS4, scrambled shRNA and shRNAs-targeting RGS4 in addition to plasmids encoding gag/pol and VSV-G envelope genes. Transfection was carried out with jetPEI reagent (Polyplus-Transfection). Organotypic brain-slices were infected with lentivirus in the presence of 8 μg/mL polybrene (Sigma-Aldrich). At 24 h post-infection, medium was removed and replaced with fresh growth medium containing puromycin (0.5 μg/mL) to select for infected cells 48 h post-infection.  /n  Rescue: -  /n  Model Summary: Genetic and pharmacological inhibition of RGS4 resulted in a significant decrease in SLC7A11 (xCT) expression and hypofunction of system xc- and reduced glutamatergic function in organotypic brain slice cultures. However, NAC restored the dysregulation of RGS4-mediated functional deficits of glutamate. Moreover, knockdown of RGS4 specifically in the prefrontal cortex caused mice to exhibit behaviors related to schizophrenia such as increased stereotypy, impaired prepulse inhibition, deficits in social interactions, working memory, and nesting behavior, while enhancing sensitivity to the locomotor stimulatory effect of MK-801. These mice displayed glutamatergic dysfunction in the prefrontal cortex, which may have contributed to the behavioral deficits. RGS4 knockdown mice that received NAC treatment had improved glutamatergic dysfunction and schizophrenia behaviors.	G-protein alpha-subunit binding,GTPase activator activity,protein kinase binding	Ani
Nuak1	NUAK1	protein-coding	Mus musculus	ENSMUSG00000020032	B230104P22Rik|Omphk1	77976	Autism Spectrum Disorder	10|10 C1	Conditional Knockout	C57BL/6J;Nuak1tm1Sia	30327473	504	Expeimentalparadigm: Open field test//Optomotor test of vision//Non-social and social odor olfactory test//Barnes maze//Social interaction test//Startle response and prepulse inhibition<U+00A0>  /n  Model Generation: Time-pregnant females were maintained in a 12h light/dark cycle and obtained by overnight breeding with males of the same strain. Noon following breeding was considered as E0.5. NUAK1+/- mice (Nuak1tm1Sia) were obtained from the Riken Institute20. Floxed NUAK1 mice were generated from targeted ES cells (Nuak1tm1a(KOMP)Wtsi) obtained from the KOMP Repository from UC Davis (https://www.komp.org/index.php, project ID CSD23401). Animals were maintained on a C57Bl/6J background.  /n  Rescue: -  /n  Model Summary: We report that Nuak1 is haploinsufficient in mice with regard to its function in cortical development. Furthermore Nuak1 mice show a combination of abnormal behavioral traits ranging from defective spatial memory consolidation, defects in social novelty (but not social preference) and abnormal sensorimotor gating. Overall, our results demonstrate that Nuak1 haploinsufficiency leads to defects in the development of cortical connectivity and a complex array of behavorial deficits.	nucleotide binding,p53 binding,protein kinase activity,protein serine/threonine kinase activity,ATP binding,kinase activity,transferase activity	Ani
LOC100430318	SHANK3	NA	Macaca fascicularis	NA	NA	NA	Autism Spectrum Disorder	NA	Gene Editing(CRISPR/Cas9)	Macaca fascicularis	30329048	505	Expeimentalparadigm: Behavioral observations//Social interaction test//Eye contact  /n  Model Generation: We used the Cas9/sgRNA method to disrupt SHANK3 gene in cynomolgus monkeys (Macaca fascicularis) following previous protocols8,9. SHANK3 has an array of mRNA isoforms due to multiple promoters and extensive alternative splicing of coding exons in both human and rodent, and this pattern is expected to be conserved in non-human primates5,10. We therefore simultaneously targeted two sites (exons 6 and 12) of SHANK3 to induce a large deletion (Figure 1A and Supplementary information, Figure S1A) that could completely disrupt all SHANK3 isoforms. We selected sgRNAs that showed high targeting efficiency for injection into monkey embryos.  /n  Rescue: -  /n  Model Summary: We have used clustered regularly interspersed short palindromic repeat/CRISPR-associated nuclease 9 to generate a cynomolgus monkey model by disrupting SHANK3 at exons 6 and 12. Analysis of the live mutant monkey revealed the core behavioral abnormalities of ASD, including impaired social interaction and repetitive behaviors, and reduced brain network activities detected by positron-emission computed tomography (PET). Importantly, these abnormal behaviors and brain activities were alleviated by the antidepressant fluoxetine treatment. Our findings provide the first demonstration that the genetically modified non-human primate can be used for translational research of therapeutics for ASD.	NA	Ani
Mir137	MIR137	ncRNA	Mus musculus	ENSMUSG00000065569	Mirn137|mir-137|mmu-mir-137	387155	Autism Spectrum Disorder	3|3 G1	Conditional Knockout	129S6/SvEvTac<U+00A0>	30397325	506	Expeimentalparadigm: Morris Water maze//Barnes maze test//Self-grooming test//Open field test//Social interaction test//Three-chamber test//Social discrimination test  /n  Model Generation: To generate miR-137 knockout mice, we designed a targeting vector to disrupt the<U+00A0>Mir137<U+00A0>gene via homologous recombination in mouse embryonic stem cells, where two loxP sites were inserted upstream (~2 kb) and downstream (~0.6 kb) of the<U+00A0>Mir137<U+00A0>gene, and derived mice carried the floxed allele of miR-137 (Fig. 1a). By crossing with either Zp3-Cre or Nestin-Cre line, we deleted<U+00A0>Mir137<U+00A0>in the germline or nervous system and generated the heterozygous miR-137 global knockout (gKO) and conditional knockout (cKO) mice (Fig. 1b).<U+00A0>  /n  Rescue: Treatment with the PDE10A inhibitor papaverine or knockdown of Pde10a ameliorates the deficits observed in the heterozygous cKO mice.  /n  Model Summary: Here we show the complete loss of miR-137 in the mouse germline (gKO) or nervous system (cKO) leads to postnatal lethality, while heterozygous gKO and cKO mice remain viable. Partial loss of miR-137 in heterozygous cKO mice results in dysregulated synaptic plasticity, repetitive behavior, and impaired learning and social behavior.<U+00A0>	NA	Ani
Setd5	SETD5	protein-coding	Mus musculus	ENSMUSG00000034269	2900045N06Rik|C330007C20|mKIAA1757	72895	Autism Spectrum Disorder	6|6 E3	Conditional Knockout	CMVCre (B6.C-Tg(CMV-cre)1Cgn/J), C57BL/6J	30455454	507	Expeimentalparadigm: Nesting behaviour//Open field test//Elevated plus maze task//Marble burying test//Social interaction test//Contextual fear conditioning task//Novel object location memory test//Memory testing in the Intellicage//Isolation-induced ultrasonic vocalisations in mouse pups  /n  Model Generation: Setd5tm1a(EUCOMM)Wtsi (International Mouse Phenotyping Consortium) mice were mated with homozygous Flip mice (Jackson Laboratories) to remove the NeoStop cassette. The resultant heterozygous Setd5+/loxP females (Supplementary Fig. 1a) were crossed with CMVCre (B6.C-Tg(CMV-cre)1Cgn/J) males to obtain Setd5+/- mice (Supplementary Fig. 1a). Setd5+/- mice were backcrossed to the N10 generation in C57BL/6J mice and used for our experiments. The Setd5GFP mouse has been described elsewhere9 and was kindly provided by M.A. Magnuson (Vanderbilt University, Nashville, TN).  /n  Rescue: -  /n  Model Summary: Here we show that Setd5-haploinsufficient mice present developmental defects such as abnormal brain-to-body weight ratios and neural crest defect-associated phenotypes. Furthermore, Setd5-mutant mice show impairments in cognitive tasks, enhanced long-term potentiation, delayed ontogenetic profile of ultrasonic vocalization, and behavioral inflexibility. Behavioral issues are accompanied by abnormal expression of postsynaptic density proteins previously associated with cognition. Our data additionally indicate that Setd5 regulates RNA polymerase II dynamics and gene transcription via its interaction with the Hdac3 and Paf1 complexes, findings potentially explaining the gene expression defects observed in Setd5-haploinsufficient mice. Our results emphasize the decisive role of Setd5 in a biological pathway found to be disrupted in humans with intellectual disability and autism spectrum disorder.	transcription corepressor activity,protein binding,methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,methylated histone binding,histone H3K9 methyltransferase activity,histone H3K36 methyltransferase activity	Ani
Slc6a3	SLC6A3	protein-coding	Rattus norvegicus	ENSRNOG00000017302	Dat1	24898	Attention-Deficit/Hyperactivity Disorder	1p11	Knockout	Wistar-Han	30472113	508	Expeimentalparadigm: Social preference task//Light-dark box test//Marble burying//Fear conditioning test  /n  Model Generation: The generation of Wistar-Han DAT knockout rats was previously described elsewhere [20], and these animals were intercrossed for >10 generations.  /n  Rescue: -  /n  Model Summary: We used recently developed DAT knockout (DAT-KO) rats to carry out further behavioral profiling on this novel model of hyperdopaminergia. DAT-KO rats display elevated locomotor activity and restless environmental exploration, associated with a transient anxiety profile. Furthermore, these rats show pronounced stereotypy and compulsive-like behavior at the Marble-Burying test.	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,monoamine transmembrane transporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Sh3rf2	SH3RF2	protein-coding	Mus musculus	ENSMUSG00000057719	2310046K19|9130023G24Rik|Ppp1r39|RNF158	269016	Autism Spectrum Disorder	18|18 B3	Knockout	Thy1-GFP line-M, C57BL/6	30540932	509	Expeimentalparadigm: Three-chamber test//Free dyadic social interaction//Nest building test//Olfactory//Ultrasonic vocalization in isolation pulps//Interaction-induced ultrasonic vocalization//Behaviors in novel cage and home cage//Rearing in novel cage and home cage//Marble burying test  /n  Model Generation: All genotypes were produced by mating heterozygous mice. To obtain green fluorescent protein (GFP) labeled neurons, Thy1-GFP line-M transgenic mice in a C57BL6 background (a kind gift from Yi Zuo, Tsinghua University) were interbred with Sh3rf2+/- mice to produce GFP+/- / Sh3rf2, GFP+/++/- / Sh3rf2+/- and GFP+/- / Sh3rf2-/- mice. The primers were used for genotyping of GFP sequences are Thy1-GFP-F and Thy1-GFP-R. The mouse Sh3rf2 genomic DNA (10.5 kb) was obtained from a C57BL/6 BAC clone. To disrupt the gene, the targeting vector construct was designed to replace exon1 (excludes 5′UTR) which codes for the first 126 residues (378 bp) with nLacZ-SV40-polyA and the neomycin resistance gene. By this approach, the endogenous translational initiation codon (ATG) was used and reporter gene (nLacZ) was introduced at the same time (Figure S1A). The vector was linearized before electroporation into C57BL/6-derived ES cells. Positive clones were verified by Southern blotting (Figures S1C and S1D) and submitted to blastocyst injection to generate heterozygous Sh3rf2 (Sh3rf2+/-) mice. F1 offspring were chimeric and were backcrossed to C57BL/6 to allow proper genetic separation of both alleles.  /n  Rescue: -  /n  Model Summary: Here, we generate mice lacking one copy of Sh3rf2, which was detected in ASD patients, to determine whether Sh3rf2 is involved in brain development and whether mutation of SH3RF2 is causative for ASD and the mechanisms linking it to ASD traits. We find that mice with Sh3rf2 haploinsufficiency display significant deficits in social interaction and communication, as well as stereotyped or repetitive behaviors and hyperactivity and seizures.	protein phosphatase inhibitor activity,protein phosphatase 1 binding,transferase activity,phosphatase binding,metal ion binding,ubiquitin protein ligase activity	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Neurodevelopmental Disorders	4 D2.2|4 61.33 cM	Knockout	C57BL/6	30587851	510	Expeimentalparadigm: Compulsive grooming assessment//Locomotor activity//Reversal learning  /n  Model Generation: Sapap3-KOs and WT littermates were maintained on C57BL/6 background, and were derived from a colony initially established at MIT by Dr. Guoping Feng [20]. SAPAP3 knockout mice were generated by homologous recombination in R1 embryonic stem cells using standard procedures. A targeting vector was designed to replace exon 3 (containing the translation initiation codon) of the SAPAP3 gene with a NEO cassette. Genotypes were determined by PCR of mouse tail DNA, using primer F1 (ATTGGTAGGCAATACCAACAGG) and R1 (GCAAAGGCTCTTCATATTGTTGG) for the wildtype allele (147 base pairs), and F1 and R2 (CTTTGTGGTTCTAAGTACTGTGG; in neo cassette) for the mutant allele (223 base pairs).  /n  Rescue: -  /n  Model Summary: To investigate the relationship between cortico-striatal circuit disturbances and cognitive functioning relevant to OCD, Sapap3 knockout mice (KOs) and littermate controls were tested in an instrumental reversal-learning paradigm to assess cognitive flexibility. These findings suggest that increased neural activity in mPFC is associated with impaired reversal learning in Sapap3-KOs, providing a likely neural basis for this observed heterogeneity. The Sapap3-KO model is thus a useful tool for future mechanistic studies to determine how mPFC hyperactivity contributes to OCD-relevant cognitive dysfunction.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Sema3f	SEMA3F	protein-coding	Mus musculus	ENSMUSG00000034684	Sema4|Semak	20350	Autism Spectrum Disorder	9|9 F1	Conditional Knockout	C57BL/6J	30635860	511	Expeimentalparadigm: Three-chamber test//Home cage monitoring//Open field test//Marble burying test  /n  Model Generation: We received conditional semaphorin 3F heterozygotes (Sema 3FF/+; one of the two Sema 3F alleles was the floxed Sema 3F transgene) from Dr. Alex Kolodkin (Johns Hopkins University) on a C57BL/6J genetic background [33]. The DLX5/6Cre heterozygotes (DLX5/6Cre/+, one of the two alleles was the DLX5/6Cre transgene; referred to hereafter as DLX5/6Cre targeting to GABAergic inhibitory neurons) from Jackson Laboratory are maintained on a mixed FVB/NJ and C57BL/6J genetic background [48, 49]. The EMX1Cre heterozygotes from Jackson Laboratory (EMX1Cre/+, one of the two alleles was the EMX1Cre transgene; referred to hereafter as EMX1Cre targeting to excitatory neurons) are maintained on a C57BL/6J genetic background [50]. The animals were backcrossed five generations; each time, a heterozygous male was mated with a pure C57/BL/6J wild-type female (Jackson Laboratory colony). Cre heterozygotes-Sema 3FF/+ were mated together to produce homozygous Cre-Sema 3FF/F mice. Genotypes were obtained at birth in the appropriate proportions. After obtaining tail DNA, PCR genotyping of each mouse was performed according to previously published protocols [18]. Handling-induced seizures, status epilepticus, and/or death were noted only in mice with either DLX5/6Cre-Sema 3FF/+ or DLX5/6Cre-Sema 3FF/F genotypes. No epileptic events were noted among the EMX1Cre-Sema 3FF/F mice.  /n  Rescue: -  /n  Model Summary: Genome-wide association and other genetic studies have implicated at least 500+ genes associated with the occurrence of autism spectrum disorders (ASD) including the human semaphorin 3F (Sema 3F) and neuropilin 2 (NRP2) genes. However, the genetic basis of the comorbid occurrence of autism and epilepsy is unknown. The aberrant development of GABAergic circuitry is a possible risk factor in autism and epilepsy. Molecular biological approaches were used to test the hypothesis that cell-specific genetic variation in mouse homologs affects the formation and function of GABAergic circuitry. The empirical analysis with mice homozygous null for one of these genes, Sema 3F, in GABAergic neurons substantiated these predictions.	semaphorin receptor binding,chemorepellent activity	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Obsessive Compulsive Disorder	4 D2.2|4 61.33 cM	Knockout	NA	30688005	512	Expeimentalparadigm: Open field test//Elevated plus maze//Pavlovian conditioning  /n  Model Generation: SAPAP3-/- mice were donated by the Feng laboratory.7 SAPAP3 knockout mice were generated by homologous recombination in R1 embryonic stem cells using standard procedures.  /n  Rescue: -  /n  Model Summary: SAPAP3 and wild-type (WT) littermates were trained in a Pavlovian conditioning task pairing visual cues with the delivery of sucrose solution. After mice learned to discriminate between a reward-predicting conditioned stimulus (CS+) and a non-reward stimulus (CS-), contingencies were reversed (CS+ became CS- and vice versa). Additionally, we assessed grooming, anxiety and general activity. SAPAP3 acquired Pavlovian approach behavior similarly to WT, albeit less vigorously and with a different strategy. However, unlike WT, SAPAP3 were unable to adapt their behavior after contingency reversal, exemplified by a lack of re-establishing CS+ approach behavior (sign tracking). Surprisingly, such behavioral inflexibility, decreased vigor, compulsive grooming and anxiety were unrelated.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Obsessive Compulsive Disorder	4 D2.2|4 61.33 cM	Knockout	C57BL/6	30737313	513	Expeimentalparadigm: Grooming  /n  Model Generation: Male and female Sapap3-KOs and WT littermates were maintained on C57BL/6 background and were derived from a colony initially established at Massachusetts Institute of Technology by Dr. Guoping Feng. For identification of FSIs, Sapap3-heterozygous (Sapap3-het) mice were bred with Sapap3-het::parvalbumin (PV)-cre mice to generate Sapap3-KO and WT littermates that were PV-cre hemizygous (see Fig. 1). PV-cre mice were derived from a mouse knockin of Cre recombinase directed by the PV promotor/enhancer (Pvalbtm1(cre)Arbr, The Jackson Laboratory; RRID:IMSR_JAX:017320).  /n  Rescue: -  /n  Model Summary: To investigate the cellular and synaptic abnormalities that may underlie corticostriatal dysfunction relevant to OCD, we used the Sapap3 knock-out (Sapap3-KO) mouse model of compulsive behaviors, which also exhibits hyperactivity in central striatum. Ex vivo electrophysiology in double-transgenic mice was used to assess intrinsic excitability and functional synaptic input in spiny projection neurons (SPNs) and fast-spiking interneurons (FSIs) in central striatum of Sapap3-KOs and wild-type (WT) littermates. While we found no differences in intrinsic excitability of SPNs or FSIs between Sapap3-KOs and WTs, excitatory drive to FSIs was significantly increased in KOs. Contrary to predictions, lateral orbitofrontal cortex-striatal synapses were not responsible for this increased drive; optogenetic stimulation revealed that lateral orbitofrontal cortex input to SPNs was reduced in KOs (3-fold) and unchanged in FSIs. However, secondary motor area (M2) postsynaptic responses in central striatum were significantly increased (6-fold) in strength and reliability in KOs relative to WTs. These results suggest that increased M2-striatal drive may contribute to both in vivo striatal hyperactivity and compulsive behaviors, and support a potential role for presupplementary/supplementary motor cortical regions in the pathology and treatment of compulsive behavior disorders.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
DAT	SLC6A3	protein-coding	Drosophila melanogaster		CG8380|Dat|DmDAT|Dmel\CG8380|Fumin|dDAT|dat|fmn|fumin	36849	Autism Spectrum Disorder	53C7-53C8|2-80 cM	Knockout	Bloomington Indiana (BI) 6326	30755521	514	Expeimentalparadigm: Locomotion test//Escape-response behavioral  /n  Model Generation: Drosophila<U+00A0>homozygotes for the DAT-null allele<U+00A0>DATfmn<U+00A0>(dDAT KO) (36) and flies harboring TH-Gal4 (37) were outcrossed to a control line [Bloomington Indiana (BI) 6326)]and selected by PCR or eye color. TH-GAL4 (Bl 8848) and M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP′} ZH-22A (Bl 24481) were obtained from the BI stock center and outcrossed to dDAT KO flies carrying the<U+00A0>white<U+00A0>(w1118) mutation (BI stock no. 6236) for five to five to 10 generations. Transgenes (hDAT or hDAT <U+2206>N336) were cloned into pBI-UASC (38), and constructs were injected into embryos from M{vas-int.Dm}ZH-2A, M{3xP3-RFP.attP′}ZH-22A (Bl 24481). Initial potential transformants were isolated and selected.  /n  Rescue: -  /n  Model Summary: we uncovered a conformational state of the transporter promoted by <U+2206>N336. It is defined by a “half-open and inward-facing” conformation of the intracellular gate that leads to specific dysfunctions in DA homeostasis as determined in the brain of<U+00A0>Drosophila melanogaster<U+00A0>expressing hDAT <U+2206>N336. Importantly, hDAT <U+2206>N336 flies display increased fear and impaired social interactions, traits associated with DA dysfunction and ASD.	dopamine:sodium symporter activity,cocaine binding	Ani
Slc1a1	SLC1A1	protein-coding	Mus musculus	ENSMUSG00000024935	D130048G10Rik|EAAC1|EAAC2|EAAT3|MEAAC1	20510	Obsessive Compulsive Disorder	19|19 C1	Transgene	C57BL/6J	30787427	515	Expeimentalparadigm: Open field test//Light–dark box test//Marble burying test//Grooming//Touchscreen-based visual discrimination task and reversal learning //Fear conditioning test  /n  Model Generation: The pCLE-EAAT3 vector was engineered to achieve Cre-dependent EAAT3 expression as described in Methods and materials (Fig. 1a). Cotransfection experiments in neuroblastoma N2A cells with pCLE-EAAT3 alone or with pCMV-Cre vector showed that EAAT3 expression increased only in the presence of Cre (Fig. 1b). Increased glutamate uptake activity was found only when pCLE-EAAT3 was co-transfected with pCMV-Cre (Fig. 1c), strongly indicating that pCLE-EAAT3 vector drives Cre-dependent and functional EAAT3 expression. Then, we injected a linearized pCLE-EAAT3 vector into FVB/N zygotes to generate EAAT3glo mice. Ten pups were obtained from 4 recipient females that were transplanted with the injected zygotes. Founder lines were identified upon GFP visualization (Fig. 1d) and confirmed by PCR (Fig. 1f). Three founder lines were established and confirmed for integration of the pCLE-EAAT3 vector using Southern blot (Fig. 1e). Then, the C6 founder line was expanded by cross-breeding with wild-type mice. EAAT3glo mice were born healthy, viable, and fertile, with no gross neurological alterations or any signs of adverse effects of transgene integration (Table S1). At least seven crosses with wild-type C57BL/6J mice were performed prior to molecular and behavioral analyses.  /n  Rescue: -  /n  Model Summary: We generated a transgenic mouse model (EAAT3glo) to achieve conditional, Cre-dependent EAAT3 overexpression and evaluated the overall impact of increased EAAT3 expression at behavioral and synaptic levels. Mice with EAAT3 overexpression driven by CaMKIIα-promoter (EAAT3glo/CMKII) displayed increased anxiety-like and repetitive behaviors that were both restored by chronic, but not acute, treatment with fluoxetine or clomipramine. EAAT3glo/CMKII mice also displayed greater spontaneous recovery of conditioned fear.	anion channel activity,L-glutamate transmembrane transporter activity,high-affinity L-glutamate transmembrane transporter activity,protein binding,chloride transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,L-aspartate transmembrane transporter activity,symporter activity,glutamate:sodium symporter activity,glutamate binding,cysteine transmembrane transporter activity,identical protein binding,metal ion binding,D-aspartate transmembrane transporter activity	Ani
Drd4	DRD4	protein-coding	Mus musculus	ENSMUSG00000025496	D4R|Drd-4	13491	Attention-Deficit/Hyperactivity Disorder	7 F5|7 86.6 cM	Knockout	NA	30797855	516	Expeimentalparadigm: Cocaine Conditioned place preference  /n  Model Generation: Young adult (10–22 weeks) male and female DRD4 wild type (WT), HT, and KO mice (n=20/group), were housed individually under standard laboratory conditions and a 12-h reverse light-dark cycle (lights off at 0600). Mice were bred in our lab as previously described [54].  /n  Rescue: -  /n  Model Summary: Results revealed that all mice, regardless of sex or genotype, developed a similar acquisition for a cocaine place preference. Female DRD4 KO mice failed to extinguish their preference for the cocaine-paired chamber following the extinction period. Male DRD4 KO mice failed to reinstate their preference after a priming dose following successful extinction. No differences in locomotor activity were observed within drug treatment conditions due to genotype, and female mice displayed reduced locomotor activity during CPP conditioning compared to male mice. The observed effects illustrate the role DRD4 gene expression has on extinction and reinstatement, but not acquisition, of cocaine-seeking behavior.	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,G protein-coupled serotonin receptor activity,SH3 domain binding,neurotransmitter receptor activity,dopamine binding,identical protein binding,metal ion binding,epinephrine binding,norepinephrine binding,heterocyclic compound binding	Ani
Iqsec2	IQSEC2	protein-coding	Mus musculus	ENSMUSG00000041115	Brag1	245666	Autism Spectrum Disorder	X F3|X 68.46 cM	Gene Editing(CRISPR/Cas9)	C57BL/6J	30842726	517	Expeimentalparadigm: Open field test//Rotarod//Three-chamber test//Morris water maze  /n  Model Generation: Mice were generated by CRISPR at Applied Stem Cells (Milpitas, CA, United States). We targeted murine IQSEC2 (NM_001005475.2) with the goal of generating an A350V mutation identical to that found in the human index case in which the codon GCT (Ala) at amino acid 350 is mutated to GTT (Val) with an additional AGG to CGT silent mutation (R349) in order to prevent the guide RNA g20 GGCAGCCCTGCGGCTCAGGA from targeting the same allele after repair. A single stranded oligonucleotide donor (ssODN) was synthesized with two homology arms flanking the GCT to GTT mutation site (5′CTGAGCT GCGCAGCCGCTCAAAGTTCTTATTCATACGGTACTGTCG AAAGGCTGTCTGGATGGTCCTGGCAACACGGCGGCTCA GGAAGGAGCCCCCATACTTCCTCTCCAGCATTTCCACCT GTCAGAGGAACAAGTTCAGAAAG3′) serving as the repair template during the process of homology directed repair (HDR). Synthesized ssODN donor, g20 gRNA transcripts and Cas9 mRNA were microinjected into the cytoplasm of C57BL/6J embryos. Identification of F0 successfully targeted mice were identified by Sanger sequencing. Germline transmitted F1s containing the mutation were used to generate the A350V colony used for all additional studies and continued breeding of the mice was done in a C57Bl/6J background.  /n  Rescue: -  /n  Model Summary: We demonstrate here that the A350V mutation results in interference with the binding of apocalmodulin to the IQ domain of IQSEC2. We further demonstrate that this mutation results in constitutive activation of the guanine nucleotide exchange factor (GEF) activity of IQSEC2 resulting in increased production of the active form of Arf6. In a CRISPR generated mouse model of the A350V IQSEC2 mutation, we demonstrate that the surface expression of GluA2 AMPA receptors in mouse hippocampal tissue was significantly reduced in A350V IQSEC2 mutant mice compared to wild type IQSEC2 mice and that there is a significant reduction in basal synaptic transmission in the hippocampus of A350V IQSEC2 mice compared to wild type IQSEC2 mice. Finally, the A350V IQSEC2 mice demonstrated increased activity, abnormal social behavior and learning as compared to wild type IQSEC2 mice. These findings suggest a model of how the A350V mutation in IQSEC2 may mediate disease with implications for targets for drug therapy.	guanyl-nucleotide exchange factor activity,protein binding	Ani
Adgrl3	ADGRL3	protein-coding	Mus musculus	ENSMUSG00000037605	5430402I23Rik|CIRL-3|D130075K09Rik|Gm1379|LEC3|Lphn3|mKIAA0768	319387	Attention-Deficit/Hyperactivity Disorder	5|5 D- E1	Knockout	C57BL/6J	30849401	518	Expeimentalparadigm: Light-dark box test//Open field test//Gait analysis//Novel object recognition task//Barnes maze//Social interaction test//Resident-intruder assay//Continuous performance test  /n  Model Generation: The transgenic mouse line used in this manuscript has already been described in detail in (Wallis et al., 2012). Frozen sperm from Adgrl3-/- mice (B6; 129S4-Lphn3Gt (FHCRC-GT-S17-5H1)Sor) was transferred from Texas A&M Institute for Genomic Medicine (Mutant Mouse Regional Resource Centers) and re-derived by in vitro fertilization and implantation in C57BL/6J dams at the Centre for Experimental Molecular Medicine (ZEMM), University of Würzburg. In order to confirm the deletion of ADGRL3, we measured protein levels in the mouse brain by Western Blot.  /n  Rescue: -  /n  Model Summary: In this study, we examined the characteristics of Adgrl3-deficient mice in multiple behavioural domains related to ADHD: locomotive activity, impulsivity, gait, visuospatial and recognition memory, sociability, anxiety-like behaviour and aggression. Additionally, we investigated the effect of Adgrl3-depletion at the transcriptomic level by RNA-sequencing three ADHD-relevant brain regions: prefrontal cortex (PFC), hippocampus and striatum. Adgrl3 mice show increased locomotive activity across all tests and subtle gait abnormalities. These mice also show impairments across spatial memory and learning domains, alongside increased levels of impulsivity and sociability with decreased aggression. However, these alterations were absent in Adgrl3 mice. Our study further validates Adgrl3 constitutive knockout mice as an experimental model of ADHD while providing neuroanatomical targets for future studies involving ADGRL3 modified models.	transmembrane signaling receptor activity,G protein-coupled receptor activity,calcium ion binding,protein binding,carbohydrate binding,metal ion binding	Ani
Ywhag	YWHAG	protein-coding	Mus musculus	ENSMUSG00000051391	14-3-3gamma|D7Bwg1348e	22628	Attention-Deficit/Hyperactivity Disorder	5|5 G2	Knockout	C57BL/6	30853823	519	Expeimentalparadigm: Open field test//Elevated plus maze test//Light-dark box test//Social interaction test//Rotarod test//Acute stress (restraint stress)  /n  Model Generation: Transgenic ywhag mouse (CARD ID 1461) were generated by a group at Kumamoto University. In brief, exchangeable gene trap pU-21W vector was used for random gene trap mutagenesis. pU-21W is a promoter trap vector with three stop codons which were arranged in upstream of the ATG of the 尾-galactosidase (尾-geo) in all three frames [30]. The strain name is depicted as B6;CB-YwhagGt (pU-21W)266Card, and the website address of the Database for the Exchange of Gene Trap Clones is聽http://egtc.jp/action/access/clone_detail?id=21-W266.  /n  Rescue: -  /n  Model Summary: Here, by using 14-3-3γ  deficient mice, we found that homozygous knockout mice were prenatally lethal, and heterozygous mice showed developmental delay relative to wild-type littermate mice. In addition, in behavioral analyses, we found that 14-3-3纬 heterozygote mice display hyperactive and depressive-like behavior along with more sensitive responses to acute stress than littermate control mice.聽	protein kinase C binding,insulin-like growth factor receptor binding,protein binding,protein domain specific binding,receptor tyrosine kinase binding,identical protein binding	Ani
Gucy2c	GUCY2C	protein-coding	Mus musculus	ENSMUSG00000042638	GC-C|Gcc	14917	Cognitive Disorders	6 G1|6 66.67 cM	Knockout	C57BL/6J	30953414	520	Expeimentalparadigm: Elevated zero maze//Novel object recognition//Morris water maze//Learning trials with the hidden platform //Acoustic and tactile startle//Conditioned fear test  /n  Model Generation: -  /n  Rescue: -  /n  Model Summary: The data indicate that the GC-C KO mouse with proper controls and sample sizes has a moderate cognitive and startle phenotype but has no ADHD-like phenotype.	nucleotide binding,peptide receptor activity,guanylate cyclase activity,protein kinase activity,ATP binding,GTP binding,toxic substance binding,lyase activity,phosphorus-oxygen lyase activity,natriuretic peptide receptor activity,peptide hormone binding	Ani
Adgrl3	ADGRL3	protein-coding	Rattus norvegicus	ENSRNOG00000030149	CIRL-3|Cirl3|Lec3|Lphn3	170641	Attention-Deficit/Hyperactivity Disorder	14p21	Knockout	Sprague Dawley	31176715	521	Expeimentalparadigm: Homecage activity test//Elevated Zero Maze//Startle Response//Open field with amphetamine challenge  /n  Model Generation: Generation of<U+00A0>Lphn3<U+00A0>KO rats<U+00A0>Lphn3<U+2212>/<U+2212><U+00A0>(knockout) rats on a Sprague-Dawley (SD-IGS, strain 001, Charles River, Charleston, NC) background were generated in the Cincinnati Children’s Transgenic Animal and Genome Editing Core using CRISPR/Cas9 to delete exon 3 (Fig. 1A).<U+00A0>  /n  Rescue: -  /n  Model Summary: Knockout of<U+00A0>latrophilin-3<U+00A0>in Sprague-Dawley rats causes hyperactivity, hyper-reactivity, under-response to amphetamine, and disrupted dopamine markers	G protein-coupled receptor activity,calcium ion binding,carbohydrate binding	Ani
LOC100430318	SHANK3	NA	Macaca fascicularis	NA	NA	NA	Neurodevelopmental Disorders	NA	Gene Editing(CRISPR/Cas9)	Macaca fascicularis	31189958	522	Expeimentalparadigm: Sleep monitoring//Behaviour scoring during social interaction//Movement tracking during habituation and social interaction  /n  Model Generation: Selected gRNAs that target exon 21 of macaque SHANK3 were cloned into the pU6-gRNA expression plasmid separately, using the two BbsI restriction sites. Sequence-verified gRNA-expressing plasmids were individually co-electroporated into primary cultured fibroblast cells together with wild-type SpCas9-expressing plasmid (Primate Biologicals) and cultured for 48 h using dermal fibroblast culture medium (Zenbio). Cells were collected, and total genomic DNA was extracted using a NucleoSpin tissue kit (Macherey-Nagel). An amplicon of 700 bp flanking the targeted mutation region of SHANK3 was amplified from each DNA sample, followed by analysis using a standard surveyor nuclease-based mutation detection assay as described in the user manual (IDTDNA). To prepare CRISPR mRNAs for embryo injection, guide RNA no. 1 and no.2, and wild-type SpCas9-expressing plasmid, were linearized and transcribed with commercial kits (MEGAscript T7 (Ambion) and HiScribe T7 (NEB)). Synthesized mRNA was further purified with MEGAclear Transcription clean-up kit (Ambion) and quantified with Nanodrop 2000 (Thermo Fisher). Monkey embryos injected with SHANK3 CRISPR mRNA were cultured for 5 to 7 days and collected individually, lysed with protease K; this was followed by nested PCR-based genotyping of 300-bp amplicons using two sets of primers. Primer set I forward: 5′-gacccctgtttgtggatgtacagg-3′; reverse: 5′-cctggcccggggtctgctggggtgccgc-3′; primer set II forward: 5′-ggtccctggcttccccggccttctcc-3′; reverse: 5′-gctgggcaggggctctgccacagctgc-3′. The presence of indels in the injected embryos was revealed by electrophoresis-based separation on 4% agarose gel and subsequent Sanger sequencing of the PCR product.  /n  Rescue: -  /n  Model Summary: Here we report CRISPR-Cas9-mediated generation of germline-transmissible mutations of SHANK3 in cynomolgus macaques (Macaca fascicularis) and their F1 offspring. Genotyping of somatic cells as well as brain biopsies confirmed mutations in the SHANK3 gene and reduced levels of SHANK3 protein in these macaques. Analysis of data from functional magnetic resonance imaging revealed altered local and global connectivity patterns that were indicative of circuit abnormalities. The founder mutants exhibited sleep disturbances, motor deficits and increased repetitive behaviours, as well as social and learning impairments.	NA	Ani
Oprm1	OPRM1	protein-coding	Mus musculus	ENSMUSG00000000766	M-OR-1|MOP-R|MOR-1|MOR-1O|Oprm|mor|muOR	18390	Restless Legs Syndrome	10 A1|10 1.85 cM	Triple Knockout	NA	31376441	523	Expeimentalparadigm: Open field  /n  Model Generation: The triple knockout (KO) mice were generated from mu opioid receptor, delta opioid receptor and kappa opioid receptor KO mice imported from the Jackson Laboratory (Stock Nos: 007559, 007557 and 007558, respectively). Wild type (WT) mice were age-matched non-littermates in the same genetic background.  /n  Rescue: -  /n  Model Summary: Our findings support the role of endogenous opioids in the pathogenesis of RLS, and the triple KO mice can be used to understand the relationship between iron deficiency, anemia, dopaminergic dysfunction, and RLS.	G-protein alpha-subunit binding,G protein-coupled receptor activity,beta-endorphin receptor activity,G protein-coupled opioid receptor activity,voltage-gated calcium channel activity,protein binding,protein C-terminus binding,protein domain specific binding,filamin binding,G-protein beta-subunit binding,morphine receptor activity,peptide binding,neuropeptide binding	Ani
Oprk1	OPRK1	protein-coding	Mus musculus	ENSMUSG00000025905	K-OR-1|KOR|KOR-1|MSL-1|Oprk2|R21	18387	Restless Legs Syndrome	1 A1|1 1.89 cM	Triple Knockout	NA	31376441	524	Expeimentalparadigm: Open field  /n  Model Generation: The triple knockout (KO) mice were generated from mu opioid receptor, delta opioid receptor and kappa opioid receptor KO mice imported from the Jackson Laboratory (Stock Nos: 007559, 007557 and 007558, respectively). Wild type (WT) mice were age-matched non-littermates in the same genetic background.  /n  Rescue: -  /n  Model Summary: Our findings support the role of endogenous opioids in the pathogenesis of RLS, and the triple KO mice can be used to understand the relationship between iron deficiency, anemia, dopaminergic dysfunction, and RLS.	G protein-coupled receptor activity,G protein-coupled opioid receptor activity,receptor serine/threonine kinase binding,dynorphin receptor activity,peptide binding,neuropeptide binding	Ani
Dlgap3	DLGAP3	protein-coding	Mus musculus	ENSMUSG00000042388	DAP-3|DAP3|Prpl8|Sapap3	242667	Neurodevelopmental Disorders	4 D2.2|4 61.33 cM	Knockout	C57BL/6J	31427755	525	Expeimentalparadigm: Sucrose solution-water choice test//Locomotor activity//Grooming  /n  Model Generation: Sapap3-mutant mice were obtained from Dr. Gouping Feng (Massachusetts Institute of Technology). The mice were backcrossed on a C57BL/6J background for >20 generations. SAPAP3 knockout mice were generated by homologous recombination in R1 embryonic stem cells using standard procedures. A targeting vector was designed to replace exon 3 (containing the translation initiation codon) of the SAPAP3 gene with a NEO cassette. Genotypes were determined by PCR of mouse tail DNA, using primer F1 (ATTGGTAGGCAATACCAACAGG) and R1 (GCAAAGGCTCTTCATATTGTTGG) for the wildtype allele (147 base pairs), and F1 and R2 (CTTTGTGGTTCTAAGTACTGTGG; in neo cassette) for the mutant allele (222 base pairs).  /n  Rescue: -  /n  Model Summary: The present study used the Sapap3-knockout (KO) mouse model of OCD to assess habit formation based on reward devaluation. We also tested wildtype mice under different training and food-restriction schedules to assess the extent of natural habit formation. We found that Sapap3-KO mice were insensitive to the devaluation of a sucrose reward under conditions in which wildtype littermates were sensitive to devaluation. Moreover, food restriction favored goal-directed action in wildtype mice, whereas mice that were fed ad libitum were more likely to form habitual behavior but nevertheless maintained partly goal-directed lever-press behavior.	amyloid-beta binding,protein domain specific binding,PDZ domain binding,molecular adaptor activity,scaffold protein binding	Ani
Nr4a2	NR4A2	protein-coding	Mus musculus	ENSMUSG00000026826	HZF-3|NOT|Nurr1|RNR-1|TINOR|TINUR	18227	Attention-Deficit/Hyperactivity Disorder	2 C1.1|2 31.66 cM	Knockout	129/SvEv;C57BL/6	31455763	526	Expeimentalparadigm: Open field test//Cliff avoidance//Rotarod test//Elevated plus maze test//Morris water maze test//Three-chambered sociability test  /n  Model Generation: Two mouse 129/SvEv genomic libraries prepared in λDash II (Stratagene) and P1 (Genome Systems Inc) were used to isolate the NURR1 gene. Screening of the λDash II library was performed (Grunstein and Hogness, 1975) using as probe a<U+00A0>DraII-PstI (680-bp) fragment from the N-terminal region of NURR1 cDNA (Law et al., 1992). The probe was radiolabeled using [32P] dCTP to a specific activity of 2×109<U+00A0>cpm/μg. Using this approach, one positive clone was identified from the λDASH II genomic library. Two fragments of this clone, 5.5-kb<U+00A0>BamHI (p20) and 6.5-kb<U+00A0>EcoRI (p10), corresponding to the 5′ portion of the NURR1 gene, were subcloned into pSP72 (Promega). The P1 library was initially screened by PCR using oligonucleotides specific for the same N-terminal region of the NURR1 gene.<U+00A0>  /n  Rescue: Finally, hyperactivity has been shown to be recovered by treatment with methylphenidate, the first line psychostimulant drug used for ADHD.  /n  Model Summary: In the present study a wide-ranging test battery was used to perform a comprehensive analysis of the behavioral phenotype of the male NURR1-KO mice. As a result, their hyperactive phenotype was confirmed, while their impulsive behavior was reported for the first time.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,protein binding,zinc ion binding,nuclear glucocorticoid receptor binding,sequence-specific DNA binding,metal ion binding,protein heterodimerization activity,sequence-specific double-stranded DNA binding	Ani
Vps13b	VPS13B	protein-coding	Mus musculus	ENSMUSG00000037646	1810042B05Rik|2310042E16Rik|4732488H20|C330002D13Rik|Coh1|D230005K13	666173	Cognitive Disorders	15|15 B3.1	Mutated	C57BL/6N	31495077	527	Expeimentalparadigm: Open field test//Elevated zero maze//Light-dark box test//Y-maze//Morris water maze//Contextual fear conditioning//Three-chamber test//Rotarod  /n  Model Generation: Vps13b<U+00A0>mutant mice were generated by using CRISPR/Cas9 system (Macrogen, Inc).<U+00A0>Cas9<U+00A0>mRNA and single guide (sg) RNAs were microinjected to fertilized embryos of C57BL/6N mice. sgRNAs were designed to mark exon 2 of mouse<U+00A0>Vps13b<U+00A0>by using following sequences: 5′-ACGCTTAAATTTGAAGATGCTGG-3′ and 5′-CGAGTTAAAGTTGGACGTTCTGG-3′. Among 17 pups, deletion of<U+00A0>vps13b<U+00A0>was affirmed in 9 mice by mismatch sensitive nuclease (T7E1) assay. Sequences used for T7E1 assays were 5′-GCCAAGCTTCCTGAGAAGTG-3′ and 5′-ACGAG-GCAAAAAGCCTTGTA-3′. Mutations were confirmed by Sanger sequencing analyses. One of the male founder (#45) concealing 156bp deletion in exon2 was selected for breeding. The founder was crossed with wild type female mouse (C57BL/6N) to obtain heterozygous mutants.  /n  Rescue: -  /n  Model Summary: Our results suggest that<U+00A0>Vps13b<U+00A0>mutant mice may recapitulate key clinical symptoms in Cohen syndrome such as intellectual disability and hypotonia.<U+00A0>	molecular_function,lipid binding,phosphatidylinositol-3-phosphate binding	Ani
Ptchd1	PTCHD1	protein-coding	Mus musculus	ENSMUSG00000041552	9630036J22Rik|Gm387	211612	Attention-Deficit/Hyperactivity Disorder	X|X F3	Knockout	C57BL/6J	31515500	528	Expeimentalparadigm: Open field test//Cliff avoidance test//Y-maze test //Novel object recognition test//Three-chamber social approach test //Five-trial social recognition memory test  /n  Model Generation: Ptchd1<U+00A0>KO mice were generated by homologous recombination in C57BL/6N embryonic stem cells and implanted in ICR blastocysts using standard procedures. Chimeric mice were crossed to female C57BL/6J mice (SLC, Japan).<U+00A0>  /n  Rescue: Acute or chronic treatment with atomoxetine ameliorated almost all behavioral deficits in Pthcd1 KO mice.  /n  Model Summary: Our findings indicate that<U+00A0>Ptchd1<U+00A0>KO mice can be used as an animal model of human ADHD and/or ASD, and KP metabolites are potential diagnostic biomarkers for neurodevelopmental disorders.	protein binding	Ani
Upf2	UPF2	protein-coding	Mus musculus	ENSMUSG00000043241	-	326622	Autism Spectrum Disorder	2|2 A1	Conditional Knockout	C57BL/6J;CamK2α-Cre	31585809	529	Expeimentalparadigm: Contextual fear conditioning//Morris water maze//Three-chamber test//Reciprocal social interaction//T-maze//Ultrasonic vocalization recording  /n  Model Generation: Upf2loxP/loxP mice (Weischenfeldt et al., 2008) were backcrossed for at least eight generations with C57BL/6J mice and subsequently crossed with CamK2α-Cre mice (Upf2; Camk2α-Cre) (Dragatsis and Zeitlin, 2000). Upf2+/+loxP/+; Camk2α-Cre mice were crossed to both Upf2loxP/loxP and Upf2loxP/+ mice. This breeding scheme generated the following experimental mice: Upf2 fb-KO (Upf2loxP/loxP; Camk2α-Cre mice) and three sets of control littermates (Upf2 mice, Upf2; Camk2α-Cre mice, and Upf2+/++/+loxP/loxP mice) that were pooled and defined as the “control” group. Mice were weaned at the third postnatal week and genotyped by PCR. The Upf2 mutant and wild-type alleles were detected by PCR using the following primers: Upf2-forA (5′CCTCATTAATGTTGAGGAGTA-3′), Upf2-for1 (5′-TCCAGTTACAGTGATGAATTG-3′), and Upf2-revC (5′-ACTGAGTCTGGTTTCTAATAG-3′), which amplify a WT band of 391 bp and a Upf2 flox band of 482 bp. Cre expression was detected by PCR using the following primers: Cre-F3 (5′-TCCAGCAACATTGGGCC-3′) and Cre-R3 (5′-TCAGCTACACCAGAGACG-3′) which amplify a 432 bp fragment.  /n  Rescue: More importantly, treatment with two FDA-approved anti-inflammatory drugs reduced brain inflammation, restored LTP and long-term memory, and reversed social and communication deficits.  /n  Model Summary: Here we identified novel protein-coding UPF2 (UP-Frameshift 2) variants in humans with NDD, including speech and language deficits. In parallel, we found that mice lacking Upf2 in the forebrain (Upf2 fb-KO mice) show impaired NMD, memory deficits, abnormal long-term potentiation (LTP), and social and communication deficits.	RNA binding,telomeric DNA binding,molecular adaptor activity	Ani
Dip2a	DIP2A	protein-coding	Mus musculus	ENSMUSG00000020231	4931420H10Rik|Dip2|Kiaa0184-hp|mKIAA0184	64451	Autism Spectrum Disorder	10 C1|10 38.76 cM	Knockout	C57BL/6	31600191	530	Expeimentalparadigm: Isolation-induced USV assay//Open field test//Repetitive behaviors in home cage//Marble burying test//Buried food test for olfaction//Novel object recognition test//Three-chambered test  /n  Model Generation: CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire<U+00A0>Dip2a<U+00A0>gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse.<U+00A0>backcrossed with C57BL/6 over 9 generations to guarantee a stable genetic background. Heterozygous Dip2a KO mice were crossed for producing offspring.  /n  Rescue: acetylation mimetic cortactin restored the impaired synaptic transmission and ameliorated repetitive behaviors in these mice.  /n  Model Summary: Furthermore,<U+00A0>Dip2a<U+00A0>knockout (KO) mice exhibited autism-like behaviors, including excessive repetitive behaviors and defects in social novelty.<U+00A0>	acetate-CoA ligase activity,protein binding,ligase activity	Ani
Rgs2	RGS2	protein-coding	Mus musculus	ENSMUSG00000026360	GOS8	19735	Aggressive Behaviors	1 F|1 62.56 cM	Transgene	C57BL/6	31633064	531	Expeimentalparadigm: Resident-intruder test//Tube dominance test//Open field test//Elevated plus maze test//Place preference test//Novelty suppressed feeding test//Force swim test//Tail suspension test  /n  Model Generation: The Rgs2-/- mice were a gift from Josef M. Penninger at the Institute of Molecular Biotechnology in Vienna, Austria and backcrossed into C57/Bl6 mice7. For stable integration of Rgs2 constructs into the mouse genome, Rgs2-IRES-GFP was subcloned 3′ to the β-globin minimal promoter and 40<U+2009>kb serotonergic-specific ePet-1 enhancer in the modified pBACe3.6 vector as previously described29. The pBAC-ePet-Rgs2-IRES-GFP constructs were microinjected into pronuclei by the Case Western Reserve University Transgenic Core Facility (Cleveland, OH, USA). Transgene expression was detected by PCR analysis (forward/reverse: TCTGAACAGGAGCCCATCCC/TTATGCCCAGCCCATCGAAT) and GFP expression in founders. We received nine founder lines, which were positive for the ePet-Rgs2-IRES-GFP BAC constructs. These founder lines were backcrossed for >17 generations into C57/Bl6 mice and evaluated for RGS2/GFP expression in 5HT neurons. Two high-expressing ePet-Rgs2-IRES-GFP founder lines were bred to hemizygosity.  /n  Rescue: Rescue of RGS2 in 5HT neurons recovers male aggression in Rgs2-/- mice.  /n  Model Summary: Here, we found that overexpression of RGS2 in explicitly serotonergic neurons augments male aggression in control mice and rescues male aggression in Rgs2 mice, while anxiety is not affected. The aggressive behavior is directly correlated to the immediate early gene c-fos induction in the dorsal raphe nuclei and ventrolateral part of the ventromedial nucleus hypothalamus, to an increase in spontaneous firing in serotonergic neurons and to a reduction in the modulatory action of G-/-i/o and Gq/11 coupled 5HT and adrenergic receptors in serotonergic neurons of Rgs2-expressing mice. Collectively, these findings specifically identify that RGS2 expression in serotonergic neurons is sufficient to drive male aggression in mice and as a potential therapeutic target for treating aggression.	G-protein alpha-subunit binding,GTPase activator activity,protein binding,adenylate cyclase inhibitor activity,beta-tubulin binding	Ani
Ash1l	ASH1L	protein-coding	Mus musculus	ENSMUSG00000028053	8030453L17Rik|Ash1|E430018P19Rik|Kmt2h	192195	Neurodevelopmental Disorders	3|3 F1	Transgene(CRISPR/Cas9)	C57BL/6J	31673123	532	Expeimentalparadigm: Tics test  /n  Model Generation: Ash1l+/- mice were generated by CRISPR/Cas9 system. Target sequence within the second exon of Ash1l was chosen according to the single guide RNA recognition guidelines described previously [46]. Genotypes were determined by PCR of mouse tail DNA, using primer F: TTAGGCAAAAAGCCAGGGGCTATC and R: CTCTTTATTCACTAGCCCTGGAAC. The mutation was backcrossed into the C57BL/6J background for >20 generations before behavioral experiments were started.  /n  Rescue: The Ash1l mice manifested tic-like behaviors and compulsive behaviors that could be rescued by the tic-relieving drug haloperidol.  /n  Model Summary: Tourette syndrome (TS) is a childhood-onset neuropsychiatric disorder characterized by repetitive motor movements and vocal tics. We established a transgenic mouse line and performed an array of anatomical, behavioral, and functional assays to investigate ASH1L function. The Ash1l mice manifested tic-like behaviors and compulsive behaviors that could be rescued by the tic-relieving drug haloperidol.	DNA binding,chromatin binding,methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,histone H3K4 methyltransferase activity,metal ion binding,histone H3K9 methyltransferase activity,histone H3K36 methyltransferase activity	Ani
Nexmif	NEXMIF	protein-coding	Mus musculus	ENSMUSG00000046449	A230051P11|KIDLIA|Xpn	245555	Autism Spectrum Disorder	X|X D	Knockout	C57BL/6J	31704787	533	Expeimentalparadigm: Three-chamber test//Marble burying test//Open field test//Barnes maze//Ultrasonic vocalization recording//Fear conditioning test  /n  Model Generation: Generation of NEXMIF KO mouse C77370tm1 (KOMP) Wtsi (KIAA2022) KO mice were created by blastocyst injection of targeted embryonic stem (ES) cell clone EPD0411_7_H02 from the NIH-funded Knock-out Mouse Project (KOMP) (International Mouse Knockout Consortium et al., 2007; Pettitt et al., 2009). The ES cell clone was the result of deletion of exon 4 of the NEXMIF gene. A chimeric animal was generated through the Boston University Transgenic Core and mouse colonies were maintained in a C57BL/6J genetic background. Female mice heterozygous for NEXMIF were crossed with wild-type male mice and KO male mice were used in experiments. All WT (+/+) mice were randomized littermate controls of the KO mice. Transgenic mice were backcrossed to C57BL/6J mice >5 times before use.  /n  Rescue: -  /n  Model Summary: Our previous work has shown that loss of expression of the X-linked gene NEXMIF/KIDLIA is implicated in patients with autistic features and intellectual disability (ID). To further determine the causal role of the gene in the disorder, and to understand the cellular and molecular mechanisms underlying the pathology, we have generated a NEXMIF knock-out (KO) mouse. We find that male NEXMIF KO mice demonstrate reduced sociability and communication, elevated repetitive grooming behavior, and deficits in learning and memory. Loss of NEXMIF/KIDLIA expression results in a significant decrease in synapse density and synaptic protein expression.	NA	Ani
Trim32	TRIM32	protein-coding	Mus musculus	ENSMUSG00000051675	1810045E12Rik|3f3|BBS11|Zfp117	69807	Autism Spectrum Disorder	4 C1|4 34.43 cM	Knockout	129S1	31828304	534	Expeimentalparadigm: Morris water maze//Novelty object recognition test//Three-chamber test//Reciprocal interaction test//Juvenile play test//Self-grooming test//Nest building test//Y-maze//Hot plate test//Olfactory//Buried food test  /n  Model Generation: The mouse TRIM32 genomic fragments were PCR-amplified from the genomic DNA of R1 ES cells (on 129S1 background) with a high fidelity polymerase from Clontech to build a gene-targeting vector, which was designed to replace a 5 kb genomic fragment containing exon 2 of TRIM32 with an SA-IRES-βgeopA expression cassette. Southern blot analysis was carried out to screen for the presence of a disrupted TRIM32 locus using BamH1/Kpn1 (for the 5′ external probe) and Nsi1 digestion (for the 3′ external probe). We used two independently targeted ES cell clones to generate chimeric mice that subsequently were bred with 129S1 females to obtain germ-line transmission. The phenotypes of TRIM32-/- mutants derived from both targeted ES cell lines were indistinguishable.  /n  Rescue: That can be rescued by treatment embryonically with 3BDO, an mTOR activator.  /n  Model Summary: Hyperactive mTOR is an essential pathological mechanism in autism spectrum disorder (ASD). Here, we show that tripartite motif protein 32 (TRIM32), as a maintainer of mTOR activity through promoting the proteasomal degradation of G protein signaling protein 10 (RGS10), regulates the proliferation of medial/lateral ganglionic eminence (M/LGE) progenitors. Deficiency of TRIM32 results in an impaired generation of GABAergic interneurons and autism-like behaviors in mice, concomitant with an elevated autophagy.	transcription coactivator activity,RNA binding,ubiquitin-protein transferase activity,protein binding,zinc ion binding,transferase activity,myosin binding,translation initiation factor binding,identical protein binding,ubiquitin binding,protein self-association,metal ion binding,ubiquitin protein ligase activity	Ani
CG11658	FBXO25	protein-coding	Drosophila melanogaster		Dmel\CG11658|FBXO12|Fbxo25|anon-WO0118547.413|dFBXO25	39319	Attention-Deficit/Hyperactivity Disorder	68D2-68D2|3-36 cM	Overexpression	Iso31	31849056	535	Expeimentalparadigm: Locomotor activity and sleep measurement  /n  Model Generation: Conditional overexpression of CG11658 (two‐to‐one orthologue of<U+00A0>FBXO25 and FBXO32) was achieved by using the GAL4‐UAS system and the pan‐neuronal driver<U+00A0>UAS‐Dcr‐2 hs(X);<U+00A0>nSyb‐GAL4. UAS overexpression lines were obtained from the stock centers in Kyoto and Bloomington (Fbxo25 overexpression‐1: Kyoto stock 203566 and FBXO25 overexpression‐2: Bloomington stock 17663).<U+00A0>The genetic background of the overexpression lines was isogenized for eight generations using a wild‐type Iso31 background  /n  Rescue: -  /n  Model Summary: Overexpression of the FBXO25 orthologue in Drosophila induces increased activity and reduced sleep	NA	Ani
Drd2	DRD2	protein-coding	Mus musculus	ENSMUSG00000032259	D2R|Drd-2	13489	Anorexia Nervosa	9 A5.3|9 26.72 cM	Overexpression	C57BL/6J	31863019	536	Expeimentalparadigm: Locomotion test//Activity-based anorexia paradigm  /n  Model Generation: The AAV1-hSyn-DIO-D2R(L)-IRES-mVenus virus, described previously17,聽18, was packaged by Vector Biolabs (Malvern, PA). The control AAV1-hSyn-DIO-eGFP virus was purchased and packaged from Vector Biolabs (Figure 1a). At 8 weeks of age, hemizygous transgenic mice of both sexes were bilaterally infused with 0.5 μL of D2R or eGFP AAVs to generate D2R-OENac聽and control mice, respectively.Adult D2-Cre BAC transgenic mice (ER44 line; GENSAT) backcrossed >10 generations onto a C57BL/6J background were purchased and bred with C57BL/6J mice from Jackson Laboratories.  /n  Rescue: -  /n  Model Summary: Dopamine D2 receptor overexpression in the nucleus accumbens core induces robust weight loss during scheduled fasting selectively in female mice	dopamine neurotransmitter receptor activity, coupled via Gi/Go,G protein-coupled receptor activity,dopamine neurotransmitter receptor activity,signaling receptor binding,protein binding,dopamine binding,ionotropic glutamate receptor binding,identical protein binding,protein-containing complex binding,organic cyclic compound binding,heterocyclic compound binding	Ani
Mef2	MEF2C	protein-coding	Drosophila melanogaster		22.21|BEST:SD04091|C|CG1429|D-MEF2|D-Mef2|D-mef2|DMEF-2|DMEF2|DMedf2|DMef-2|DMef2|Dmef|Dmef-2|Dmef2|Dmel\CG1429|MEF-2|MEF2|Mef|Mef-2|SD04091|dMEF2|dMEf2|dMef2|dmef2|l(2)46CFr|mb247|mef|mef-2|mef2|mef2c	36032	Attention-Deficit/Hyperactivity Disorder	46C4-46C7|2-61 cM	Knockdown	NA	32046534	537	Expeimentalparadigm: Light-dark cycle  /n  Model Generation: Drosophila orthologs were retrieved from the NCBI protein DELTA-BLAST and ENSEMBL gene tree. The Drosophila orthologs of MEF2C (termed Mef2) and TRAPPC9 (termed brun) were targeted by RNA interference (RNAi)–mediated knockdown using the UAS-GAL4 system. Tissue-cell-type-specific knockdown was achieved using tissue-cell-type-specific promoters driving GAL4 expression.  /n  Rescue: -  /n  Model Summary: Pan-neuronal knockdown of dMEF2 expression caused no changes in activity and sleep during the stable period of the relative day compared with the genetic background control (Figure 2A), but significantly increased night activity (p=0.0059) and reduced sleep (p=0.014) (Figure 2A; see also Table S6 in the online supplement). In constant darkness, the knockdown also showed significantly increased activity (p=0.0088) and less sleep (p=0.00037) in the relative night period (Figure 2B; see also Table S7 in the online supplement). This increased activity was the result of increased activity counts per waking minute (Figure 2A, B).	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,cis-regulatory region sequence-specific DNA binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,histone deacetylase binding,protein dimerization activity	Ani
brun	TRAPPC9	protein-coding	Drosophila melanogaster		38D.28|CG2478|Dmel\CG2478|TRAPPC9|bru|dTRAPPC9	35325	Attention-Deficit/Hyperactivity Disorder	38D2-38D2|2-54 cM	Knockdown	NA	32046534	538	Expeimentalparadigm: Light-dark cycle  /n  Model Generation: Drosophila orthologs were retrieved from the NCBI protein DELTA-BLAST and ENSEMBL gene tree. The Drosophila orthologs of MEF2C (termed Mef2) and TRAPPC9 (termed brun) were targeted by RNA interference (RNAi)–mediated knockdown using the UAS-GAL4 system. Tissue-cell-type-specific knockdown was achieved using tissue-cell-type-specific promoters driving GAL5 expression.  /n  Rescue: -  /n  Model Summary: Pan-neuronal knockdown of dTRAPPC9 did not result in observable alterations in activity or sleep either in the 12-hour light-dark cycle or in constant darkness (Figures 3A,B; see also Figure S5A,B in the online supplement). Specific knockdown of dTRAPPC9 in dopaminergic neurons caused significantly reduced activity and increased day sleep during the relative day (p=0.0022 and p=0.013, respectively), but not in the night (Figure 3C; see also Table S6 in the online supplement). In constant darkness, relative night activity was increased and sleep was reduced (p=0.012 and p=0.015, respectively) (Figure 3D; see also Table S7 in the online supplement). In contrast, knockdown of dTRAPPC9 timeless-expressing neurons resulted in increased night activity and reduced night sleep (p=4.2×10-5 and p=0.00022, respectively) (Figure 3E; see also Table S6 in the online supplement). In constant darkness, increased activity and reduced sleep were also present in the relative night (p=0.00017 and p=0.010, respectively) (Figure 3F; see also Table S7 in the online supplement).	NA	Ani
Lpin1	LPIN1	protein-coding	Mus musculus	ENSMUSG00000020593	Lipin1|fld	14245	Cognitive Disorders	12 A1.1|12 7.9 cM	Mutated	B6;BALB/cByJ-Lpin1<U+00A0>fld<U+00A0>/J	32087966	539	Expeimentalparadigm: Morris water maze  /n  Model Generation: B6 x BALB/cByJ-Lpin1fld/J(JAX stock #002533) mice were gifts from Key Laboratory of Medical Genetics, Central South University. The mice were bred to produce mice with the desired genotype(Lpin1fld/J mice and WT mice as controls).<U+00A0>  /n  Rescue: -  /n  Model Summary: Lipin1 deficiency impairs spatial learning and memory in mice.	transcription coactivator activity,protein binding,phosphatidate phosphatase activity,hydrolase activity,histone deacetylase binding,peroxisome proliferator activated receptor binding,RNA polymerase II-specific DNA-binding transcription factor binding	Ani
Pogz	POGZ	protein-coding	Mus musculus	ENSMUSG00000038902	9530006B08Rik	229584	Neurodevelopmental Disorders	3|3 F2.1	Mutated	C57BL/6NJcl	32103003	540	Expeimentalparadigm: Home cage activity//Fear conditioning test//Novel object recognition test//Open field test//Light-dark box test//Y-maze//Startle response and prepulse inhibition//Reciprocal social interaction test//Self-grooming test//Juvenile playing test//USV test  /n  Model Generation: The<U+00A0>POGZWT/Q1038R<U+00A0>mouse strain was generated using a genome-editing technique as described previously63<U+00A0>with some modifications. The sequence 5′-GCAGCAGCTCCCTGTAAATG-3′ was selected as the target for single guide RNA (sgRNA). Cas9 mRNA and sgRNA were produced using linearized T7-NLS hCas9-pA (RIKEN BioResource Research Center (BRC) #RDB13130, a gift from Tomoji Mashimo)64<U+00A0>and DR274 (Addgene #42250, a gift from Keith Joung)65, respectively. A 117-nt single-stranded oligodeoxynucleotide (ssODN) donor coding the POGZ Q1038R mutation was ordered as Ultramer DNA oligos from Integrated DNA Technologies (Skokie, IL, USA). The Cas9 mRNA, sgRNA, and ssODN were dissolved in nuclease-free water and microinjected into the cytoplasm of pronuclear-stage mouse zygotes obtained from C57BL/6NJcl mice (CLEA Japan, Tokyo, Japan).<U+00A0>  /n  Rescue: Treatment with an anti-epileptic agent, perampanel, improves the social deficits in<U+00A0>POGZWT/Q1038R<U+00A0>mice  /n  Model Summary: We also develop the first mouse model heterozygous for a<U+00A0>de novo<U+00A0>POGZ<U+00A0>mutation identified in a patient with ASD, and we identify ASD-like abnormalities in the mice. Importantly, social deficits can be treated by compensatory inhibition of elevated cell excitability in the mice.	nucleic acid binding,DNA binding,metal ion binding	Ani
Tet3	TET3	protein-coding	Mus musculus	ENSMUSG00000034832	B430006D22Rik|D230004J03Rik	194388	Anxiety Disorder	6|6 C3	Conditional Knockout	C57BL/6N	32103150	541	Expeimentalparadigm: Elevated plus maze//Open field//Novelty-suppressed feeding//Forced swim test//Morris water maze//Tail suspension test  /n  Model Generation: Tet3fl/fl mice on a C57BL/6N background [23, 24] were crossed with B6;129S6 mice (JAX stock #012362—Camk2a-CreERT2 [25]) expressing a tamoxifen-inducible Cre-recombinase under the control of the mouse Camk2a promoter region to generate mice heterozygous for the floxed Tet3 allele and Cre-recombinase. These mice were interbred with C57BL/6N mice homozygous for the floxed Tet3 allele to generate mice heterozygous for Cre-recombinase and homozygous for the floxed Tet3 allele, designated as Tet3 cKO mice. Mice homozygous for the Tet3 floxed allele, but not carrying Cre-recombinase, were used as controls. Animals were genotyped by PCR analysis using genomic DNA and primers specific to Cre-recombinase and the floxed Tet3 allele. Detection of the floxed transgene was done using a primer specific to the fragment, which allowed to detect the deleted or floxed allele (Supplementary Table S1a). To induce Tet3 deletion, 6-week-old male mice were administered tamoxifen (Sigma, St. Louis, MO; T-5648) dissolved in corn oil (Sigma; C-8267) at 20<U+2009>mg/ml. Six-week-old mice were injected intraperitoneally with 50<U+2009>mg/kg of tamoxifen twice a day for 5 consecutive days, with 7 days break followed by injections for 5 additional consecutive days. One month after tamoxifen administration, blood samples were collected from the animals, and corticosterone levels were measured using a commercial kit (Enzo Life Sciences, New York, USA).  /n  Rescue: -  /n  Model Summary: To investigate the function of TET3 in adult postmitotic neurons, we crossed Tet3 floxed mice with a neuronal Cre-expressing mouse line, Camk2a-CreERT2, obtaining a Tet3 conditional KO (cKO) mouse line. Ablation of Tet3 in adult mature neurons resulted in increased anxiety-like behavior with concomitant hypercorticalism, and impaired hippocampal-dependent spatial orientation. Transcriptome and gene-specific expression analysis of the hippocampus showed dysregulation of genes involved in glucocorticoid signaling pathway (HPA axis) in the ventral hippocampus, whereas upregulation of immediate early genes was observed in both dorsal and ventral hippocampal areas. In addition, Tet3 cKO mice exhibit increased dendritic spine maturation in the ventral CA1 hippocampal subregion. Based on these observations, we suggest that TET3 is involved in molecular alterations that govern hippocampal-dependent functions.	DNA binding,protein binding,zinc ion binding,methyl-CpG binding,oxidoreductase activity,metal ion binding,dioxygenase activity,methylcytosine dioxygenase activity	Ani
Rab39b	RAB39B	protein-coding	Mus musculus	ENSMUSG00000031202	6330580M05Rik	67790	Autism Spectrum Disorder	X 38.26 cM|X A7.3	Knockout(CRISPR/Cas9)	C57BL/6	32115408	542	Expeimentalparadigm: Open field test//Rotarod//Three-chamber test//Marble burying test//Self-grooming behaviors  /n  Model Generation: Two gRNAs (CCTGTAGTAGGCGCGAGTGA and AAGAGGTTATCAAATCAGAG) were designed to target exon 2 of mouse Rab39b. The designed guide RNA and Cas9 mRNA were injected into C57BL/6N zygotes. Fifteen pups were obtained from the zygotes injection and were genotyped. Three of them (one male and two females) showed large deletion-carrying mutations. Sanger sequencing showed the mutants were harboring 397-bp deletions in Rab39b exon 2. This sequence maps uniquely to the targeting site via BLAST, reducing the likelihood of off-target mutations. The PCR primers used for genotyping were Rab39b primer-F (GGACTGTCAGGAATCAGGAACACTAG) and Rab39b primer-R (GCCTAGGAAGAAGGCTCATTTATTATCC).  /n  Rescue: -  /n  Model Summary: Mutations in the small GTPase gene RAB39b are associated with X-linked macrocephaly, autism spectrum disorder (ASD), and intellectual disability. The in vivo roles of RAB39b in the brain remain unknown. We generated Rab39b knockout (KO) mice and found that they exhibited cortical neurogenesis impairment, macrocephaly, and hallmark ASD behaviors, which resembled patient phenotypes. We also produced mutant human cerebral organoids that were substantially enlarged due to the overproliferation and impaired differentiation of neural progenitor cells (NPCs), which resemble neurodevelopmental deficits in KO mice.	nucleotide binding,GTPase activity,protein binding,GTP binding,myosin V binding	Ani
Rin1	RIN1	protein-coding	Rattus norvegicus	ENSRNOG00000050223	-	207119	Posttraumatic Stress Disorder	1q43	Knockout	Sprague Dawley	32174475	543	Expeimentalparadigm: Auditory fear conditioning//Auditory fear extinction training//Open field test  /n  Model Generation: The TALENs were 16–18 base pairs in length. TALENs were assembled using the TALEN Toolkit (ViewSolid Biotech, Beijing, China). Finally, four pairs of TALEN sequences were designed using the pCS7-eTALEN-T plasmid (Fig.<U+00A0>1B). The activity of the four TALENs was measured using a luciferase single-strand annealing kit (ViewSolid Biotech, Beijing, China), and the TALEN with the strongest activity was used for embryo microinjection (Fig.<U+00A0>1C).<U+00A0>  /n  Rescue: -  /n  Model Summary: Rin1 knocKnockoutut rats showed deficit in fear formation and fear extinction.	guanyl-nucleotide exchange factor activity,GTPase activator activity,small GTPase binding	Ani
Grm7	GRM7	protein-coding	Mus musculus	ENSMUSG00000056755	6330570A01Rik|C030018L03|E130018M02Rik|Gpr1g|Gprc1g|SMN2|Tg(SMN2)89Ahmb|mGluR7	108073	Neurodevelopmental Disorders	6|6 E3	Knockout	B6.129P2-Grm7<U+00A0>Tm1Dgen/Mmnc;C57BL/6	32248644	544	Expeimentalparadigm: Open field tes//Elevated plus maze//Three-chamber social interaction //Five trial social recognition assay //Fear conditioning//Limb clasping//Gait analysis //Rotarod //Grip strength //Seizure evaluation  /n  Model Generation: Grm7<U+00A0>knockout mice were cryorecovered from the Mutant Mouse Regional Resource Center (B6.129P2-Grm7Tm1Dgen/Mmnc). All mice were generated from heterozygous breeding pairs.  /n  Rescue: -  /n  Model Summary: These findings provide rationale for further investigation of mGlu7<U+00A0>as a potential therapeutic target for neurodevelopmental disorders such as idiopathic autism, attention deficit hyperactivity disorder and Rett syndrome.	adenylate cyclase inhibiting G protein-coupled glutamate receptor activity,group III metabotropic glutamate receptor activity,G protein-coupled receptor activity,voltage-gated calcium channel activity,calcium channel regulator activity,calcium ion binding,calmodulin binding,glutamate receptor activity,adenylate cyclase inhibitor activity,glutamate binding,PDZ domain binding,identical protein binding,protein dimerization activity,calcium-dependent protein binding,serine binding	Ani
Actl6b	ACTL6B	protein-coding	Mus musculus	ENSMUSG00000029712	Actl6|ArpNa|Baf53b	83766	Autism Spectrum Disorder	5|5 G2	Knockout	129/Sv;C57BL/6	32312822	545	Expeimentalparadigm: Juvenile interaction test//Three-chamber test//Barnes maze  /n  Model Generation: In 2007, we generated<U+00A0>Actl6b<U+2212>/<U+2212><U+00A0>mice with mixed 129/Sv; C57BL/6 background and found that few survived past weaning (14). Subsequent backcrossing over many generations to C57BL/6 produced litters with<U+00A0>Actl6b<U+2212>/<U+2212><U+00A0>at the expected 25% ratio and with most mice living to adulthood when provided with recovery gel after weaning.  /n  Rescue: -  /n  Model Summary: Actl6b<U+00A0>knockout mice on two genetic backgrounds exhibited ASD-related behaviors, including social and memory impairments, repetitive behaviors, and hyperactivity.ACTL6B loss is thus an important cause of recessive ASD, with impaired neuron-specific chromatin repression indicated as a potential mechanism.	chromatin binding,protein binding	Ani
Nr2f1	NR2F1	protein-coding	Mus musculus	ENSMUSG00000069171	COUP-TF1|COUP-TFI|COUPTFA|EAR-3|EAR3|Erbal3|SVP44|Tcfcoup1	13865	Autism Spectrum Disorder	13 C1|13 41.38 cM	Gene Editing(CRISPR/Cas9)	C57BL/6;B6D2F1;BALB/cAnSlac Crygc<m1Sbao>	32320667	546	Expeimentalparadigm: Three-chamber test//Y-maze//Open field test//Elevated plus maze//Elevated plus maze//Rotarod//Novelty object recognition test  /n  Model Generation: The generation of corresponding Nr2f1 point mutant mice was performed as described previously (Wu et al., 2013). Briefly, 3-5 weeks old C57BL/6 female mice were superovulated, and ICR females were used as foster mothers. One-cell-stage embryos were collected and injected with Cas9 mRNAs (50 ng/μl), sgRNA (20 ng/μl), and donor oligo (20 ng/μl). The Cas9 mRNA and sgRNA production was performed as described previously (Wu et al., 2013). Briefly, the pX330 plasmid (Addgene, Plasmid #42230) with T7 promoter was linearized, purified, and transcribed with mMESSAGE mMACHINE T7 ULTRA kit. sgRNAs with T7 promoter were amplified by PCR and transcribed using the MEGAshortscript T7 kit. Finally, the Cas9 mRNA and the sgRNA were purified with the MEGAclear kit according to the manufacturer’s instructions. The injected embryos were cultured in KSOM culture medium (Millipore) until the blastocyst stage and transferred into pseudopregnant female mice.  /n  Rescue: Antagonizing the increased inhibitory synaptic transmission partially alleviates their behavioral deficits.  /n  Model Summary: Here, we generate mutant human embryonic stem cell lines (Mut hESCs) carrying an NR2F1-R112K mutation that has been identified in a patient with ASD features and investigate their neurodevelopmental alterations. Mut hESCs overproduce ventral telencephalic neuron progenitors (ventral NPCs) and underproduce dorsal NPCs, causing the imbalance of excitatory/inhibitory neurons. These alterations can be mainly attributed to the aberrantly activated Hedgehog signaling pathway. Moreover, the corresponding Nr2f1 point-mutant mice display a similar excitatory/inhibitory neuron imbalance and abnormal behaviors.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,zinc ion binding,sequence-specific DNA binding,retinoic acid-responsive element binding,metal ion binding,sequence-specific double-stranded DNA binding	Ani
Sybu	SYBU	protein-coding	Mus musculus	ENSMUSG00000022340	Golsyn	319613	Autism Spectrum Disorder	15|15 B3.2	Conditional Knockout	C57BL/6J;RPCIB-731	32332993	547	Expeimentalparadigm: Three-chamber test//Novel object test//Five-trial social memory assay//Repetitive behavior test//Buried food finding test//Olfactory habituation-dishabituation test//Ultrasonic vocalizations test//Morris water maze//Fear conditioning test//Cotton bud biting test//Rotarod//Elevated plus maze//Open field test//Pre-pulse inhibition test  /n  Model Generation: Stb cKO mice were generated by an stb targeting vector using BAC clones from the C57BL/6J RPCIB-731 BAC library in a Cre-dependent manner. Specifically, two loxP sites flanked exons 4 and 5, resulting in a frameshifting that generates a premature stop codon in exon 6. The linearized targeting vector was electroporated into C57BL/6N Tac embryonic stem (ES) cells. Homologous recombinant clones were isolated using positive (PuroR) and negative (Thymidine kinase-TK) selection. ES cells with correct conditional alleles were confirmed by Southern blot and PCR analyses and subsequently injected into blastocysts. The stbLoxP/LoxP mice were maintained on the C57BL/6J background. By crossing with the Nestincre/+ line (B6.Cg-Tg Nes-cre), the stb gene was specifically deleted in central and peripheral nervous systems in cKO mice.  /n  Rescue: Expressing STB-R178Q fails to rescue reduced synapse formation and impaired synaptic transmission and plasticity in stb cKO neurons.  /n  Model Summary: Here, we report that defects in syntabulin-mediated transport and thus reduced formation and maturation of synapses are one of core synaptic mechanisms underlying autism-like synaptic dysfunction and social behavioral abnormalities. Syntabulin expression in the mouse brain peaks during the first 2 weeks of postnatal development and progressively declines during brain maturation. Neurons from conditional syntabulin mice (stb cKO) display impaired transport of presynaptic cargos, reduced synapse density and active zones, and altered synaptic transmission and long-term plasticity. Intriguingly, stb cKO mice exhibit core autism-like traits, including defective social recognition and communication, increased stereotypic behavior, and impaired spatial learning and memory.	microtubule binding,syntaxin-1 binding,kinesin binding	Ani
Slc18a2	SLC18A2	protein-coding	Mus musculus	ENSMUSG00000025094	1110037L13Rik|9330105E13|Vmat2	214084	Motor Disorders	19 D3|19 54.64 cM	Transgene	C57BL/6N	32410942	548	Expeimentalparadigm: Open field test//Grip strength//Beam walking//Footprint analysis//Olfactory tests//Elevated plus maze//Sucrose preference test//Tail suspension test//Novel object recognition test//E-motion test  /n  Model Generation: Mice carrying CreERT2 (Cre recombinase and mutated estrogen receptor binding domain) under the control of the promoter for the dopaminergic-specific dopamine transporter (DAT) gene were crossed with mice carrying the floxed<U+00A0>Vmat2<U+00A0>gene to obtain the target mice, which were maintained on a C57BL/6N background. With the introduction of tamoxifen, one allele of the<U+00A0>Vmat2<U+00A0>gene in the mouse line with DAT-Cre would be conditionally knocked down in dopaminergic neurons, generating VMAT2DATcre-HET mice. The rest of the mice with one allele of the<U+00A0>Vmat2<U+00A0>gene were flanked by two loxP sites (VMAT2flox/+<U+00A0>mice) and used as the wild-type (WT) mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: Behavioral tasks showed impairments in several motor functions and major defects in olfactory abilities in the VMAT2DATcre-HET mice.<U+00A0>	amine transmembrane transporter activity,serotonin:sodium:chloride symporter activity,protein binding,monoamine:proton antiporter activity,enzyme binding,transmembrane transporter activity,heat shock protein binding,xenobiotic transmembrane transporter activity,heterocyclic compound binding	Ani
Oprm1	OPRM1	protein-coding	Mus musculus	ENSMUSG00000000766	M-OR-1|MOP-R|MOR-1|MOR-1O|Oprm|mor|muOR	18390	Restless Legs Syndrome	10 A1|10 1.85 cM	Knockout	Oprm1<U+00A0>tm1Kff	32424971	549	Expeimentalparadigm: Wheel running//Open field test//Warm stimuli//Tail-flick test  /n  Model Generation: The MOR Knockout mice (Oprm1tm1Kff) were from Jackson Laboratory (Stock No: 007559, RRID: IMSR_JAX:007559). The original MOR Knockout mice were bred with the wild-type (WT) mice to generate heterozygous males and females, which were interbred to generate experimental animals.<U+00A0>  /n  Rescue: -  /n  Model Summary: The Knockout mice showed hyperactivity and increased thermal sensitivity in wakefulness primarily during what would normally be the sleep phase similar to that seen in human RLS.	G-protein alpha-subunit binding,G protein-coupled receptor activity,beta-endorphin receptor activity,G protein-coupled opioid receptor activity,voltage-gated calcium channel activity,protein binding,protein C-terminus binding,protein domain specific binding,filamin binding,G-protein beta-subunit binding,morphine receptor activity,peptide binding,neuropeptide binding	Ani
Btbd9	BTBD9	protein-coding	Mus musculus	ENSMUSG00000062202	1700023F20Rik|4930402L05	224671	Restless Legs Syndrome	17|17 A3.3	Conditional Knockout	NA	32446853	550	Expeimentalparadigm: Open field<U+00A0>test//Wheel running//Tail flick  /n  Model Generation: The PC-specific<U+00A0>Btbd9<U+00A0>knockout mice (Btbd9<U+00A0>pKO) were generated from<U+00A0>Btbd9 loxP<U+00A0>mice crossed with<U+00A0>Pcp2-cre<U+00A0>mice (Zhang et al., 2004) as described (Lyu et al., 2019b;<U+00A0>Yokoi et al., 2012a;<U+00A0>Yokoi et al., 2012b;<U+00A0>Zhang et al., 2011). Mice doubly heterozygous for both<U+00A0>Btbd9 loxP<U+00A0>and<U+00A0>Pcp2-cre<U+00A0>were then crossed with<U+00A0>Btbd9 loxP<U+00A0>hetero- or homozygous mice to derive<U+00A0>Btbd9<U+00A0>pKO mice and their control littermates, including WT littermates,<U+00A0>Pcp2-cre+/<U+2212> (animals only expressing<U+00A0>Pcp2-cre) and<U+00A0>Btbd9 loxP+/<U+2212> (animals only having<U+00A0>loxP<U+00A0>sites in one allele) or<U+00A0>Btbd9 loxP<U+2212>/<U+2212> (animals having<U+00A0>loxP<U+00A0>sites in both alleles).  /n  Rescue: -  /n  Model Summary: Btbd9<U+00A0>pKO mice showed significant motor restlessness during the rest phase but not in the active phase.<U+00A0>Btbd9<U+00A0>pKO mice also had an increased probability of waking at rest. Unlike the<U+00A0>Btbd9<U+00A0>knockout mice, there was no increased thermal sensation in the<U+00A0>Btbd9<U+00A0>pKO.<U+00A0>	NA	Ani
Cttnbp2	CTTNBP2	protein-coding	Mus musculus	ENSMUSG00000000416	3010022N24Rik|4732477G22Rik|6430526E05|9130022E09Rik|Cortbp2|ORF4|mKIAA1758	30785	Autism Spectrum Disorder	6|6 A2	Knockout	C57BL/6	32492416	551	Expeimentalparadigm: Open field test//Elevated plus maze//Marble burying//Three-chamber test//Novel location recognition//Novel object recognition//T maze  /n  Model Generation: Male R533<U+2217><U+00A0>mutant mice were mated with WT female C57BL/6 mice to generate breeders and mice (both<U+00A0>+/+ and<U+00A0>+/R533<U+2217>) for experiments. To maintain the<U+00A0>Cttnbp2+/– mouse line,<U+00A0>Cttnbp2+/– male mice were used as breeders to mate WT female C57BL/6 mice. To generate<U+00A0>Cttnbp2–/–,<U+00A0>+/– and<U+00A0>+/+ littermates for experiments, male<U+00A0>Cttnbp2+/– mice were mated with female<U+00A0>Cttnbp2+/– mice.We used a TALEN technique (Cermak et al., 2011, Sung et al., 2013) to disrupt the Cttnbp2 gene.  /n  Rescue: Zinc supplementation and D-cycloserine improve the defects of<U+00A0>Cttnbp2-deficient mice  /n  Model Summary: Deletion and autism-linked mutation of<U+00A0>Cttnbp2<U+00A0>results in autism-like behaviors	cytoskeletal regulatory protein binding,SH3 domain binding	Ani
Tcf20	TCF20	protein-coding	Mus musculus	ENSMUSG00000041852	2810438H08Rik|SPBP|mKIAA0292	21411	Autism Spectrum Disorder	15|15 E1	Knockout(CRISPR/Cas9)	C57BL/6;ICR	32510763	552	Expeimentalparadigm: Open field test//Elevated‐plus maze//Three‐chamber social interaction test//Y‐Maze//Marble burying test//Ultrasonic vocalization test  /n  Model Generation: CRISPR‐Cas9 technology was used to generate TCF20 knockout mice. Two guide RNAs, which separately target both ends of exon2 of TCF20 gene, were cloned to pUC57‐kan‐T7‐gRNA vector. The sequences of these 2 gRNAs are upstream‐gRNA: GATGAGCTGTGCACCTCCTGTGG, downstream‐gRNA: AAGACTGTGGTGGAGGTCCTCGG. And the gRNA vectors and Cas9 vector were injected into fertilized eggs. Then, these treated zygotes were transferred into surrogate mother mice.  /n  Rescue: Overexpression of TDG or TCF-4 rescues the deficient neurogenesis of TCF20 knockdown brains.  /n  Model Summary: Recently, de novo mutations of transcription factor 20 (TCF20) were found in patients with autism by large-scale exome sequencing. To understand the biological function of TCF20 in neurogenesis and the possible relationship between TCF20 mutations and ASD, we generated TCF20 knockout mice and found that the deletion of TCF20 results in neurogenesis defects as well as autistic‐like behavioral patterns.	transcription cis-regulatory region binding,DNA binding,DNA-binding transcription factor activity,transcription coactivator activity,metal ion binding	Ani
Chrna5	CHRNA5	protein-coding	Mus musculus	ENSMUSG00000035594	Acra-5|Acra5	110835	Cocaine Addiction	9 B|9 29.84 cM	Knockout	Long Evans	32841724	553	Expeimentalparadigm: Cocaine self administration  /n  Model Generation: Wild-type (WT) rats, homozygous α5Knockout rats and homozygous rats constitutively carrying the rs16969968 SNP (α5SNP rats), on Long Evans background, all males, were generated, bred and housed at the Institut Pasteur, Paris, France (Forget et al., 2018). Homozygous rats were used considering the stronger phenotype on cocaine addiction in patients homozygous for the rs16969968 polymorphism (Grucza et al., 2008). The rats’ colonies were regularly back-crossed with WT Long-Evans rats.  /n  Rescue: -  /n  Model Summary: α5SNP rats exhibit impairment in the acquisition of cocaine self-administration.α5 knock-out rats exhibit higher cocaine-induced reinstatement of nicotine seeking	transmembrane signaling receptor activity,ion channel activity,extracellular ligand-gated ion channel activity,excitatory extracellular ligand-gated ion channel activity,acetylcholine receptor activity,acetylcholine-gated cation-selective channel activity,neurotransmitter receptor activity,acetylcholine binding,protein-containing complex binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Aatk	AATK	protein-coding	Mus musculus	ENSMUSG00000025375	AATYK|aatyk1|mKIAA0641	11302	Attention-Deficit/Hyperactivity Disorder	11|11 E2	Knockout	C57BL/6J<U+00A0>	32963255	554	Expeimentalparadigm: Morris water maze test//Fear conditioning test//Open field test //Wire-hang test//Rotarod performance test //Novel object recognition test//Social interaction test//Elevated plus maze test//Sucrose preference test//Tail suspension test //Forced swim test  /n  Model Generation: Homologous recombination was used to replace the genomic region of<U+00A0>LMTK1<U+00A0>that contains exons 4–7 and encodes the kinase domain with the<U+00A0>neomycin resistance (Neo)<U+00A0>cassette. LMTK1-targeted ES clones were injected into C57B6/J blastocysts. Male chimeras were mated with C57B6/J females to obtain heterozygous (LMTK1+/<U+2212>) F1 offspring. We intercrossed the F1 progeny to produce homozygous<U+00A0>LMTK1<U+2212>/<U+2212><U+00A0>mice. Genotyping was performed by PCR with specific primers to amplify either the mutant or the wild-type allele.  /n  Rescue: -  /n  Model Summary: Some of these abnormal behaviors represent core features of attention deficit hyperactive disorder (ADHD), suggesting the possible involvement of LMTK1 in the pathogenesis of ADHD.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,protein tyrosine kinase activity,ATP binding,kinase activity,transferase activity	Ani
Bche	BCHE	protein-coding	Mus musculus	ENSMUSG00000027792	C730038G20Rik	12038	Posttraumatic Stress Disorder	3|3 E3	Knockdown	C57BL/6	33061920	555	Expeimentalparadigm: Open field test  /n  Model Generation: AAV2/9-shBChE was produced by transfecting 293T cells with three plasmids: an AAV vector expressing BChE shRNA and eGFP or EGFP alone, an AAV helper plasmid (pAAV Helper) and an AAV Rep/Cap expression plasmid. AAV2/9- eGFP served as the control in this experiment. Seventy-two hours after transfection, the cells were collected and lysed using a freeze-thaw procedure. The viral particles were purified by the iodixanol step-gradient ultracentrifugation method. Iodixanol was diluted, and the AAV was concentrated using a 100-kDa molecular mass cutoff ultrafiltration device.  /n  Rescue: -  /n  Model Summary: Enhanced Contextual Fear Memory and Elevated Astroglial Glutamate Synthase Activity in Hippocampal CA1 BChE shRNA Knockdown Mice	acetylcholinesterase activity,cholinesterase activity,hydrolase activity,choline binding,identical protein binding,carboxylic ester hydrolase activity	Ani
Cnr1	CNR1	protein-coding	Mus musculus	ENSMUSG00000044288	CB-R|CB1|CB1A|CB1B|CB1R	12801	Anxiety Disorder	4 A5|4 16.28 cM	Conditional Knockout	C57BL/6J	33093652	556	Expeimentalparadigm: Elevated plus maze//Light-dark box//Open field//Marble burying test//Sucrose preference//Novelty-suppressed feeding//Forced swim test  /n  Model Generation: All experiments were performed on adult (8–16 weeks old at the beginning of the experiments) male or female mice. C57BL/6J (Jax stock#: 000664), Gad2-Cre (Gad2tm2(cre)Zjh/J, Jax stock#: 010802), ChAT-Cre (Chattm2(cre)Lowl/J, Jax stock#: 006410), and Ai9 reporter mice (B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J; Jax stock#: 007909) were obtained from the Jackson Laboratory (Bar Harbor, Maine). ChAT-Cre mice were originally on a mixed C57BL/6;129 background and were backcrossed to C57BL/6J mice. Cnr1loxP/loxP mice (Cnr1tm1.1Zxx, MGI: 6119514) were generously provided by Zheng-Xiong Xi at NIDA/NIH and were maintained on a C57BL/6J background67. MaglloxP/loxP mice were generated as described in our previous study68 and maintained on a C57BL/6J background. ChAT-tdTomato reporter mice were generated by crossing ChAT-Cre mice with Ai9 mice, which express tdTomato following Cre-mediated recombination27.  /n  Rescue: -  /n  Model Summary: Here, we show that a robust endocannabinoid signaling system modulates synaptic transmission between the MHb and its sole identified GABA input, the medial septum and nucleus of the diagonal band (MSDB). With RNAscope in situ hybridization, we demonstrate that key enzymes that synthesize or degrade the endocannabinoids 2-arachidonylglycerol (2-AG) or anandamide are expressed in the MHb and MSDB, and that cannabinoid receptor 1 (CB1) is expressed in the MSDB. Electrophysiological recordings in MHb neurons revealed that endogenously-released 2-AG retrogradely depresses GABA input from the MSDB. This endocannabinoid-mediated depolarization-induced suppression of inhibition (DSI) was limited by monoacylglycerol lipase (MAGL) but not by fatty acid amide hydrolase. Anatomic and optogenetic circuit mapping indicated that MSDB GABA neurons monosynaptically project to cholinergic neurons of the ventral MHb. To test the behavioral significance of this MSDB-MHb endocannabinoid signaling, we induced MSDB-specific knockout of CB1 or MAGL via injection of virally-delivered Cre recombinase into the MSDB of Cnr1loxP/loxP or MgllloxP/loxP mice. Relative to control mice, MSDB-specific knockout of CB1 or MAGL bidirectionally modulated 2-AG signaling in the ventral MHb and led to opposing effects on anxiety- and depressive-like behavior.	G protein-coupled receptor activity,cannabinoid receptor activity,identical protein binding	Ani
Mgll	MGLL	protein-coding	Mus musculus	ENSMUSG00000033174	Magl|Mgl	23945	Anxiety Disorder	6|6 D1	Conditional Knockout	C57BL/6J	33093652	557	Expeimentalparadigm: Elevated plus maze//Light-dark box//Open field//Marble burying test//Sucrose preference//Novelty-suppressed feeding//Forced swim test  /n  Model Generation: All experiments were performed on adult (8–16 weeks old at the beginning of the experiments) male or female mice. C57BL/6J (Jax stock#: 000664), Gad2-Cre (Gad2tm2(cre)Zjh/J, Jax stock#: 010802), ChAT-Cre (Chattm2(cre)Lowl/J, Jax stock#: 006410), and Ai9 reporter mice (B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J; Jax stock#: 007909) were obtained from the Jackson Laboratory (Bar Harbor, Maine). ChAT-Cre mice were originally on a mixed C57BL/6;129 background and were backcrossed to C57BL/6J mice. Cnr1loxP/loxP mice (Cnr1tm1.1Zxx, MGI: 6119514) were generously provided by Zheng-Xiong Xi at NIDA/NIH and were maintained on a C57BL/6J background67. MaglloxP/loxP mice were generated as described in our previous study68 and maintained on a C57BL/6J background. ChAT-tdTomato reporter mice were generated by crossing ChAT-Cre mice with Ai9 mice, which express tdTomato following Cre-mediated recombination27.  /n  Rescue: -  /n  Model Summary: Here, we show that a robust endocannabinoid signaling system modulates synaptic transmission between the MHb and its sole identified GABA input, the medial septum and nucleus of the diagonal band (MSDB). With RNAscope in situ hybridization, we demonstrate that key enzymes that synthesize or degrade the endocannabinoids 2-arachidonylglycerol (2-AG) or anandamide are expressed in the MHb and MSDB, and that cannabinoid receptor 1 (CB1) is expressed in the MSDB. Electrophysiological recordings in MHb neurons revealed that endogenously-released 2-AG retrogradely depresses GABA input from the MSDB. This endocannabinoid-mediated depolarization-induced suppression of inhibition (DSI) was limited by monoacylglycerol lipase (MAGL) but not by fatty acid amide hydrolase. Anatomic and optogenetic circuit mapping indicated that MSDB GABA neurons monosynaptically project to cholinergic neurons of the ventral MHb. To test the behavioral significance of this MSDB-MHb endocannabinoid signaling, we induced MSDB-specific knockout of CB1 or MAGL via injection of virally-delivered Cre recombinase into the MSDB of Cnr1loxP/loxP or MgllloxP/loxP mice. Relative to control mice, MSDB-specific knockout of CB1 or MAGL bidirectionally modulated 2-AG signaling in the ventral MHb and led to opposing effects on anxiety- and depressive-like behavior.	lipase activity,hydrolase activity,protein homodimerization activity,acylglycerol lipase activity,carboxylic ester hydrolase activity	Ani
Plpp1	PLPP1	protein-coding	Rattus norvegicus	ENSRNOG00000009980	Ppap2a	64369	Cognitive Disorders	2q14	Knockdown	Wistar	33123308	558	Expeimentalparadigm: Open field test//Novel object recognition test //Morris water maze  /n  Model Generation: Lentiviral up- and downregulation of the Lipin1 and the blank vectors were constructed and encoded with the green fluorescent protein sequence (Jikai Gene Chemical Technology Co., Ltd.): Lv-Lipin1 (1 × 109<U+00A0>TU/mL), Lv-Lipin1-Con (2 × 109<U+00A0>TU/mL), Lv-Lipin1ShRNA (7 × 108<U+00A0>TU/mL), and Lv-Lipin1ShRNA-Con (1 × 109<U+00A0>TU/mL). The sequence of Lipin1ShRNA was caGCGAGTCTTCAGACACTTT. The sequence of Lipin1ShRNA-Con is TTCTCCGAACGTGTCACGT.  /n  Rescue: -  /n  Model Summary: In contrast, knockdown of Lipin1 within the CA1 region enhanced neuronal abnormalities and the genesis of cognitive impairment in rats.	diacylglycerol diphosphate phosphatase activity,phosphatidate phosphatase activity,sphingosine-1-phosphate phosphatase activity,lipid phosphatase activity,ceramide-1-phosphate phosphatase activity	Ani
chmp7	CHMP7	protein-coding	Zebrafish	ENSDARG00000041362	zgc:73300|zgc:77047	393754	Attention-Deficit/Hyperactivity Disorder	-	Knockout(Target)	Tübingen	33159045	559	Expeimentalparadigm: Locomotion test  /n  Model Generation: To create a<U+00A0>chmp7<U+00A0>mutant zebrafish line, a guide RNA targeting<U+00A0>chmp7<U+00A0>(ENSDARG00000041362) exon 2 was generated according to Gagnon et al.17. One-cell stage embryos were injected with a mixture containing: 150<U+2009>ng/μL guide RNA, 5<U+2009>μg/μL Cas9 protein (PNA Bio, Newbury Park, CA, USA), 20<U+2009>μM STOP cassette, 0.25<U+2009>μL Phenol Red, 0.25<U+2009>μL Cascade Blue (Molecular Probes, Waltham, MA, USA), and ultra-pure H2O to a final volume of 2.5<U+2009>μL. Embryos were selected for Cascade Blue, indicating successful injection, at 24 hpf and raised to adulthood.<U+00A0>  /n  Rescue: The hyperactivity at 6 days post-fertilisation was significantly reduced through the application of methylphenidate, a mainstay pharmacological treatment for ADHD.  /n  Model Summary: Overall, this study highlights an important role for<U+00A0>CHMP7<U+00A0>in the neurodevelopment of ADHD, and demonstrates the utility of zebrafish for modelling the functional effects of genes conferring risk to ADHD.	NA	Ani
Slc18a3	SLC18A3	protein-coding	Mus musculus	ENSMUSG00000100241	VAChT|VAT	20508	Eating Disorder	14 B|14 19.4 cM	Conditional Knockout	C57BL/6J	33164988	560	Expeimentalparadigm: Touchscreen behavioral test//Operant sucrose self-administration//Sucrose binge-like overconsumption//Sucrose preference  /n  Model Generation: VAChT 248 flox/flox mice were backcrossed to C57BL/6J for 10 generations. VAChT 249 D2-Cre-flox/flox mice (named VAChTcKO mice) were generated by crossing VAChTflox/flox 250 with the D2-Cre hemizygous mice (  /n  Rescue: -  /n  Model Summary: Silencing glutamate favored goal-directed behaviors and had no impact on eating behavior. In contrast, VAChTcKO mice were more prone to habits and maladaptive eating.<U+00A0>	acetylcholine transmembrane transporter activity,acetylcholine:proton antiporter activity,protein binding,monoamine transmembrane transporter activity,monoamine:proton antiporter activity,transmembrane transporter activity	Ani
Pogz	POGZ	protein-coding	Mus musculus	ENSMUSG00000038902	9530006B08Rik	229584	Autism Spectrum Disorder	3|3 F2.1	Conditional Knockout	C57BL/6	33203851	561	Expeimentalparadigm: Three-chamber test//Direct social interaction//Marble burying test//T-maze//Morris water maze//Open field test//Elevated plus maze//Social and nonsocial odors habituation//dishabituation//Rotarod//Horizontal bars  /n  Model Generation: Pogz<U+00A0>conditional knockout mice on the background of C57/BL6 were previously generated27<U+00A0>using the Cre-lox system, with loxP sites flanking exons 13<U+2212>19. Exons 13<U+2212>19 include the DDE transposas domain, the CENP DNA binding domain and a part of the zinc fingers domain that binds HP1 proteins (HPZ). To create a mutation that is restricted to the brain, we crossed a conditional<U+00A0>Pogz<U+00A0>flox/flox (Pogzfl/fl) mice with transgenic NestinCRE<U+00A0>(NesCre/+;<U+00A0>Pogzfl/+) to produce heterozygous (NesCre/+;<U+00A0>Pogzfl/+), homozygous (NesCre/+;<U+00A0>Pogzfl/fl) and controls (Nes+/+;<U+00A0>Pogzfl/fl) littermates.  /n  Rescue: -  /n  Model Summary: Here, we generate a brain specific conditional knockout mouse model deficient for<U+00A0>Pogz, an ASD risk gene. We demonstrate that<U+00A0>Pogz<U+00A0>deficient mice show microcephaly, growth impairment, increased sociability, learning and motor deficits, mimicking several of the human symptoms.<U+00A0>	nucleic acid binding,DNA binding,metal ion binding	Ani
Tecpr2	TECPR2	protein-coding	Mus musculus	ENSMUSG00000021275	4930573I19Rik|mKIAA0297	104859	Intellectual Disability	12|12 F1	Knockout	C57BL/6J	33218264	562	Expeimentalparadigm: Heat probe//Von frey//Home cage locomotion//Rotarod//Gait and stride analyses//Pole task  /n  Model Generation: To generate tecpr2 knockout mice (tecpr2-/-), we used the online CRISPR design tool [8] to create two short guide RNA (sgRNA) sequences, targeting the third (ACGGGGACTACATTGCAGTG) and the fifth (CGCTGGCGTGGAGCCCCAAT) exons of the 21 coding exons of the mouse Tecpr2 gene. The sgRNAs were injected together with in-vitro-transcribed Cas9 into single-cell fertilized embryos isolated from super-ovulated C57BL/6 J mice, a background recommended for modeling neuronal diseases [34,35] at the WIS transgenic and knockout facility. The zygotic embryos were transferred to pseudopregnant females. Fully weaned mice were analyzed for Tecpr2 alterations using PCR amplification and sequencing of tail-tip DNA.  /n  Rescue: -  /n  Model Summary: Mutations in the coding sequence of human TECPR2 were recently linked to spastic paraplegia type 49 (SPG49), a hereditary neurodegenerative disorder involving intellectual disability, autonomic-sensory neuropathy, chronic respiratory disease and decreased pain sensitivity. Here, we report the generation of a novel CRISPR-Cas9 tecpr2 knockout (tecpr2) mouse that exhibits behavioral pathologies observed in SPG49 patients. tecpr2 mice develop neurodegenerative patterns in an age-dependent manner, manifested predominantly as neuroaxonal dystrophy in the gracile (GrN) and cuneate nuclei (CuN) of the medulla oblongata in the brainstem and dorsal white matter column of the spinal cord.	molecular_function	Ani
Nrgn	NRGN	protein-coding	Mus musculus	ENSMUSG00000053310	0710001B06Rik|NG|NG/RC3|Pss1|RC3	64011	Neurodevelopmental Disorders	9 A4|9 20.78 cM	Knockout	C57BL/6J	33270377	563	Expeimentalparadigm: Nest-building test// Light//Dark Transition Test //Open field test//Elevated plus maze test//Hot plate test//Social interaction test in a novel environment//Rotarod Test//Sociability and social novelty preference test// Startle response//prepulse inhibition test//Porsolt forced swim test//T-maze spontaneous alternation task//Tail Suspension Test//Locomotor activity monitoring in the home cage  /n  Model Generation: To construct the targeting vector, the sequence coding for the first five amino acids in the first exon and the adjoining 98 bp of the first intron were replaced by bacterial<U+00A0>lacZ<U+00A0>and the neomycin resistance (neo) genes derived from pZINIMn vector. The targeting vector (linearized by<U+00A0>NotI digestion) was transfected into embryonic stem cells derived from 129/sv mouse for homologous recombination, and clones obtained by the positive–negative selection strategy were positively identified by Southern blot (after<U+00A0>SacI digestion) with a probe containing 5′-flanking sequence. Two clones were used to generate chimeras. Germline transmission was obtained by crossing male chimeras with female C57BL/6 mice, and the F1 heterozygous (HET) littermates were then inbred to generate three genotypes  /n  Rescue: -  /n  Model Summary: In the current study, we identified behavioral phenotypes of<U+00A0>Nrgn<U+00A0>KO mice that mimic some of the typical symptoms of neuropsychiatric diseases, including impaired executive function, motor dysfunction, and altered anxiety.<U+00A0>	calmodulin binding,phosphatidylinositol-3,4,5-trisphosphate binding,phosphatidic acid binding	Ani
nrxn2a	NRXN2	protein-coding	Zebrafish	ENSDARG00000061454	-	558326	Anxiety Disorder	-	Knockout(Mutated)	NA	33276371	564	Expeimentalparadigm: Locomotion//NTD test for anxiety//Social preference test  /n  Model Generation: For generation of<U+00A0>nrxn2aa<U+2212>/<U+2212><U+00A0>mutants, two CRISPR target sites were identified in exon 1 of<U+00A0>nrxn2aa<U+00A0>(ENSDARG00000061454) using ZiFit Target version 4.2 software (56). gBlock fragments were obtained from Integrated DNA Technologies and PCR-amplified using a TaKaRa PrimeStar Max kit. gRNAs were<U+00A0>in vitro<U+00A0>transcribed using a MEGAshortscript<U+2122> T7 kit (Invitrogen). Cas9 mRNA was<U+00A0>in vitro<U+00A0>transcribed using the mMessage mMachine SP6 kit (Ambion) from the pCS2-nCas9n plasmid available at Addgene (plasmid # 47929) (57) after linearization with<U+00A0>NotI<U+00A0>(NEB). Zebrafish embryos were co-injected with two gRNAs (100<U+00A0>ng/μL each) and Cas9 mRNA (150–300<U+00A0>ng/μL) into the cytoplasm at the early one-cell stage. Embryos and adult fish (by fin-clipping) were genotyped with PCR using primers 5′-GAGCTACCGGTGAACTGAGC-3′ and 5′-AAAGTGCAGGAGACGACGAT-3′. Fin positive F0 fishes were outcrossed to WT fish and progeny screened for germline transmission. F1 larvae were raised and genotyped at 2–3<U+00A0>months to determine the sequence of their mutant alleles. Zygotic homozygous embryos (Z) were obtained in F2 from carriers of the same allele, raised and incrossed to obtain MZ mutants in F3.  /n  Rescue: -  /n  Model Summary: Together, our data demonstrate an essential role for maternal<U+00A0>nrxn2aa<U+00A0>in NMJ synapse establishment, while zygotic<U+00A0>nrxn2aa<U+00A0>expression appears dispensable for synapse maintenance. The viable<U+00A0>nrxn2aa<U+2212>/<U+2212><U+00A0>mutant furthermore serves as a novel model to study how an increase in anxiety-like behaviors impacts other deficits.	NA	Ani
Zfp804a	ZNF804A	protein-coding	Mus musculus	ENSMUSG00000070866	C630007C17Rik|Znf804a	241514	Schizophrenia	2|2 D	Mutated(TALEN)	C57BL/6 ×FVB/N	33303946	565	Expeimentalparadigm: Open field test//Three chamber social interaction test//Fear conditioning test//Prepulse inhibition test//Morris water maze  /n  Model Generation: The TALEN-coding ZFP804A plasmid was purchased from Shanghai Taiting Biotechnology Co. Ltd, China. Procedures for superovulation, oocytes collection, TALEN injection, and embryo transfer were then carried out as previously described [40]. Briefly, TALEN plasmid was digested by NotI restriction endonuclease. One microgram of the digested plasmid was used as a template for the in vitro transcription reaction using the mMESSAGE mMACHINE SP6 Transcription Kit (Ambion), and then polyadenylated by using a Poly(A) tailing kit (Ambion). Two TALEN mRNAs (1:1 ratio) were diluted with injection buffer (10-mM TrisHCl/0.1-mM EDTA, pH 7.4) at 10<U+2009>ng/μl. We then carried out microinjection of the mixture into cytoplasm of pronuclear stage oocytes under standard procedures using oocytes obtained from superovulated (C57BL/6<U+2009>×<U+2009>FVB/N) F1 mice mated with male mice of the same strain. The injected oocytes were transferred into pseudopregnant ICR female mice.  /n  Rescue: -  /n  Model Summary: We generated ZFP804A mutant mice, and they showed deficits in contextual fear and spatial memory. We also observed the sensorimotor gating impairment, as revealed by the prepulse inhibition test, but only in female ZFP804A mutant mice from the age of 6 months. Notably, the PPI difference between the female mutant and control mice was no longer existed with the administration of Clozapine or after the ovariectomy. Hippocampal long-term potentiation was normal in both genders of the mutant mice. Long-term depression was absent in male mutants, but facilitated in the female mutants. Protein levels of hippocampal serotonin-6 receptor and GABAB1 receptor were increased, while those of cortical dopamine 2 receptor were decreased in the female mutants with no obvious changes in the male mutants. Moreover, the spine density was reduced in the cerebral cortex and hippocampus of the mutant mice. Knockdown of ZFP804A impaired the neurite morphogenesis of cortical and hippocampal neurons, while its overexpression enhanced neurite morphogenesis only in the cortical neurons in vitro.	metal ion binding	Ani
Dlgap2	DLGAP2	protein-coding	Mus musculus	ENSMUSG00000047495	6430596N04Rik|Dap-2|Dap2|Sapap2	244310	Neurodevelopmental Disorders	8|8 A1.1	Mutated	129 S5;C57BL/6J	33347690	566	Expeimentalparadigm: Touchscreen test  /n  Model Generation: For breeding, male mice homozygous (<U+2212>/<U+2212>) for loss-of-function mutations in<U+00A0>Shank2,<U+00A0>Dlgap1<U+00A0>or<U+00A0>Dlgap2<U+00A0>and male mice heterozygous (+/<U+2212>) for<U+00A0>Syngap1<U+00A0>were obtained from the University of Edinburgh.<U+00A0>Shank2<U+2212>/<U+2212>,<U+00A0>Dlgap1<U+2212>/<U+2212><U+00A0>and<U+00A0>Dlgap2<U+2212>/<U+2212><U+00A0>mice were on a mixed 129 S5/C57BL/6J background (C57BL/6J background 50%–75%).With the exception of Syngap1+/<U+2212> animals, the progeny of these crosses were inter-crossed to generate experimental cohorts of Shank2, Dlgap1 and Dlgap2 heterozygous or homozygous mice and wild-type (WT) litter-matched controls.  /n  Rescue: -  /n  Model Summary: Here, by using genetically engineered mice and innovative touchscreen-based cognitive testing, we sought to investigate whether loss-of-function mutations in genes encoding key interactors of the PSD-95 protein complex display shared phenotypes in associative learning, updating of learned associations and reaction times. Our genetic dissection of mice with loss-of-function mutations in<U+00A0>Syngap1,<U+00A0>Nlgn3,<U+00A0>Dlgap1,<U+00A0>Dlgap2<U+00A0>and<U+00A0>Shank2<U+00A0>showed that distinct components of the PSD-95 protein complex differentially regulate learning, cognitive flexibility and reaction times in cognitive processing. These data provide insights for understanding how human mutations in these genes lead to the manifestation of diverse and complex phenotypes in NDDs.	protein domain specific binding,molecular adaptor activity	Ani
Itgae	ITGAE	protein-coding	Mus musculus	ENSMUSG00000005947	A530055J10|CD103|aM290|alpha-E1|alpha-M290	16407	Neurodevelopmental Disorders	11 B4|11 45.22 cM	Knockout	C57BL/6	33424735	567	Expeimentalparadigm: Open field test//Repetitive grooming test//Y-Maze spontaneous alternation //Barnes Maze//Social approach test  /n  Model Generation: Female C57BL/6, B6.Foxn1 mice, and syngeneic CD103-knockout strains (Jackson Labs) were housed in a pathogen–free vivarium under standard conditions on a 12-h light/12-h dark cycle with food and water<U+00A0>ad libitum.<U+00A0>  /n  Rescue: -  /n  Model Summary: CD103 Deficiency Promotes Autism (ASD) and Attention-Deficit Hyperactivity Disorder (ADHD) Behavioral Spectra and Reduces Age-Related Cognitive Decline	integrin binding,metal ion binding	Ani
Gpr139	GPR139	protein-coding	Mus musculus	ENSMUSG00000066197	GPRg1|Gm495|PGR3	209776	Schizophrenia	7|7 F2	Knockout	C57BL/6N	33479510	568	Expeimentalparadigm: Open field test//Novel object recognition test//Social interaction test//Acoustic startle response and pre-pulse inhibition//Cued fear conditioning//Water maze visual learning//Operant conditioning  /n  Model Generation: Gpr139<U+2212>/<U+2212> mouse strain (GPR139tm1.1(KOMP)Vleg) on pure C57BL/6N background was generated from embryonic stem cell clone 10338B-A5, created by Regeneron Pharmaceuticals Inc. and obtained from KOMP repository at the University of California, Davis.  /n  Rescue: Remarkably, a number of these behavioral deficits could be rescued by the administration of μ-opioid and D2 dopamine receptor (D2R) antagonists: naltrexone and haloperidol, respectively, suggesting that loss of neuropsychiatric manifestations in mice lacking GPR139 are driven by opioidergic and dopaminergic hyper-functionality.  /n  Model Summary: Here we present a comprehensive behavioral characterization of a mouse model with a GPR139 null mutation. We show that loss of GPR139 in mice results in delayed onset hyperactivity and prominent neuropsychiatric manifestations including elevated stereotypy, increased anxiety-related traits, delayed acquisition of operant responsiveness, disruption of cued fear conditioning and social interaction deficits. Furthermore, mice lacking GPR139 exhibited complete loss of pre-pulse inhibition and developed spontaneous 'hallucinogenic' head-twitches, altogether suggesting schizophrenia-like symptomatology.	G protein-coupled receptor activity,neuropeptide receptor activity,identical protein binding	Ani
Slc2a3	SLC2A3	protein-coding	Mus musculus	ENSMUSG00000003153	Glut-3|Glut3	20527	Attention-Deficit/Hyperactivity Disorder	6 F2|6 57.82 cM	Conditional Knockout	C57BL/6	33482226	569	Expeimentalparadigm: Accelerating rotating rod test//Open field test//Fear conditioning test//Morris water maze//Social interaction test  /n  Model Generation: Glut3flox/+ mice were generated on C57BL/6 background by inserting LoxP sites into introns 5 and 6 (Mouse Biology Program, University of California, Davis). We crossed male glut3flox/+ mice with female glut3flox/+ mice generating glut3flox/flox mice as previously described (Shin et al., 2018). For generation of glut3flox/flox/Cre+ by Cre/loxP recombination, we next crossed glut3flox/flox mice with transgenic mice that expressed Cre recombinase under the regulation of an Emx1 promoter, namely Emx1-Cre mice (B6.Cg-Tg[Emx1-cre]1Kln/J; Jackson Laboratory, USA), thereby creating glut3flox/+/Emx1-Cre+ mice. Subsequently, mating male glut3flox/+/Emx1-Cre+ mice with female glut3flox/+/Emx1-Cre+ mice generated glut3flox/flox/Emx1-Cre+ mice. Finally, female glut3flox/flox mice were crossed with male glut3flox/ flox /Emx1-Cre+ mice, generating the glut3 conditional knockout (KO) mice designated as glut3flox/flox/Emx1-Cre+ (homozygous KO). Since glut3flox/flox without Cre in preliminary studies expressed a phenotype no different from the wild type (wt, glut3) despite the introduction of loxP sites in two intronic regions, glut3+/+flox/flox served as the control (CON) genotype for our subsequent studies as previously described (Shin et al., 2018).  /n  Rescue: -  /n  Model Summary: These KO mice demonstrated sex-specific differences in brain and body weights (p = 0.0001 and p = 0.01 each) with reduced GLUT3 protein in cerebral cortices and brain stem (p = 0.005). In patch clamp studies the glut3 KO mice displayed a shorter latency to and enhanced paroxysmal activity (p = 0.01 and p = 0.015 each) in pyramidal neurons upon application of a GABAA antagonist, supporting hyperexcitability. Further, associated changes in neurobehavior consisted of reduced latency to fall in the rotorod motor test related to incoordination, increased distance traveled in total and periphery versus center in open field testing suggesting hyperactivity with anxiety (p = 0.0013 in male, p = 0.045 in female), reduced time freezing reminiscent of disrupted contextual fear conditioning (p = 0.0033), decreased time in target quadrant seen with spatial cognitive memory water maze testing (p = 0.034), and enhanced sociability particularly for novelty reflecting a lack of inhibition/impulsivity (p = 0.038). Some of these features were equally pronounced in males and females (cognitive) while others were seen in females (anxiety and impulsivity).	galactose transmembrane transporter activity,glucose transmembrane transporter activity,glucose binding,monosaccharide transmembrane transporter activity,hexose transmembrane transporter activity,galactoside binding,kinase binding,transmembrane transporter activity,xylose binding,dehydroascorbic acid transmembrane transporter activity,D-glucose transmembrane transporter activity	Ani
Tlr5	TLR5	protein-coding	Mus musculus	ENSMUSG00000079164	-	53791	Anxiety Disorder	1 H5|1 86.12 cM	Knockout	C57BL/6	33516921	570	Expeimentalparadigm: Elevated plus maze//Hole board test//Marble burying test//Novelty suppressed feeding//Forced swim test//Tail suspension test//Y-maze//Novel object recognition//Sociability and preference//Open field test//Social novelty test//Restraint stress and plasma corticosterone level  /n  Model Generation: TLR5 knock-out mice and their wild-type littermates from C57BL6 background were bred in our specific pathogen free (SPF) animal facility (Number D63.113.16, University Clermont Auvergne, Clermont-Ferrand, France).  /n  Rescue: -  /n  Model Summary: Here, we investigated the potential involvement of the flagellin receptor, TLR5, in anxiety, depression and cognitive behaviors using male TLR5 knock-out (KO) mice. We aobserved a specific low level of basal anxiety in TLR5 KO mice with an alteration of the hypothalamo-pituitary axis (HPA) response to acute restraint stress, illustrated by a decrease of both plasma corticosterone level and c-fos expression in the hypothalamic paraventricular nucleus where TLR5 was expressed, compared to WT littermates. However, depression and cognitive-related behaviors were not different between TLR5 KO and WT mice. Nor there were significant changes in the expression of some cytokines (IL-6, IL-10 and TNF-α) and other TLRs (TLR2, TLR3 and TLR4) in the prefrontal cortex, amygdala and hippocampus of TLR5 KO mice compared to WT mice. Moreover, mRNA expression of BDNF and glucocorticoid receptors in the hippocampus and amygdala, respectively, was not different. Finally, acute intracerebroventricular administration of flagellin, a specific TLR5 agonist, or chronic neomycin treatment did not exhibit a significant main effect, only a significant main effect of genotype was observed between TLR5 KO and WT mice.	transmembrane signaling receptor activity,interleukin-1 receptor binding,protein binding,signaling receptor activity	Ani
foxp1a	FOXP1	NA	Zebra Finch	NA	NA	NA	Autism Spectrum Disorder	NA	Knockdown	Zebra Finch	33536209	571	Expeimentalparadigm: Song analysis//Syntax analysis  /n  Model Generation: Experiments described in this study were conducted using juvenile and adult male zebra finches (30 to 130 dph).pscAAV-GFP-shFoxP1 was generated by polymerase chain reaction (PCR) amplification of U6-shFoxp1 from pLKO.1 (TRCN0000072005, Broad Institute) while adding Not I and Bam HI sites and then ligating into pscAAV9-CBh-GFP (46) digested with these enzymes.Briefly, AAV vectors (pscAAV-GFP-shFoxP1 or rAAV9/ds-CBh-GFP) were injected into HVC (50 nl per injection and ~60 injections, for a total of ~3 μl) at ~35 dph, and the transgenes were allowed to express for a minimum of 10 days.  /n  Rescue: -  /n  Model Summary: Here, we examine how disrupted expression of the ASD gene FOXP1, which causes severe impairments in speech and language learning, affects the cultural transmission of birdsong between adult and juvenile zebra finches. FoxP1 is widely expressed in striatal-projecting forebrain mirror neurons. Knockdown of FoxP1 in this circuit prevents juvenile birds from forming memories of an adult song model but does not interrupt learning how to vocally imitate a previously memorized song. This selective learning deficit is associated with potent disruptions to experience-dependent structural and synaptic plasticity in mirror neurons.<U+00A0>	NA	Ani
Macrod1	MACROD1	protein-coding	Mus musculus	ENSMUSG00000036278	D930010J01Rik|Lrp16	107227	Motor Disorders	19|19 A	Knockout	C57BL/6N	33578760	572	Expeimentalparadigm: Open field test//Y-Maze//Accelerating Rotarod//Four-Limb Hang Test//Link Lifting//Catwalk Gait Analysis//LMA Anxiogenic Open Field  /n  Model Generation: The<U+00A0>Macrod1<U+00A0>KO strain is a Knockout Mouse Programme (KOMP)-Regeneron (Velocigene) definitive null design (Project ID:VG13617) whereby most of exons 1 through to 3 are deleted and replaced with a promoter-driven Zen_Ub1 cassette [29]. In total 9303 bp were deleted between positions 7131384–7140686 of Chromosome 19 (Genome Build37).<U+00A0>  /n  Rescue: -  /n  Model Summary: Loss of<U+00A0>Macrod1<U+00A0>resulted in a female-specific motor-coordination defect, whereas<U+00A0>Macrod2<U+00A0>disruption was associated with hyperactivity that became more pronounced with age, in combination with a bradykinesia-like gait.<U+00A0>	hydrolase activity,hydrolase activity, acting on glycosyl bonds,deacetylase activity,ADP-ribosylglutamate hydrolase activity	Ani
Macrod2	MACROD2	protein-coding	Mus musculus	ENSMUSG00000068205	1110033L15Rik|2610107G07Rik|2900006F19Rik	72899	Motor Disorders	2|2 F3- G1	Knockout	C57BL/6N	33578760	573	Expeimentalparadigm: Open field test// Y-Maze//Accelerating Rotarod//Four-Limb Hang Test //Link Lifting//Catwalk Gait Analysis//LMA Anxiogenic Open Field  /n  Model Generation: The<U+00A0>Macrod2<U+00A0>KO strain is also a Velocigene definitive null design, whereby 19.2 kb (including part of exon 2) is deleted and replaced with a promoter-driven Zen_Ub1 cassette (Project ID:VG12650). In total 19,224 bp were deleted between positions 140226712–140245935 of Chromosome 2 (Genome Build37).<U+00A0>  /n  Rescue: -  /n  Model Summary: -	hydrolase activity,hydrolase activity, acting on glycosyl bonds,deacetylase activity,ADP-ribosylglutamate hydrolase activity	Ani
Arid1b	ARID1B	protein-coding	Mus musculus	ENSMUSG00000069729	8030481M12|9330189K18Rik|Ardi1b|B230217J03Rik|BAF250B|mKIAA1235	239985	Intellectual Disability	17|17 A1	Knockout	C57BL/6	33594090	574	Expeimentalparadigm: Novel object recognition test//Three-chamber test//Grooming//Elevated plus maze//Open field test//Forced swim test//Tail suspension test  /n  Model Generation: The ES cell clone used for creating the Arid1b mouse model was the JM8.N4 strain obtained from the European Conditional Mouse Mutagenesis program (EUCOMM) and contains a “knockout first” design (https://www.mousephenotype.org/data/alleles/MGI:1926129/tm1a(EUCOMM)Hmgu/ IKMC project ID: 25129). Exon 5 of the Arid1b gene was targeted to create a deletion allele. The knockout first allele for the Arid1b locus was created by injecting the targeted ES cell clones into the blastocysts derived from an albino C57BL6 strain (Jackson Laboratory, #000058) in the Mouse Genome Engineering Core Facility at the University of Nebraska Medical Center. The chimeras were first bred to a Flpo mouse strain (MMRRC UCD, stock # 036512) to delete the knockout first cassette in the intron 4–5 and convert the allele to the floxed allele. Elimination of the neomycin cassette was confirmed by PCR genotyping. The heterozygous floxed mice were crossed with appropriate Cre drivers for tissue-specific Arid1b deletion. To generate the global Arid1b KO allele, the knockout first allele was crossed with a CMV-Cre mouse strain (Jackson laboratory, #006054), and the resulting Arid1b KO allele in which the neo cassette, one FRT, one loxP, and exon 5 were removed was selected by genomic PCR and sequencing using appropriate primers. The genomic sequences showing the deletion break points of mutant genomic DNAs were shown in Supplementary Table 2. Based on the lack of protein in the null mice, we presume that the transcript from the deleted allele undergoes nonsense-mediated decay.  /n  Rescue: -  /n  Model Summary: Genetic evidence indicates that haploinsufficiency of ARID1B causes intellectual disability (ID) and autism spectrum disorder (ASD), but the neural function of ARID1B is largely unknown. Using both conditional and global Arid1b knockout mouse strains, we examined the role of ARID1B in neural progenitors. We detected an overall decrease in the proliferation of cortical and ventral neural progenitors following homozygous deletion of Arid1b, as well as altered cell cycle regulation and increased cell death. Each of these phenotypes was more pronounced in ventral neural progenitors. Furthermore, we observed decreased nuclear localization of β-catenin in Arid1b-deficient neurons. Conditional homozygous deletion of Arid1b in ventral neural progenitors led to pronounced ID- and ASD-like behaviors in mice, whereas the deletion in cortical neural progenitors resulted in minor cognitive deficits.	DNA binding,protein binding,nucleosome binding	Ani
Prdx6	PRDX6	protein-coding	Mus musculus	ENSMUSG00000026701	1-Cys Prx|1-cysPrx|9430088D19Rik|Aop2|Brp-12|CP-3|GPx|LPCAT-5|Ltw-4|Ltw4|Lvtw-4|NSGPx|ORF06|Prdx5|aiPLA2	11758	Posttraumatic Stress Disorder	1 H2.1|1 69.75 cM	Knockout	C57BL/6J	33632301	575	Expeimentalparadigm: Trace fear conditioning//Open field test//Three-chambers test//Marble burying test//Elevated plus maze  /n  Model Generation: A genomic clone containing the 129/SvJ (129)<U+00A0>Prdx6<U+00A0>gene was isolated as previously described (27). The clone was digested with<U+00A0>BglI, and a 5094-bp fragment containing the upstream regulatory regions (position 1606–6700) of the gene was isolated. This represented the 5′-arm of<U+00A0>Prdx6. The 3′-arm was isolated using a multiple step cloning method.  /n  Rescue: -  /n  Model Summary: Prdx6<U+2212>/<U+2212><U+00A0>mice exhibited enhanced fear learning and memory	catalytic activity,peroxidase activity,glutathione peroxidase activity,phospholipase A2 activity,protein binding,thioredoxin peroxidase activity,antioxidant activity,oxidoreductase activity,transferase activity,hydrolase activity,ubiquitin protein ligase binding,identical protein binding,1-acylglycerophosphocholine O-acyltransferase activity,calcium-independent phospholipase A2 activity,peroxiredoxin activity	Ani
Ldb2	LDB2	protein-coding	Mus musculus	ENSMUSG00000039706	CLIM1|CLP-36|Ldb3	16826	Schizophrenia	5|5 B3	Knockout	C57BL/6N	33656268	576	Expeimentalparadigm: Open‐field test//Homecage activity test//Y‐maze  /n  Model Generation: The animals had free access to standard lab chow and tap water. The inbred C57BL/6N (B6N) mice were obtained from Japan SLC (Hamamatsu, Japan). Sperm of the Ldb2 knockout (KO) mice, where the function of the gene was knocked out by the replacement of exon 1 with the lacZ/neor‐expression cassette, were obtained from the MMRRC (Mutant Mouse Resource & Resource Centers) (RRID: MMRRC_011733‐UCD, B6;129S5‐Ldb2tm1Lex/Mmucd). The sperm were subjected to in vitro fertilization with oocytes from B6N females. The fertilized eggs were transplanted into the uterus of pseudo‐pregnant dams to produce first generation animals. Genotyping was performed using genomic DNA from the tail by multiplex genomic PCR with the three primers: Neo3a (5’‐GCAGCGCATCGCCTTCTATC‐3’), 0813‐4 (5’‐AAGAACACAGCCCATGTGC‐3’), and 0813‐6 (5’‐TCTTGTTCATCTCATAGATTCG‐3’). To obtain the gene KO and wild‐type (WT) control mice, heterozygous mice produced by backcrossing the founder animal to the B6N strain for at least six generations were intercrossed. Basically, all animal experiments were done using male at 9–17 weeks after birth.  /n  Rescue: -  /n  Model Summary: We show here that Ldb2 knockout (KO) mice displayed multiple deficits relevant to mental disorders. In particular, Ldb2 KO mice exhibited deficits in the fear-conditioning paradigm.	transcription coregulator activity,protein binding,enzyme binding,LIM domain binding	Ani
Scn8a	SCN8A	protein-coding	Mus musculus	ENSMUSG00000023033	C630029C19Rik|NaCh6|Nav1.6|dmu|med|mnd-2|mnd2|nmf2|nmf335|nmf58|nur14|seal	20273	Intellectual Disability	15 56.39 cM|15 F1	Gene Editing(CRISPR/Cas9)	C57BL/6J	33658654	577	Expeimentalparadigm: Open field test//Novel object recognition test//Rotarod//Three-chamber test//Light-dark box test//Novel cage//Reciprocal interaction//Fear conditioning test  /n  Model Generation: Using CRISPR/Cas9 technology, we introduced the human R1620L mutation into the equivalent location of the mouse Scn8a gene (R1618 in the mouse) on the C57BL/6J background (Fig. 1A, Supplementary Fig. 1A). Cas9 protein was used for the mutagenesis since it has been shown to initiate editing in embryos more rapidly than Cas9 mRNA. Furthermore, Cas9 protein provides high editing efficiency, lower off-target effects, and reduced mosaicism compared to Cas9 mRNA [22, 23]. Two silent substitutions were also introduced in order to create a Taq 1 restriction enzyme site. Taq 1 digestion of the PCR product yielded two fragments (610 and 176<U+2009>bp) from the mutant allele, while the wild-type (WT) allele was identified by the uncut 786<U+2009>bp PCR product (Fig. 1B). Heterozygous mice (RL/+) were backcrossed to C57BL/6J mice (Strain: 000664, Jackson Laboratories) for four generations to eliminate off-target substitutions. To identify possible off-target substitutions, whole-genome sequencing was performed on 2 RL/+ mutants and 1 WT littermate at the N4 generation (PerkinElmer Genomics). Sequence data from all chromosomes were examined for coding variants that differed between the mutant and WT mice. The only observed nucleotide change that resulted in an amino acid substitution in the RL/+ mutants but not the WT littermates corresponded to the engineered mutation in Scn8a. We also performed Sanger sequencing of all Scn8a exons in a RL/+ mutant and confirmed the absence of unwanted substitutions.  /n  Rescue: -  /n  Model Summary: To date, the effects of SCN8A mutations that are primarily associated with behavioral abnormalities have not been studied in a mouse model. To better understand the phenotypic and functional consequences of the R1620L mutation, we used CRISPR/Cas9 technology to generate mice expressing the corresponding SCN8A amino acid substitution. Homozygous mutants exhibit tremors and a maximum lifespan of 22 days, while heterozygous mutants (RL/+) exhibit autistic-like behaviors, such as hyperactivity and learning and social deficits, increased seizure susceptibility, and spontaneous seizures. Current clamp analyses revealed a reduced threshold for firing action potentials in heterozygous CA3 pyramidal neurons and reduced firing frequency, suggesting that the R1620L mutation has both gain- and loss-of-function effects.	nucleotide binding,ion channel activity,voltage-gated ion channel activity,voltage-gated sodium channel activity,cation channel activity,sodium channel activity,protein binding,ATP binding,sodium ion binding	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Intellectual Disability	X A7.1|X 34.83 cM	Conditional Knockin	C57BL/6	33692361	578	Expeimentalparadigm: Locomotor activity//Isolation-induced ultrasonic vocalizations test//Novel object recognition test//Three-chamber test  /n  Model Generation: To assess the pathophysiological impact of the recurrent R138Q mutation in vivo, we generated a specific knock-in mouse line expressing the R138Q FXS mutation using classical homologous recombination in murine C57BL/6 embryonic stem (ES) cells (Fig. 1a). The R138Q coding mutation was introduced in exon 5 by changing the CGA arginine codon into a CAA nucleotide triplet coding for a glutamine (R138Q: c.413G>A). The integrity of the FXS mutation in the Fmr1R138Q mice was confirmed by genomic DNA sequencing (Fig. 1a).  /n  Rescue: -  /n  Model Summary: Fragile X syndrome (FXS) is the most frequent form of inherited intellectual disability and the best-described monogenic cause of autism. CGG-repeat expansion in the FMR1 gene leads to FMR1 silencing, loss-of-expression of the Fragile X Mental Retardation Protein (FMRP), and is a common cause of FXS. Missense mutations in the FMR1 gene were also identified in FXS patients, including the recurrent FMRP-R138Q mutation. To investigate the mechanisms underlying FXS caused by this mutation, we generated a knock-in mouse model (Fmr1R138Q) expressing the FMRP-R138Q protein. We demonstrate that, in the hippocampus of the Fmr1R138Q mice, neurons show an increased spine density associated with synaptic ultrastructural defects and increased AMPA receptor-surface expression. Combining biochemical assays, high-resolution imaging, electrophysiological recordings, and behavioural testing, we also show that the R138Q mutation results in impaired hippocampal long-term potentiation and socio-cognitive deficits in mice.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
npy	NPY	protein-coding	Zebrafish	ENSDARG00000036222	si:dkey-22m8.5	30281	Anxiety Disorder	-	Knockout	RIKEN	33721592	579	Expeimentalparadigm: Acute stress-induced behavior  /n  Model Generation: When establishing NPY-KO zebrafish, npy-specific guide RNAs (gRNAs) were designed for the zebrafish genome using CRISPRdirect25 to avoid off-targeting. Two gRNA candidates downstream of the first ATG were selected, target #1 was 5′-TTCTCTTGTTCGTCTGCTTGGGG-3′ and target #2 was 5′-CCCGACAACCCGGGAGAGGACGC-3′, and gRNAs were synthesized according to each target sequence (Fig. 1A and Supplemental Fig. 1). After microinjection of each gRNA/tracrRNA/rCas9 in one-cell-stage zebrafish embryos, genomic DNA was extracted from F0 embryos, and efficacy gRNAs for npy editing were estimated by conducting a heteroduplex mobility assay (HMA). Both gRNA#1- and gRNA#2-injected embryos showed double or triple bands, with a band shift with high efficacy (77.7 and 85.2% embryos with mutation in 27 gRNA-injected embryos, respectively), while a single band of a npy fragment was detected in wild-type embryos (Fig. 1B). These band patterns indicated the presence of various heterozygous npy alleles with mutation(s). DNA sequencing these HMA products revealed npy mutations in each RNA-injected embryo, confirming that npy genome editing by gRNAs was successful (Fig. 1C). As both gRNAs had high efficacy in inducing npy mutations, gRNA#1 was used for the establishment of the npy-knockout strain. The F0 founder was crossed with wild-type zebrafish to obtain the F1 generation (Fig. 1D). Two F1 pairs had the same type of npy mutation (7- and 11-base deletion) on one allele, and were selected using DNA sequencing to establish the F2 generation (Fig. 1E). F2 generations was co-housed before genotyping. The establishment of F2 with homozygous npy alleles with mutation was confirmed by HMA assay (Fig. 1F) and DNA sequencing of npy cDNA from the F2 also confirmed the 7- or 11-base deletion (Supplemental Fig. 3). In addition, cDNA from brain RNA was subjected to polymerase chain reaction (PCR) analysis with primers specific to intact npy, but not to the npy mutant (Fig. 1G). The expected PCR bands were found in wild-type fish but not in 7- and 11-base-deletion mutants. The 7- and 11-base deletion in npy caused a frame shift, and resulted in the induction of polypeptides that were different to mature zebrafish NPY (Fig. 1H). As the 7- and 11-deletions were present in the same exon with the region encoding Npy mature peptide, unexpected splicing valiant in 7- and 11-deletion mutant could not yield Npy mature peptides (Supplemental Fig. 1). By immunohistochemical analysis, NPY-positive neurons were detected around the central posterior thalamic nucleus (CP) in wild type zebrafish brain (Fig. 2), same as reported elsewhere21, while NPY-positive neurons were barely detected in wild type hypothalamus (Supplemental Fig. 4). Like no transcription of npy gene in NPY-KOs, NPY-positive neurons were not detected around the CP and in the hypothalamus of NPY-KO7 and KO11 (Fig. 2 and Supplemental Fig. 4). Weak signals detected in NPY-KO specimen would be due to artefact staining because there are not an alternative splicing isoform, other npy paralogs and other start codon inducing in-frame in NPY-KO mutants. As a result, npy-knockout zebrafish (NPY-KO) was established with a 7- or 11-base deletion and named NPY-KO7 and NPY-KO11, respectively.  /n  Rescue: -  /n  Model Summary: Recently, Kampo medicines have received focus as antidepressant drugs for clinical use because of their synergistic and additive effects. Thus, we evaluated the anxiolytic activity of Ninjinyoeito (NYT) using neuropeptide Y-knockout (NPY-KO) zebrafish that exhibit severe anxiety responses to acute stress. Adult NPY-KO zebrafish were fed either a 3% NYT-supplemented or normal diet (i.e., the control diet) for four days and were then examined via behavioral tests. After short-term cold stress (10 °C, 2 s) was applied, control-fed NPY-KO zebrafish exhibited anxiety behaviors such as freezing, erratic movement, and increased swimming time along the tank wall. On the other hand, NYT-fed NPY-KO zebrafish significantly suppressed these anxiety behaviors, accompanied by a downregulation of tyrosine hydroxylase levels and phosphorylation of extracellular signal-regulated kinases in the brain. To understand the responsible component(s) in NYT, twelve kinds of herbal medicines that composed NYT were tested in behavioral trials with the zebrafish. Among them, nine significantly reduced freezing behavior in NPY-KO zebrafish. In particular, Schisandra fruit induced the most potent effect on abnormal zebrafish behavior, even in the lower amount (0.3% equivalent to NYT), followed by Atractylodes rhizome and Cinnamon bark. Subsequently, four lignans uniquely found in Schisandra fruit (i.e., gomisin A, gomisin N, schizandrin, and schizandrin B) were investigated for their anxiolytic activity in NPY-KO zebrafish. As a result, schizandrin was identified as a responsible compound in the anxiolytic effect of NYT.	G protein-coupled receptor binding,hormone activity,neuropeptide hormone activity,protein binding,neuropeptide Y receptor binding,type 2 neuropeptide Y receptor binding	Ani
Ppm1f	PPM1F	protein-coding	Mus musculus	ENSMUSG00000026181	1110021B16Rik|4933427B07Rik|CaMKPase|Popx2|mKIAA0015	68606	Anxiety Disorder	16|16 A3	Conditional Knockout	CamK-cre93;CamK-cre159	33745117	580	Expeimentalparadigm: Acute or chronic restrain stress//Light–dark box test//Elevated plus maze test//Open field test  /n  Model Generation: Male and female wild-type (WT) C57BL/6J (Stock No. 000664) and Bdnfflox/flox (Stock No. 004339) mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and maintained as a breeding colony. Bdnfflox/flox mice possess loxP sites flanking the region encoding exon 9 of the Bdnf gene [28]. For genotyping, the following PCR primers were used: Bdnf, WT, and flox: forward-5′-TGTGATTGTGTTTCTGGTGAC-3′ and reverse-5′-GCCTTCATGC AACCGAAGTATG-3′.  /n  Rescue: -  /n  Model Summary: In this study, we showed that chronic restraint stress (CRS) induced anxiety-related behaviors only in female mice, while acute restraint stress (ARS) produced anxiety-related behaviors in both male and female mice in light-dark and elevated plus maze tests and induced upregulation of PPM1F and downregulation of brain-derived neurotrophic factor (BDNF) expression in the hippocampus. Adeno-associated virus-mediated overexpression of PPM1F or conditional knockout of BDNF in dentate gyrus (DG) led to a more pronounced anxiety-related behavior in female than in male mice as indicated by the behavioral evaluations. Meanwhile, overexpression of PPM1F in the DG decreased total Bdnf exon-specific messenger RNA expression in the hippocampus with the decreased binding activity of phosphorylated H3S10 to its individual promoters in female mice. Furthermore, we identified that overexpression of PPM1F decreased the phosphorylation levels of AKT and JNK in the hippocampus of female mice.	phosphoprotein phosphatase activity,protein serine/threonine phosphatase activity,protein tyrosine/serine/threonine phosphatase activity,hydrolase activity,myosin phosphatase activity,calmodulin-dependent protein phosphatase activity,cation binding,metal ion binding	Ani
Ftsj1	FTSJ1	protein-coding	Mus musculus	ENSMUSG00000031171	Ftsj|Ftsjl|Sfc12	54632	Intellectual Disability	X A1.1|X 3.73 cM	Knockout	C57BL/6J	33771871	581	Expeimentalparadigm: Open field test//Elevated plus maze//Barnes maze//Fear conditioning test  /n  Model Generation: Ftsj1 gene trapped mice were generated by microinjection of gene trapped ES-cells. The mouse embryonic stem cell line RRD143 (129P2/OlaHsd) containing a gene trap insertion in intron 5 of the Ftsj1 gene was obtained from Baygenomics and expanded on a layer of cell division deficient mouse embryonic feeder cells. Blastocysts were obtained from hormonally stimulated (superovulating) female C57BL/6J mice. The round and smooth ES-cells were injected into the blastocyst cavity and surgically transferred into pseudo-pregnant recipient female mice using standard methods, essentially as described [49]. Chimeric pups were identified by the presence of brown coat spots and bred to select for germline transmission. Offspring harboring gene trapped Ftsj1 were then backcrossed to a C57BL/6J genetic background for at least 10 generations before they were expanded to provide wild type and gene trapped littermates of both sexes for phenotypic characterization. In this process we also removed other gene traps that could have been integrated in the genomic DNA during the RRD143 cell line generation. For the mouse characterization at the German Mouse Clinic (www.mouseclinic.de) a cohort of 54 animals were used. 12 Ftsj1-/y males, 15 control males, 12 Ftsj1-/- females and 15 Ftsj1-/x control female mice were born within one week from the mating of hemizygous Ftsj1 gene trapped males with heterozygous females.  /n  Rescue: -  /n  Model Summary: FtsJ RNA 2'-O-methyltransferase 1 (FTSJ1) gene has been implicated in X-linked intellectual disability (XLID), but the molecular pathogenesis is unknown. We show that Ftsj1 is responsible for 2'-O-methylation of 11 species of cytosolic transfer RNAs (tRNAs) at the anticodon region, and these modifications are abolished in Ftsj1 knockout (KO) mice and XLID patient-derived cells. Loss of 2'-O-methylation in Ftsj1 KO mouse selectively reduced the steady-state level of tRNAPhe in the brain, resulting in a slow decoding at Phe codons. Ribosome profiling showed that translation efficiency is significantly reduced in a subset of genes that need to be efficiently translated to support synaptic organization and functions. Ftsj1 KO mice display immature synaptic morphology and aberrant synaptic plasticity, which are associated with anxiety-like and memory deficits.	RNA methyltransferase activity,tRNA methyltransferase activity,tRNA (guanosine-2'-O-)-methyltransferase activity,tRNA (cytosine-2'-O-)-methyltransferase activity	Ani
Phf6	PHF6	protein-coding	Mus musculus	ENSMUSG00000025626	2700007B13Rik|4931428F02Rik|mKIAA1823	70998	Intellectual Disability	X|X A5	Transgene(CRISPR/Cas9)	C57BL/6	33772537	582	Expeimentalparadigm: Elevated plus maze//Open field test//Forced swm test//Y-maze  /n  Model Generation: Guide RNA sequences (Supplementary Material, Table S3) were designed to target exon 10 of the mouse Phf6 gene using the online CRISPR tool (crispr.genome-engineering.org) developed by Ran et al. (34). Guide sequences were annealed and cloned into the PX458 plasmid (pSpCas9(BB)-2A-GFP; Addgene #48138). A 120-nucleotide single stranded oligomer (Supplementary Material, Table S3) homologous to the targeted region and containing the C to T mutation (c.1024 C<U+2009>><U+2009>T) and two restriction sites (HindIII for screening and XhoI that altered the Cas9 recognition sequence) was electroporated into the R1 mESCs with the targeting plasmid using the P3 Primary Cell 4D-Nucleofector X Kit manufacturer’s protocol (Lonza). Two days later, the mESCs were harvested, filtered through a cell strainer to generate a single cell suspension for FACS sorting (OHRI StemCore Flow Cytometry Facility). GFP fluorescent and 7-AAD negative cells were sorted into individual wells of gelatin and MEF coated 96 well plates for expansion and screening. Genomic DNA isolated from individual clones was used for PCR amplification and HindIII restriction analysis of the targeted region. Positive clones were confirmed by sequencing and subsequently screened for off-target indels using the SURVEYOR assay (Surveyor Mutation Detection Kit, IDT). The SURVEYOR assay was performed with PCR amplicons (Supplementary Material, Table S3) for the top four predicted off-target sites as described previously (34). Of 56 GFP-positive cells, five contained the HindIII restriction site and one remained positive after sequencing and SURVEYOR screening. This single clone was cultured and passaged for 7 days then harvested and provided to the University of Ottawa Transgenic Mouse Core Facility for blastocyst injections using a previously described protocol (53). Four chimeric mice harboring the Phf6 R342X mutation were obtained and two showed germline transmission when bred to C57BL/6 female mice.  /n  Rescue: -  /n  Model Summary: The PHF6 mutation c.1024C > T; p.R342X, is a recurrent cause of B<U+00F6>rjeson-Forssman-Lehmann Syndrome (BFLS), a neurodevelopmental disorder characterized by moderate-severe intellectual disability, truncal obesity, gynecomastia, hypogonadism, long tapering fingers and large ears (MIM#301900). Here, we generated transgenic mice with the identical substitution (R342X mice) using CRISPR technology. We show that the p.R342X mutation causes a reduction in PHF6 protein levels, in both human and mice, from nonsense-mediated decay and nonsense-associated alternative splicing, respectively. Magnetic resonance imaging studies indicated that R342X mice had a reduced brain volume on a mixed genetic background but developed hydrocephaly and a high incidence of postnatal death on a C57BL/6 background. Cortical development proceeded normally, while hippocampus and hypothalamus relative brain volumes were altered. A hypoplastic anterior pituitary was also observed that likely contributes to the small size of the R342X mice. Behavior testing demonstrated deficits in associative learning, spatial memory and an anxiolytic phenotype.	DNA binding,tubulin binding,enzyme binding,histone binding,histone deacetylase binding,ribonucleoprotein complex binding,metal ion binding,phosphoprotein binding,scaffold protein binding	Ani
Dyrk1a	DYRK1A	protein-coding	Mus musculus	ENSMUSG00000022897	2310043O08Rik|D16Ertd272e|D16Ertd493e|Dyrk|Gm10783|Mnbh|Mp86|mmb	13548	Intellectual Disability	16 C4|16 55.3 cM	Conditional Knockout	C57BL/6-Dyrk1atm1Jdc/J, Gt (ROSA)26Sortm14 (CAG-tdTomato)Hze/J, Mtortm1.2Koz, Emx1tm1 (cre)Krj, B6	33840455	583	Expeimentalparadigm: Three-chamber test//Tail suspension test//Open field test  /n  Model Generation: All mice used in the study were obtained from the Jackson Laboratory (Bar Harbor, ME) or MMRC and have been previously described, including C57BL/6-Dyrk1atm1Jdc/J (Dyrk1aloxP/loxP, stock #027801), Gt (ROSA)26Sortm14 (CAG-tdTomato)Hze/J (Ai14 or tdTomato, stock #007914), Ptentm1Hwu (PtenloxP/loxP, stock #006440), Mtortm1.2Koz (MtorloxP/loxP, stock #011009), Emx1tm1 (cre)Krj (Emx1-cre+/-, stock #005628), and B6.FVB (Cg)-Tg (Rbp4-cre)KL100Gsat/Mmucd (Rbp4-cre+/-, stock #037128-UCD). Wild-type and Emx1-cre; Dyrk1a-loxP/+ mice were used as controls. To avoid germline recombination in males, Emx1-cre;Dyrk1a-loxP/loxP males were bred with Emx1-cre;Dyrk1a+loxP/+ females. The same breeding strategy was used for experiments involving Rbp4-cre, mTORloxP/loxP, and PtenloxP/+. Genomic DNA isolated from ear samples was used for polymerase chain reaction to confirm genotypes. All animal experiments were conducted in accordance with National Institutes of Health and Association for Assessment and Accreditation of Laboratory Animal Care guidelines and were approved by The Scripps Research Institute’s Institutional Animal Care and Use Committee. Mixed sexes were used for all cellular and molecular assays. Male mice were used for behavioral experiments. Mixed sexes of even numbers were used for proteomic analysis, and females were used for phosphoenrichment and analysis.  /n  Rescue: Genetic suppression of Pten or pharmacological treatment with IGF-1 (insulin-like growth factor-1), both of which impinge on these signaling cascades, rescued microcephaly and neuronal undergrowth in neonatal mutants.  /n  Model Summary: We found that cortical deletion of Dyrk1a in mice causes decreased brain mass and neuronal size, structural hypoconnectivity, and autism-relevant behaviors. Using phosphoproteomic screening, we identified growth-associated signaling cascades dysregulated upon Dyrk1a deletion, including TrkB-BDNF (tyrosine receptor kinase B-brain-derived neurotrophic factor), an important regulator of ERK/MAPK (extracellular signal-regulated kinase/mitogen-activated protein kinase) and mTOR (mammalian target of rapamycin) signaling.	nucleotide binding,transcription coactivator activity,actin binding,protein kinase activity,protein serine/threonine kinase activity,protein serine/threonine/tyrosine kinase activity,protein tyrosine kinase activity,non-membrane spanning protein tyrosine kinase activity,protein binding,ATP binding,cytoskeletal protein binding,RNA polymerase II CTD heptapeptide repeat kinase activity,tubulin binding,kinase activity,transferase activity,identical protein binding,protein self-association,tau protein binding,histone H3T45 kinase activity	Ani
Stat3	STAT3	protein-coding	Mus musculus	ENSMUSG00000004040	1110034C02Rik|Aprf	20848	Anxiety Disorder	11 D|11 63.82 cM	Conditional Knockout	STAT3-loxP;B6.SJL-Slc6a3tm1.1（cre）Bkmn/J	33872705	584	Expeimentalparadigm: Physical activity//Palatable food preference//Conditioned place preference//Amphetamine locomotor sensitization//Basal and stress-induced corticosterone//Open field test//Elevated plus maze//Forced swim test//Tail suspension test  /n  Model Generation: STAT3-loxP mice (C57Bl6 background) in which loxP sites flank exon 22 of the STAT3 gene that encodes a tyrosine residue (tyr705) essential for STAT3 activation were graciously provided by Dr. Shizuo Akira (Osaka, Japan) (Takeda et al., 1998). Female mice homozygous for the floxed STAT3 allele were crossed with male mice heterozygous for the floxed STAT3 allele and heterozygous for the dopamine transporter (DAT)::Cre transgene (B6.SJL-Slc6a3tm1.1(cre)Bkmn/J) (Backman et al., 2006) to generate DATCre;STAT3fl/fl mice (hereafter referred to as “STAT3DAT KO”) and littermate controls (“CTRL”; STAT3fl/fl or STAT3fl) (Fig. 1A). We previously demonstrated that presence of the DAT::Cre transgene in mice from this strain and from our colony do not exhibit differences in wheel running relative to wildtype littermates (Fernandes et al., 2015). Mice were genotyped using genomic DNA derived from juvenile tail-cuts using the Extract-N-Amp PCR kit (Sigma Aldrich). STAT3DAT KO mice were identified by dual PCR amplification using primers for the DAT::Cre sequence (Backman et al., 2006) and the STAT3-loxP sequence (Takeda et al., 1998). To substantiate Cre recombination, genomic DNA (200 ng) was isolated from brain tissue punches and peripheral tissue using Trizol and subjected to PCR using the following primers: a- 5′-CAC ACA AGC CAT CAA ACT CTG GTC TCC-3′ (specific for exon 22 of the STAT3 gene) b- 5′-GAT TTG AGT CAG GGA TCC ATA ACT TCG -3′ (specific for loxP site upstream of the targeting construct). This strategy permitted verification of the new, recombined STAT3 genomic sequence (“ΔSTAT3”) and its restriction to regions in which DAT is expressed (Supplementary Fig. 1A).  /n  Rescue: In accordance with biochemical evidence of increased D1 receptor signaling (phospho-DARPP32Thr34) in the central nucleus of the amygdala (CeA) of knockout mice, local microinjections of a D1 receptor antagonist reversed the anxiogenic phenotype of knockout mice.  /n  Model Summary: To assess the contribution of STAT3 signaling in mesolimbic DA neurons on feeding, mesolimbic DA tone and anxiodepressive behaviors in female mice, we generated DA-specific STAT3 knockout mice by crossing mice expressing Cre under the control of the dopamine transporter with STAT3-LoxP mice. Feeding, locomotion, wheel running, conditioned place preference for palatable food and amphetamine locomotor sensitization were unaffected by DA-specific STAT3 deletion. Conversely, knockout mice exhibited heightened anxiety-like behavior (open field test and elevated plus maze) along with increased basal and stress-induced plasma corticosterone, whereas indices of behavioral despair (forced swim and tail-suspension tasks) were unchanged. In accordance with biochemical evidence of increased D1 receptor signaling (phospho-DARPP32Thr34) in the central nucleus of the amygdala (CeA) of knockout mice, local microinjections of a D1 receptor antagonist reversed the anxiogenic phenotype of knockout mice.	transcription cis-regulatory region binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear receptor activity,signaling receptor binding,protein binding,protein kinase binding,protein phosphatase binding,chromatin DNA binding,CCR5 chemokine receptor binding,nuclear glucocorticoid receptor binding,signaling adaptor activity,identical protein binding,protein homodimerization activity,sequence-specific DNA binding,protein dimerization activity,RNA polymerase II-specific DNA-binding transcription factor binding,primary miRNA binding,DNA-binding transcription factor binding	Ani
Ucp2	UCP2	protein-coding	Mus musculus	ENSMUSG00000033685	Slc25a8|UCP 2|UCPH	22228	Anxiety Disorder	7 E2|7 54.36 cM	Conditional Knockout	B6;129S<U+00A0>-Ucp2<U+00A0>tm2<U+00A0>.<U+00A0>1Lowl<U+00A0>/J	33879866	585	Expeimentalparadigm: Elevated zero maze//Open field test//Novel object recognition test//Marble burying test//Y maze  /n  Model Generation: Both male and female, adult microglial specific Ucp2 knock-out mice (Ucp2MGKO), and their littermate controls (Ucp2+/+-Cx3cr1-cre) were used in the study. Ucp2MGKO mice were generated by crossing mice expressing tamoxifen-inducible Cre recombinase (CreERT2) in cells expressing CX3CR1 (Cx3cr1-cre:ERT2) and tdTomato reporter (Ai14; cre recombinase-dependent expression) with mice harboring conditional alleles of Ucp2 (Ucp2fl/fl mice) [11].  /n  Rescue: -  /n  Model Summary: By examining microglia-neuronal interaction in the ventral hippocampus, we found a significant reduction in spine synapse number during the light phase of the light/dark cycle accompanied by increased microglia-synapse contacts and an elevated amount of microglial phagocytic inclusions. This was followed by a transient rise in microglial production of reactive oxygen species (ROS) and a concurrent increase in expression of uncoupling protein 2 (Ucp2), a regulator of mitochondrial ROS generation. Conditional ablation of Ucp2 from microglia hindered phasic elimination of spine synapses with consequent accumulations of ROS and lysosome-lipid droplet complexes, which resulted in hippocampal neuronal circuit dysfunctions assessed by electrophysiology, and altered anxiety-like behavior.	oxidative phosphorylation uncoupler activity,transmembrane transporter activity	Ani
Cpeb3	CPEB3	protein-coding	Mus musculus	ENSMUSG00000039652	4831444O18Rik|CPE-BP3|mKIAA0940	208922	Posttraumatic Stress Disorder	19|19 C2	Knockout	C57BL/6J	33941859	586	Expeimentalparadigm: Context-dependent auditory fear acquisition and extinction  /n  Model Generation: The genomic BAC clone (RP23-56A17) containing the 5′-portion of the C57BL/6J mouse CPEB3 gene was used to construct the targeting vector by the recombineering technique according to the manufacturer's instructions (Gene Bridges). Briefly, a loxP-Neo-loxP cassette was first recombined into the 3′-end of exon 2 and excised with recombinant Cre (New England Biolabs)<U+00A0>in vitro<U+00A0>to result in a single loxP site. The resulting plasmid was recombineered with the Frt-PGK-Neo-Frt-loxP cassette to the 5′-end of exon 2. The plasmid was linearized with NruI and electroporated into C57BL/6J ES cells. Four correct clones of 258 G418-resistant clones were injected into c2J blastocysts. Only one clone derived a germline-transmitted line. The mouse carrying floxed allele was first crossed with Frt recombinase driven by the β-actin promoter to remove the Frt-PGK-Neo-Frt cassette.<U+00A0>  /n  Rescue: -  /n  Model Summary: Here, using a context-dependent auditory fear conditioning and extinction paradigm, we found that CPEB3-Knockout mice exhibited traumatic intensity-dependent PTSD-like fear memory.	mRNA regulatory element binding translation repressor activity,nucleic acid binding,RNA binding,mRNA 3'-UTR binding,protein binding,translation factor activity, RNA binding,RNA stem-loop binding,mRNA 3'-UTR AU-rich region binding,ribosome binding,translation regulator activity	Ani
Otx2	OTX2	protein-coding	Mus musculus	ENSMUSG00000021848	E130306E05Rik	18424	Anxiety Disorder	14 C1|14 25.36 cM	Targeted(Knockin)	B6D2	33963285	587	Expeimentalparadigm: Elevated plus maze//Light-dark box test//Rotarod//Tail-suspension test//Forced swim test//Prepulse inhibition test  /n  Model Generation: The Otx2-het mouse line was generated in the laboratory of Antonio Simeone (CEINGE, Naples), with the Otx2 coding sequence and introns replaced by GFP [23]. Otx2+/GFP males were crossed with B6D2F1 females to obtain Otx2-het mice. The Otx2+/AA mouse line was generated through a knock-in approach, as described previously [24]. The conditional secreted single-chain antibody (scFv) OTX2 scFvOtx2tg/0 mouse line was generated by targeted transgenics in the Rosa26 locus, as described previously [25].  /n  Rescue: We found reduced expression of parvalbumin in medial prefrontal cortex, which could be rescued in part by adult overexpression of Otx2 specifically in choroid plexus, resulting in increased anxiety-like behavior.  /n  Model Summary: Here, we investigated the consequences of reduced OTX2 levels in Otx2 heterozygote mice, as well as in Otx2+/AA and scFvOtx2tg/0 mouse models for decreasing OTX2 transfer from choroid plexus to parvalbumin interneurons. Both male and female adult mice show anxiolysis-like phenotypes in all three models. In Otx2 heterozygote mice, we observed no changes in dopaminergic neuron numbers and morphology in ventral tegmental area, nor in their metabolic output and projections to target structures. However, we found reduced expression of parvalbumin in medial prefrontal cortex, which could be rescued in part by adult overexpression of Otx2 specifically in choroid plexus, resulting in increased anxiety-like behavior.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,cis-regulatory region sequence-specific DNA binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,protein binding,sequence-specific double-stranded DNA binding	Ani
Setd2	SETD2	protein-coding	Mus musculus	ENSMUSG00000044791	4921524K10Rik|KMT3A	235626	Anxiety Disorder	9|9 F2	Gene Editing(CRISPR/Cas9)	C57BL/6J(GRCm38)	34014281	588	Expeimentalparadigm: Elevated plus maze//Light-dark box test//Open field test  /n  Model Generation: Point missense mutant R2483H allele of Setd2 (Setd2SRI/wt) mice were generated by the CRISPR/Cas9 system using C57BL/6J (GRCm38) mice with the single guide RNA (sgRNA) sequence T TTC AAG CAC CTC GCC CGA AAG G in exon 20. The R2483H point variant (CGA → CAT) was created. Two silent mutations L2481L (CTC → CTT) and A2482A (GCC → GCG) were added to interrupt the sgRNA site and create a novel FspI restriction site for genotyping. PCR was performed using genomic DNA from tail biopsies. The primers were TTG TTG GCC TAG ACA GCA GC and GAT TGG GGC AAG CTG GTA CA. Digestion of the PCR product (408<U+2009>bp) with FspI generates 214<U+2009>bp and 194<U+2009>bp DNAs in R2483H mutants.  /n  Rescue: -  /n  Model Summary: We report here that cytoskeletal methylation by SETD2 occurs in the mouse brain, and is prominent in neurites and growth cones of post-mitotic neurons. Homozygosity or hemizygosity for a mutant SRI allele, Setd2SRI/SRI or Nestin-Cre:Setd2flox/SRI, respectively, was lethal even though this SRI domain mutation preserves catalytic methyltransferase activity and binding to phosphorylated RNA polymerase II. While heterozygous Setd2SRI/wt mice with only one wild-type (wt) allele lived to adulthood, male Setd2SRI/wt mice exhibited an anxiety-like phenotype, and cultured neurons from Setd2SRI/wt mice showed significant deficits in both axon length and dendritic arborization. These data demonstrate that heterozygosity for an α-tubulin methylation-defective allele is sufficient to cause an ASD-associated co-morbidity (anxiety), and suggest that defects in cytoskeletal processes involved in neuronal differentiation and dendritic maturation may contribute to disease pathogenesis in individuals carrying heterozygous SETD2 mutations.	methyltransferase activity,protein-lysine N-methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,alpha-tubulin binding,metal ion binding,histone H3K36 methyltransferase activity	Ani
B2m	B2M	protein-coding	Mus musculus	ENSMUSG00000060802	Ly-m11|beta2-m|beta2m	12010	Attention-Deficit/Hyperactivity Disorder	2 E5|2 60.55 cM	Knockout	C57BL6/J	34022373	589	Expeimentalparadigm: Locomotion test//Place learning and reversal learning task//Simple reaction time task//Delay discounting task//Social behavior test//Prepulse inhibition  /n  Model Generation: Male mice at the age of 8–12<U+202F>weeks with a constitutive homozygous deletion of the β2m and TAP1 genes (β2m<U+2212>/<U+2212>Tap1<U+2212>/<U+2212>) and their wild-type (WT) littermates were used throughout the study except for the developmental locomotor analysis, where male<U+00A0>β2m<U+2212>/<U+2212>Tap1<U+2212>/<U+2212><U+00A0>and WT mice from 22 to 70<U+202F>days old were used. WT and<U+00A0>DKO mice<U+00A0>were generated by breeding heterozygous mutants, maintained in a C57BL6/J background.<U+00A0>  /n  Rescue: Low-dose methylphenidate, used for the treatment of ADHD patients, alleviated the three behavioral symptoms and suppressed c-Fos expression in the D1R-expressing medium spiny neurons of the mice.  /n  Model Summary: Functional<U+00A0>MHCI<U+00A0>KO mice showed ADHD-like symptoms.Low-dose methylphenidate alleviated ADHD-like symptoms in functional MHCI KO mice.	protein binding,MHC class II protein complex binding,identical protein binding,protein homodimerization activity	Ani
Tap1	TAP1	protein-coding	Mus musculus	ENSMUSG00000037321	ABC17|APT1|Abcb2|Ham-1|Ham1|MTP1|PSF1|RING4|TAP|Tap-1|Y3	21354	Attention-Deficit/Hyperactivity Disorder	17 B1|17 17.98 cM	Knockout	C57BL6/J	34022373	590	Expeimentalparadigm: Locomotion test//Place learning and reversal learning task//Simple reaction time task//Delay discounting task//Social behavior test//Prepulse inhibition  /n  Model Generation: Male mice at the age of 8–12<U+202F>weeks with a constitutive homozygous deletion of the β2m and TAP1 genes (β2m<U+2212>/<U+2212>Tap1<U+2212>/<U+2212>) and their wild-type (WT) littermates were used throughout the study except for the developmental locomotor analysis, where male<U+00A0>β2m<U+2212>/<U+2212>Tap1<U+2212>/<U+2212><U+00A0>and WT mice from 22 to 70<U+202F>days old were used. WT and<U+00A0>DKO mice<U+00A0>were generated by breeding heterozygous mutants, maintained in a C57BL6/J background.<U+00A0>  /n  Rescue: Low-dose methylphenidate, used for the treatment of ADHD patients, alleviated the three behavioral symptoms and suppressed c-Fos expression in the D1R-expressing medium spiny neurons of the mice.  /n  Model Summary: Functional<U+00A0>MHCI<U+00A0>KO mice showed ADHD-like symptoms.Low-dose methylphenidate alleviated ADHD-like symptoms in functional MHCI KO mice.	nucleotide binding,ATP binding,ABC-type peptide antigen transporter activity,ABC-type peptide transporter activity,ATP hydrolysis activity,MHC class Ib protein binding,MHC protein binding,MHC class I protein binding,peptide antigen binding,ATPase-coupled transmembrane transporter activity,protein homodimerization activity,ADP binding,protein-containing complex binding,metal ion binding,TAP1 binding,TAP2 binding,tapasin binding,ABC-type transporter activity,peptide transmembrane transporter activity	Ani
Rab39b	RAB39B	protein-coding	Mus musculus	ENSMUSG00000031202	6330580M05Rik	67790	Intellectual Disability	X 38.26 cM|X A7.3	Knockout	C57BL/6N	34035473	591	Expeimentalparadigm: Emergence test//Novelty test//Water maze//Radial maze//Spontaneous alternation//Fear conditioning  /n  Model Generation: The murine Rab39b gene mapped to the mouse X chromosome in XA7.3 occupying a region of 6187 base pairs (bp) (NC_000086.7). It is composed of two exons of 215 and 427 bp spaced out by one 2785 bp intron. The 5′- and 3′- untranslated regions (UTRs) flanking the two exons were 224 bp and 2536 bp, respectively. Rab39b-/Y mice (Rab39b KnockOut, KO) were generated by injecting three gRNAs (Sigma-Aldrich; #MM0000573711; #MM0000573712; #MM0000573713) targeting different DNA sequences in the 1st Rab39b exon, together with Cas9 mRNA in C57Bl/6N murine zygotes [24]. We obtained 15/76 pups carrying different insertion/deletion (indel) mutations, and we selected heterozygote females carrying a deletion of 14 bp or an insertion of 10 bp, giving a frame shift and a premature stop codon after 84 and 92 amino acids, respectively, from guide #MM0000573713. Possible off-targets were excluded by CCTop [25]. Heterozygous females were crossed with C57Bl/6N wild-type (WT) males (Charles River, Italy) to monitor the transmission of the mutant allele in the expected Mendelian segregation ratio of an X chromosome gene in N1 generation. Genotypes were determined by sequencing the portion of DNA surrounding the mutation (MyGATC from Eurofins Genomics; 1385-primer: 5′-TGTTTGTCACCCTGGCAGCATCG-3′) after PCR amplification with New_5′ARM_Sal_For (5′-GGTTGTCGACCAGGCCAGTGATGTTCTCGCGG-3′) and 1385 primers. Generations up to N6 were obtained by backcrossing Rab39b heterozygote females carrying a 14 bp deletion or a 10 bp insertion with C57Bl/6N WT males to establish murine lines. For all the experiments, except for those depicted in Fig. 1b, c, Rab39b KO 14-bp male mice and their WT littermates were used.  /n  Rescue: The persistence of immature circuits is triggered by increased hypermobility of the spine, which is restored by the Ca2+-permeable AMPAR antagonist NASPM.  /n  Model Summary: Mutations in the RAB39B gene cause X-linked intellectual disability (XLID), comorbid with autism spectrum disorders or early Parkinson's disease. One of the functions of the neuronal small GTPase RAB39B is to drive GluA2/GluA3 α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) maturation and trafficking, determining AMPAR subunit composition at glutamatergic postsynaptic neuronal terminals. Taking advantage of the Rab39b knockout murine model, we show that a lack of RAB39B affects neuronal dendritic spine refinement, prompting a more Ca2+-permeable and excitable synaptic network, which correlates with an immature spine arrangement and behavioural and cognitive alterations in adult mice.	nucleotide binding,GTPase activity,protein binding,GTP binding,myosin V binding	Ani
Cdkl5	CDKL5	protein-coding	Mus musculus	ENSMUSG00000031292	Stk9	382253	Intellectual Disability	X F4|X 73.95 cM	Knockout	C57BL/6N	34094641	592	Expeimentalparadigm: Marble burying test//Hind-limb clasping//Rotarod//Morris water maze//Assessment of visual responses//Fear conditioning test//Non-invasive assessment of sleep and breathing pattern  /n  Model Generation: A 10 kb genomic fragment containing exon 4 of Cdkl5 (ENSMUSE00000346596) was subcloned into a pDTA targeting plasmid by recombineering-mediated transfer from a 178-kb genomic fragment containing the C57BL/6J mouse Cdkl5 locus (RP23-213O8, ChoriBACPAC, Oklahoma, CA). A loxP site was inserted 806 bp upstream of the exon by recombineering-mediated insertion of a loxP-flanked pEM7::kanamycin gene and subsequent Cre recombination. An FRT-flanked pEM7/PGK::neomycin selection cassette was inserted 347 bp downstream of exon 4. The plasmid was linearized with NruI before electroporation into ES cells (129/Sv×C57BL/6N, clone A8, gift of A. Wutz, Wellcome Trust Centre for Stem Cell Research, Stem Cell Institute, University of Cambridge). G418-resistent clones were identified and screened by long-range PCR. Hybridization with a specific probe for the 5′ and 3′ arms was used to confirm PCR results. Two independent positive ES cell clones were injected into C57BL/6N host embryos using a piezo-drill assisted 8-cell stage injection procedure developed at EMBL. Four out of five offspring (all >95% ES cell derived) provided germline transmission. Positive offspring were crossed to C57BL/6J congenic FLP-deleter mice [16] to remove the neomycin selection cassette and further crossed to C57BL/6J congenic Cre-deleter mice [17] to generate the Cdkl5 null allele.  /n  Rescue: -  /n  Model Summary: Children affected by CDD display a clinical phenotype characterized by early-onset epilepsy, intellectual disability, motor impairment, and autistic-like features. Although the clinical aspects associated with CDKL5 mutations are well described in children, adults with CDD are still under-characterized. Similarly, most animal research has been carried out on young adult Cdkl5 knockout (KO) mice only. Since age represents a risk factor for the worsening of symptoms in many neurodevelopmental disorders, understanding age differences in the development of behavioral deficits is crucial in order to optimize the impact of therapeutic interventions. Here, we compared young adult Cdkl5 KO mice with middle-aged Cdkl5 KO mice, at a behavioral, neuroanatomical, and molecular level. We found an age-dependent decline in motor, cognitive, and social behaviors in Cdkl5 KO mice, as well as in breathing and sleep patterns.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,cyclin-dependent protein serine/threonine kinase activity,ATP binding,kinase activity,transferase activity,small GTPase binding	Ani
Cacng8	CACNG8	protein-coding	Mus musculus	ENSMUSG00000053395	-	81905	Antisocial Personality Disorder	7 A1|7 1.98 cM	Knockout	C57BL/6 J	34099816	593	Expeimentalparadigm: Resident–intruder test//Open field test//Novelty-suppressed feeding//Exposure to a novel object//Three-chamber test//Risk-taking behavior//Drowning rescue test  /n  Model Generation: The TARP γ-8<U+2212>/<U+2212><U+00A0>mice27<U+00A0>were a gift from Roger A. Nicoll of UCSF and were backcrossed with C57BL/6<U+00A0>J mice for at least 8 generations before these experiments.<U+00A0>  /n  Rescue: -  /n  Model Summary: We then characterized the behavior of TARP 纬-8 knocKnockoutut and heterozygous mice and found that consistent with ASPD patients who often exhibit impulsivity, aggression, risk taking, irresponsibility and callousness, a decreased 纬-8 expression in mice displayed similar behaviors.聽	voltage-gated ion channel activity,voltage-gated calcium channel activity,calcium channel regulator activity,calcium channel activity,channel regulator activity,protein phosphatase 2B binding,ionotropic glutamate receptor binding	Ani
Cc2d1a	CC2D1A	protein-coding	Mus musculus	ENSMUSG00000036686	Freud-1|Tape	212139	Intellectual Disability	8|8 C2	Conditional Knockout	Cc2d1a floxed;Emx1-Cre;C57BL/6 J	34132974	594	Expeimentalparadigm: Open-field test//Light-dark box test//Marble burying test//Repetitive behavior//Three-chamber test//Olfactory//Y-maze//Reciprocal social interaction test//Nest building test//Rotarod//Home cage activity  /n  Model Generation: The Cc2d1a floxed mouse (Cc2d1af/f) line with Cre-dependent excision of exon 12–14 was used for the generation of cKO mice [7]. Emx1-Cre (no. 005628) mice were obtained from Jackson Laboratories and maintained in the C57BL/6 J background. Cc2d1a cKO mice were generated by crossing Emx1-Cre transgenic mice with homozygous Cc2d1af/f mice. Cc2d1af/f mice were used as the wild-type (WT) littermates for comparison with homozygous Cc2d1a cKO mice. Mice were genotyped by a PCR-based method using genomic DNA isolated from tail samples. Primers used are as follows: forward (5′-GCGGTCTGGCAGTAAAAACTATC-3′) and reverse (5′-GTGAAACAGCATTGCTGTCACTT-3′). While sex-specific behavioral deficits were reported in Cc2d1a-deficient mice [6], only male mice were used for experiments throughout the study. The exclusion of female mice from studies because of estrous cycle variability may increase variance relative to males.  /n  Rescue: -  /n  Model Summary: We recently reported that conditional deletion of Cc2d1a in glutamatergic neurons of the postnatal mouse forebrain leads to impaired hippocampal synaptic plasticity and cognitive function. However, the pathogenic origin of the autistic features of CC2D1A deficiency remains elusive. Here, we confirmed that CC2D1A is highly expressed in the cortical zones during embryonic development. Taking advantage of Cre-LoxP-mediated gene deletion strategy, we generated a novel line of Cc2d1a conditional knockout (cKO) mice by crossing floxed Cc2d1a mice with Emx1-Cre mice, in which CC2D1A is ablated specifically in glutamatergic neurons throughout all embryonic and adult stages. We found that CC2D1A deletion leads to a trend toward decreased number of cortical progenitor cells at embryonic day 12.5 and alters the cortical thickness on postnatal day 10. In addition, male Cc2d1a cKO mice display autistic-like phenotypes including self-injurious repetitive grooming and aberrant social interactions.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding	Ani
ar	AR	protein-coding	Zebrafish	ENSDARG00000067976	NR3C4	100005148	Aggressive Behaviors	-	Knockout(TALEN)	AB	34153924	595	Expeimentalparadigm: Attack-retreat counts//Dominance behavior//Encounter analysis  /n  Model Generation: Ar knockouts (ArKO) and Pgr knockouts (PgrKO) were generated using Transcription Activator-Like Effector Nucleases (TALENs), and mutations were confirmed as previously described (Zhu et al., 2015; Yong et al., 2017). Briefly, zebrafish Ar (genomic sequence: CR396593; mRNA sequence: NM_001083123) consists of 868 amino acids and 8 coding exons. ArKO was generated by targeting the beginning of first exon, which encodes beginning part of A/B domain. TALENs generated three different frame shifts and premature stop codes, which led to truncated proteins with loss of major part of A/B domain, and all of C, D, E and F domains (Yong et al., 2017). Zebrafish Pgr (genomic sequence: CU459064; mRNA sequence: NM_001166335 & EF155644) consists of 618 amino acids and 8 coding exons. We used two sets of TALENS targeted two different parts of A/B domain, i.e., beginning or end of AB domain, which led to generation of three different Pgr mutant lines. Two Pgr mutants (Pgr15 and Pgr35) have a short-truncated protein with the loss of major part of A/B domain and all C, D, E, F domains, while the third Pgr mutant line (Pgr2d) retains major part of A/B domain, but lost all C, D, E and F domains (Zhu et al., 2015). To distinguish ArKO and PgrKO mutants from their WT siblings, TALENs targeting regions were PCR amplified, verified with restriction endonuclease digestion and visualization on agarose gel. There were no active androgen or progestin receptors present in vivo due to premature stop codons that terminated the formation of the protein during gene translation. Out of several ArKO and PgrKO lines created, Ar9.1 (arecu5/ecu5), Pgr15 (pgrecu1/ecu1) and Pgr2d (pgrecu3/ecu3) were used in the current study.  /n  Rescue: -  /n  Model Summary: Previous studies have shown a relationship between aggressive acts and circulating gonadal steroids, but whether classical nuclear steroid receptors regulate aggression in animals is still uncertain. We examined whether the nuclear androgen receptor (Ar) and nuclear progestin receptor (Pgr) were necessary for aggressive behaviors and maintenance of a dominance relationship in male zebrafish (Danio rerio). Dyadic social interactions of Ar knockout (ArKO), Pgr knockout (PgrKO) and wildtype (WT) controls were observed for two weeks (2-weeks). ArKO zebrafish were significantly less aggressive and had a less defined dominance relationship, whereas PgrKO dominant zebrafish were significantly and persistently more aggressive with a robust dominance relationship.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,androgen binding,zinc ion binding,sequence-specific DNA binding,metal ion binding	Ani
pgr	PGR	protein-coding	Zebrafish	ENSDARG00000035966	gb:dq017620|pg|pr	569575	Aggressive Behaviors	-	Knockout(TALEN)	AB	34153924	596	Expeimentalparadigm: Attack-retreat counts//Dominance behavior//Encounter analysis  /n  Model Generation: Ar knockouts (ArKO) and Pgr knockouts (PgrKO) were generated using Transcription Activator-Like Effector Nucleases (TALENs), and mutations were confirmed as previously described (Zhu et al., 2015; Yong et al., 2017). Briefly, zebrafish Ar (genomic sequence: CR396593; mRNA sequence: NM_001083123) consists of 868 amino acids and 8 coding exons. ArKO was generated by targeting the beginning of first exon, which encodes beginning part of A/B domain. TALENs generated three different frame shifts and premature stop codes, which led to truncated proteins with loss of major part of A/B domain, and all of C, D, E and F domains (Yong et al., 2017). Zebrafish Pgr (genomic sequence: CU459064; mRNA sequence: NM_001166335 & EF155644) consists of 618 amino acids and 8 coding exons. We used two sets of TALENS targeted two different parts of A/B domain, i.e., beginning or end of AB domain, which led to generation of three different Pgr mutant lines. Two Pgr mutants (Pgr15 and Pgr35) have a short-truncated protein with the loss of major part of A/B domain and all C, D, E, F domains, while the third Pgr mutant line (Pgr2d) retains major part of A/B domain, but lost all C, D, E and F domains (Zhu et al., 2015). To distinguish ArKO and PgrKO mutants from their WT siblings, TALENs targeting regions were PCR amplified, verified with restriction endonuclease digestion and visualization on agarose gel. There were no active androgen or progestin receptors present in vivo due to premature stop codons that terminated the formation of the protein during gene translation. Out of several ArKO and PgrKO lines created, Ar9.1 (arecu5/ecu5), Pgr15 (pgrecu1/ecu1) and Pgr2d (pgrecu3/ecu3) were used in the current study.  /n  Rescue: -  /n  Model Summary: Previous studies have shown a relationship between aggressive acts and circulating gonadal steroids, but whether classical nuclear steroid receptors regulate aggression in animals is still uncertain. We examined whether the nuclear androgen receptor (Ar) and nuclear progestin receptor (Pgr) were necessary for aggressive behaviors and maintenance of a dominance relationship in male zebrafish (Danio rerio). Dyadic social interactions of Ar knockout (ArKO), Pgr knockout (PgrKO) and wildtype (WT) controls were observed for two weeks (3-weeks). ArKO zebrafish were significantly less aggressive and had a less defined dominance relationship, whereas PgrKO dominant zebrafish were significantly and persistently more aggressive with a robust dominance relationship.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA binding,DNA-binding transcription factor activity,nuclear steroid receptor activity,nuclear receptor activity,steroid binding,zinc ion binding,sequence-specific DNA binding,metal ion binding	Ani
Cbln2	CBLN2	protein-coding	Mus musculus	ENSMUSG00000024647	6330593N19Rik|A730004O05	12405	Obsessive Compulsive Disorder	18 E4|18 58.63 cM	Knockout	C57BL/6;SV129	34158618	597	Expeimentalparadigm: Open field test//Elevated plus maze//Resident–intruder assay//Marble burying//Explosive jumping //Normal nest building//excessive nest building  /n  Model Generation: To generate Cbln1 KO or Cbln2 KO mice, homozygous Cbln1flox/flox<U+00A0>or Cbln2flox/flox<U+00A0>mice were crossed with transgenic mice expressing Cre-recombinase under control of the nestin promoter (Jackson Labs), as described previously [15].<U+00A0>  /n  Rescue: -  /n  Model Summary: Here, we report that constitutive Cbln2 KO mice, but not Cbln1 KO mice, display robust compulsive behaviors, including stereotypic pattern running, marble burying, explosive jumping, and excessive nest building, and exhibit decreased brain serotonin levels.<U+00A0>	protein binding	Ani
Slc1a2	SLC1A2	protein-coding	Mus musculus	ENSMUSG00000005089	1700091C19Rik|2900019G14Rik|Eaat2|GLT-1|GLT1|MGLT1	20511	Attention-Deficit/Hyperactivity Disorder	2 E2|2 54.13 cM	Knockdown	C57BL/6J	34166912	598	Expeimentalparadigm: Open field test//Homecage activity test//Cliff avoidance  /n  Model Generation: We used 129 SvEv ES cells (line H23). Five recombined clones were obtained out of two hundred G418 resistant clones. Germline transmitted offspring were established as GLT1-STOP-tetO heterozygous knock-in mice. GLT1 hypomorph mice were generated by crossing heterozygotes. All experiments were performed in accordance with the ethical guidelines of the Institutional Animal Care and Use Committee of Tokyo Medical and Dental University. All mice used in this study were backcrossed with C57BL/6 mice for at least 6 generations.  /n  Rescue: -  /n  Model Summary: We report here the generation of mice expressing only 20% of normal levels of the GLT1. Unlike conventional GLT1 knockout mice, these mice survive to adulthood and exhibit ADHD-like phenotypes, including hyperactivity, impulsivity and impaired memory. These findings indicate that glutamatergic dysfunction due to GLT1 deficiency, a mechanism distinct from the dopaminergic deficit hypothesis of ADHD, underlies ADHD-like symptoms.	L-glutamate transmembrane transporter activity,high-affinity L-glutamate transmembrane transporter activity,anion transmembrane transporter activity,neutral L-amino acid transmembrane transporter activity,symporter activity,glutamate:sodium symporter activity,cysteine transmembrane transporter activity,metal ion binding	Ani
neu1	NEU1	protein-coding	Zebrafish	ENSDARG00000008832	si:ch211-222e23.1	559850	Aggressive Behaviors	-	Knockout(CRISPR/Cas9)	NA	34188220	599	Expeimentalparadigm: Normal swimming behavior//Aggressive behavior//Shoaling behavior//Mirror test//Three-chamber test//Black–white preference test  /n  Model Generation: Neu1-knockout zebrafish (Neu1-KO) was established through CRISPR/Cas9 genome editing.  /n  Rescue: -  /n  Model Summary: Here, we conducted the behavioral analysis using Neu1-knockout zebrafish (Neu1-KO). Neu1-KO zebrafish showed normal swimming similar to wild-type zebrafish (WT), whereas shoaling was decreased and accompanied by greater inter-fish distance than WT zebrafish. The aggression test showed a reduced aggressive behavior in Neu1-KO zebrafish than in WT zebrafish. In the mirror and 3-chambers test, Neu1-KO zebrafish showed more interest toward the opponent in the mirror and multiple unfamiliar zebrafish, respectively, than WT zebrafish. Furthermore, Neu1-KO zebrafish also showed increased interaction with different fish species, whereas WT zebrafish avoided them. In the black-white preference test, Neu1-KO zebrafish showed an abnormal preference for the white region, whereas WT zebrafish preferred the black region.	exo-alpha-sialidase activity,alpha-sialidase activity,exo-alpha-(2->3)-sialidase activity,exo-alpha-(2->6)-sialidase activity,exo-alpha-(2->8)-sialidase activity	Ani
Fmr1	FMR1	protein-coding	Mus musculus	ENSMUSG00000000838	FMRP|Fmr-1	14265	Intellectual Disability	X A7.1|X 34.83 cM	Knockout	NA	34196695	600	Expeimentalparadigm: Open field test//Contextual fear conditioning test//Marble burying test//Self-grooming  /n  Model Generation: Fmr1 KO2 mice supplied by the FRAXA Research Foundation were used in this study.  /n  Rescue: Using the cannabinoid-like large-conductance calcium-activated potassium channel activator VSN16R we rescued behavioural deficits such as repetitive behaviour, hippocampal dependent tests of daily living, hyperactivity and memory in a mouse model of fragile X syndrome.  /n  Model Summary: The behavioural findings described in this study provide direct evidence that chronic treatment with VSN16R, a selective activator of BK channels, can rectify the hyperactivity, short-term and long-term memory deficits and reduce stereotypy and aggression that occur in the Fmr1 KO2 mouse model of FXS.	RNA 7-methylguanosine cap binding,G-quadruplex RNA binding,nucleic acid binding,DNA binding,chromatin binding,RNA binding,mRNA binding,mRNA 3'-UTR binding,protein binding,microtubule binding,poly(U) RNA binding,protein kinase binding,protein phosphatase binding,protein domain specific binding,translation repressor activity,translation initiation factor binding,RNA strand annealing activity,poly(G) binding,methylated histone binding,siRNA binding,miRNA binding,RNA stem-loop binding,identical protein binding,protein homodimerization activity,ribosome binding,transmembrane transporter binding,translation regulator activity,protein heterodimerization activity,mRNA 5'-UTR binding,dynein complex binding,molecular condensate scaffold activity,sequence-specific mRNA binding	Ani
Npas4	NPAS4	protein-coding	Mus musculus	ENSMUSG00000045903	LE-PAS|Nxf	225872	Anxiety Disorder	19|19 A	Conditional Knockout	C57BL/6N	34289353	601	Expeimentalparadigm: Y-maze//Open field test//Novel object recognition test//Elevated plus-maze//Light-dark box test//Novelty suppressed feeding test//Forced swim test  /n  Model Generation: Npas4 floxed KO (Npas4f/f) mice were previously described (Lin et al., 2008). To determine conclusively the involvement of Npas4 in inhibitory synapse development, we generated an Npas4 conditional knockout mouse (Npas4flx/flx) in which the coding region of Npas4 is flanked by loxP sites and can be acutely removed by Cre-mediated recombination (Supplementary Fig. 4). Organotypic hippocampal slices were prepared from Npas4flx/flx mice and whole-cell recordings made from CA1 pyramidal neurons transfected with GFP and either a control vector or a vector encoding Cre recombinase. Cre expression had no effect on mIPSCs in wild-type neurons (Supplementary Fig. 5). However, compared with transfection with the control construct, transfection of Npas4flx/flx neurons with Cre led to a significant increase in the mIPSC inter-event interval (Fig. 3d, e).  /n  Rescue: -  /n  Model Summary: Here, we show that Npas4 (neuronal PAS-domain protein 4) transcriptionally regulates the expression of IQSEC3, a GABAergic synapse-specific guanine nucleotide-exchange factor for ADP-ribosylation factor (ARF-GEF) that directly interacts with gephyrin. Neuronal activation by an enriched environment induces Npas4-mediated upregulation of IQSEC3 protein specifically in CA1 stratum oriens layer somatostatin (SST)-expressing GABAergic interneurons. SST interneuron-specific knockout (KO) of Npas4 compromises synaptic transmission in these GABAergic interneurons, increases neuronal activity in CA1 pyramidal neurons, and reduces anxiety behavior, all of which are normalized by the expression of wild-type IQSEC3, but not a dominant-negative ARF-GEF-inactive mutant, in SST interneurons of Npas4-KO mice. Our results suggest that IQSEC3 is a key GABAergic synapse component that is directed by Npas4 and ARF activity, specifically in SST interneurons, to orchestrate excitation-to-inhibition balance and control anxiety-like behavior.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,protein binding,protein-containing complex binding,protein heterodimerization activity,protein dimerization activity	Ani
Ddx3x	DDX3X	protein-coding	Mus musculus	ENSMUSG00000000787	D1Pas1-rs2|Ddx3|Fin14	13205	Behavioral Disorders	X A1.1|X 8.17 cM	Knockout	B6.Cg-Edil3 Tg(Sox2<U+2212>Cre)1Amc /J ;C57BL/6J	34344536	602	Expeimentalparadigm: Open field test//Elevated plus maze test//Rotarod//Y maze//Novel object recognition test//Three-chamber test//Fear conditioning test//Balance beam test//Vertical pole test//Wire hanger test  /n  Model Generation: Animal procedures were approved by the Institutional Animal Care and Use Committee of the Icahn School of Medicine at Mount Sinai. The<U+00A0>Ddx3xflox<U+00A0>line was generated at Ozgene by introducing two<U+00A0>loxP sites<U+00A0>flanking exon 2 of mouse<U+00A0>Ddx3x<U+00A0>(OTTMUSG00000017078) in C57BL/6J<U+00A0>embryonic stem cells. To generate the knockout allele,<U+00A0>Ddx3xflox/flox<U+00A0>females were crossed with B6.Cg-Edil3Tg(Sox2<U+2212>Cre)1Amc/J males (Sox2-Cre/+) (17) (#008454; The Jackson Laboratory). The colony was maintained on a C57BL/6J background.<U+00A0>  /n  Rescue: -  /n  Model Summary: Ddx3x+/<U+2212><U+00A0>females showed physical, sensory, and motor delays that evolved into behavioral anomalies in adulthood, including hyperactivity, anxiety-like behaviors,<U+00A0>cognitive impairments<U+00A0>in specific tasks (e.g., contextual fear memory but not novel object recognition memory), and motor deficits. Motor function declined with age but not if mice were previously exposed to behavioral training.<U+00A0>	nucleotide binding,nucleic acid binding,DNA binding,DNA helicase activity,RNA binding,RNA helicase activity,mRNA binding,GTPase activity,helicase activity,protein binding,ATP binding,transcription factor binding,poly(A) binding,eukaryotic initiation factor 4E binding,hydrolase activity,ATP hydrolysis activity,ribonucleoside triphosphate phosphatase activity,translation initiation factor binding,RNA strand annealing activity,RNA stem-loop binding,gamma-tubulin binding,ribosomal small subunit binding,CTPase activity,protein serine/threonine kinase activator activity,mRNA 5'-UTR binding,primary miRNA binding	Ani
Adgrl3	ADGRL3	protein-coding	Rattus norvegicus	ENSRNOG00000030149	CIRL-3|Cirl3|Lec3|Lphn3	170641	Attention-Deficit/Hyperactivity Disorder	14p21	Knockout	Sprague Dawley	34352385	603	Expeimentalparadigm: Straight channel//Cincinnati water maze//Morris water maze//Conditioned freezing//Startle response and light prepulse inhibition<U+00A0>//Novel object recognition test//Temporal order  /n  Model Generation: The CRISPR/Cas9 targeting of exon-3 is as described (Regan et al., 2019).<U+00A0>Lphn3+/<U+2212><U+00A0>males and females were bred to generate offspring for testing.  /n  Rescue: -  /n  Model Summary: Lphn3<U+00A0>KO rats are hyperactive and release more dopamine shown previously.Here we show that Lphn3 KO rats have spatial and egocentric cognitive deficits.	G protein-coupled receptor activity,calcium ion binding,carbohydrate binding	Ani
Shh	SHH	protein-coding	Mus musculus	ENSMUSG00000002633	9530036O11Rik|Dsh|Hhg1|Hx|Hxl3|M100081|ShhNC	20423	Attention-Deficit/Hyperactivity Disorder	5 B1|5 14.39 cM	Knockin	C57BL/6J	34399854	604	Expeimentalparadigm: Open field test//Visual discrimination//Water maze test//Morris water maze//Repeated reversal water maze  /n  Model Generation: In the JHU Transgenic Core Laboratory, 50 ng/ul φC31mRNA and 3 ng/ul TRE-hShh targeting vector were diluted in RNAse free injection buffer (10 mM Tris–HCl, pH 7.4, 0.25 mM EDTA) and injected into the pronucleus of 297 zygotes from Rosa26 TARGATT mice (Applied StemCell). The embryos were transferred into the oviducts of 11 pseudopregnant ICR moms. Founder pups were identified by PCR of tail DNA using primer sets SSL and SSR (Applied StemCell) that were specific for the right and left junctions of the attP/Rosa26 locus. Three mice positive for the insertion were identified among 31 pups.  /n  Rescue: -  /n  Model Summary: Our study provides the first in vivo evidence that Shh overexpression from the perinatal period protects DS brain integrity and enhances learning and memory in normal mice, indicating the broad therapeutic potential of Shh ligand for other neurological conditions. Moreover, the first inducible hShh site-specific knock-in mouse could be widely used for spatiotemporal Shh signaling regulation.	patched binding,calcium ion binding,protein binding,glycosaminoglycan binding,peptidase activity,zinc ion binding,transferase activity,hydrolase activity,laminin-1 binding,metal ion binding,cholesterol-protein transferase activity	Ani
kif2a	KIF2A	protein-coding	Zebrafish	ENSDARG00000043571	fj55b02|wu:fj55b02|zgc:103670	447926	Intellectual Disability	-	Knockout(CRISPR/Cas9)	AB	34404749	605	Expeimentalparadigm: Locomotor studies//PTZ experiments//Habituation assay  /n  Model Generation: A kif2a knock-out line was generated via the CRISPR/Cas9 technique (Hruscha et al., 2013; Hwang et al., 2013). kif2a single-guide RNA (sgRNA) targeting exon 5 in the kif2a gene (5′-CAGCCAGAATCAGCACCCCC-3′) was designed using the CHOP CHOP web tool (https://chopchop.cbu.uib.no), and was further transcribed using the MEGAshortscript T7 Transcription Kit (Ambion) and purified with the MEGAclear Transcription Clean-Up Kit (Ambion). Cas9 (GeneArt CRISPR Nuclease mRNA) was purchased from Thermo Fisher Scientific. Single cell-stage, fertilized wild-type embryos of the AB line were injected with 100<U+2009>pg of kif2a sgRNA and 150<U+2009>pg of Cas9 mRNA (in 1 nl volume). The mutation at the target site was verified via T7 endonuclease assay. The remaining sgRNA/Cas9-injected embryos were raised till adulthood, outcrossed with wild-type adults, and screened for indels by Sanger sequencing. F0 founder with germline transmission and a high rate of indels was selected to establish the knock-out line. F1 generation embryos of F0 founder were raised to adulthood, fin clipped, and sequenced. Individuals carrying 4<U+2009>bp deletion of CCAG were identified and pooled together. Experiments were performed on embryos coming from homozygous and heterozygous F2 or F3 progeny.  /n  Rescue: -  /n  Model Summary: In recent years there has been extensive research on malformations of cortical development (MCDs) that result in clinical features like developmental delay, intellectual disability, and drug-resistant epilepsy (DRE). It has been reported that de novo mutations in KIF2A, a member of the kinesin-13 family, are linked to brain malformations and DRE. Here, we present a novel kif2a knock-out zebrafish model, showing hypoactivity, habituation deficits, pentylenetetrazole-induced seizure susceptibility and microcephaly, as well as neuronal cell proliferation defects and increased apoptosis. Notably, our kif2a zebrafish knock-out model demonstrated many phenotypic similarities to KIF2A mouse models.	nucleotide binding,microtubule motor activity,ATP binding,microtubule binding,ATP hydrolysis activity	Ani
Fndc5	FNDC5	protein-coding	Mus musculus	ENSMUSG00000001334	1500001L03Rik|PeP|Pxp	384061	Cognitive Disorders	4|4 D2.2	Knockout	B6.FVB-Tg(EIIa-cre)C5379Lmgd/J;C57BL/6	34417591	606	Expeimentalparadigm: Running exercise paradigm//Barnes maze  /n  Model Generation: We developed<U+00A0>Fndc5fl/fl-targeted (exon 2 and 3) mice with the Texas A&M Institute for Genomic Medicine using homologous recombination. Global<U+00A0>Fndc5<U+00A0>Knockout mice (F5Knockout) were generated by crossing<U+00A0>Fndc5fl/fl<U+00A0>with B6.FVB-Tg(EIIa-cre)C5379Lmgd/J mice (003724, JAX). APP/PS1 mice (34832, JAX) were crossed with a heterozygous F5Knockout to generate the APP/PS1-F5Knockout strain. All strains were on a C57BL/6 background. The 5xFAD mice were maintained on a mixed background at MGH (6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax). Thy1-GFP+/F5Knockout were generated by crossing the F5Knockout mice with the Thy1-GFP line M (007788, JAX).  /n  Rescue: Diminished pattern separation in F5Knockout mice can be rescued by delivering irisin directly into the dentate gyrus, suggesting that irisin is the active moiety.<U+00A0>  /n  Model Summary: Genetic deletion of Fndc5/irisin (global Fndc5 knock-out (Knockout) mice;<U+00A0>F5Knockout) impairs cognitive function in exercise, ageing and AD.	hormone activity	Ani
Adgrl3	ADGRL3	protein-coding	Rattus norvegicus	ENSRNOG00000030149	CIRL-3|Cirl3|Lec3|Lphn3	170641	Attention-Deficit/Hyperactivity Disorder	14p21	Knockout	Sprague Dawley	34427038	607	Expeimentalparadigm: Autoshaping//Fixed ratio training//Differential reinforcement of high rates//Differential reinforcement of low rates//Cued alternation//Noncued alternation//Delayed spatial alternation  /n  Model Generation: The<U+00A0>Lphn3<U+2212>/<U+2212><U+00A0>rats were generated at the Cincinnati Children's Transgenic Animal and Genome Editing Core by using CRISPR/Cas9 to delete exon 3.37<U+00A0>The<U+00A0>Lphn3<U+2212>/<U+2212><U+00A0>founders were then bred with<U+00A0>Lphn3+/+<U+00A0>rats to establish the lines and heterozygote crossings (i.e.,<U+00A0>Lphn3+/<U+2212><U+00A0>x<U+00A0>Lphn3+/<U+2212>) were used to generate the KO and WT rats used for these experiments.  /n  Rescue: -  /n  Model Summary: Compared with wildtype controls,<U+00A0>Lphn3<U+2212>/<U+2212><U+00A0>rats exhibited deficits on both the DRL and DSA tasks, indicative of deficits in impulsive action and working memory, respectively.<U+00A0>	G protein-coupled receptor activity,calcium ion binding,carbohydrate binding	Ani
Brpf1	BRPF1	protein-coding	Mus musculus	ENSMUSG00000001632	4833438B11Rik|4930540D11Rik|Brpf2	78783	Intellectual Disability	6|6 E3	Knockdown	C57BL/6	34485298	608	Expeimentalparadigm: Morris water maze  /n  Model Generation: All mice used were of C57BL/6 background purchased from Jiesijie lab (Shanghai, China). Primary hippocampal neurons were generated from E17.5 to E18.5 mouse embryos as described previously (Beaudoin et al., 2012). Briefly, hippocampi from E17.5 to E18.5 embryos were dissected in HBSS and dissociated in 0.25% of trypsin. The dissociated cells were plated onto poly-L-lysine-coated 24-well plates with neurobasal medium supplemented with B27 supplement (17504044, Gibco, New York, NY, United States). Media were changed twice a week. To knock down Brpf1, cultured neurons at days in vitro (DIV) 3 were infected with either AAV2-scramble-green fluorescent protein (GFP) or AAV2-shBrpf1-GFP purchased from BrainVTA (Wuhan, China). The sense sequence of shBrpf1 is GGCTTACCGCTACTTGAACTT. Media were replaced after 12 h. Experiments using primary cultured neurons were performed at DIV 14–15. Neurons were grown at 37℃ and with 5% CO2.  /n  Rescue: -  /n  Model Summary: Our previous work indicated that Brpf1 was specifically and strongly expressed in the hippocampus from the perinatal period to adulthood. We hypothesized that mouse Brpf1 plays critical roles in the morphology and function of hippocampal neurons, and its deficiency leads to learning and memory deficits. To test this, we performed immunofluorescence, whole-cell patch clamp, and mRNA-Seq on shBrpf1-infected primary cultured hippocampal neurons to study the effect of Brpf1 knockdown on neuronal morphology, electrophysiological characteristics, and gene regulation. In addition, we performed stereotactic injection into adult mouse hippocampus to knock down Brpf1 in vivo and examined the learning and memory ability by Morris water maze. We found that mild knockdown of Brpf1 reduced mEPSC frequency of cultured hippocampal neurons, before any significant changes of dendritic morphology showed. We also found that Brpf1 mild knockdown in the hippocampus showed a decreasing trend on the spatial learning and memory ability of mice.	DNA binding,acetyltransferase activator activity,histone H4K5 acetyltransferase activity,histone H4K8 acetyltransferase activity,histone H4K12 acetyltransferase activity,metal ion binding	Ani
Plxna1	PLXNA1	protein-coding	Mus musculus	ENSMUSG00000030084	2600013D04Rik|NOV|PlexA1|Plxn1|mKIAA4053	18844	Panic Disorder	6|6 D1	Overexpression	C57BL/6J	34508226	609	Expeimentalparadigm: Contextual fear conditioning//Open field test  /n  Model Generation: The AAVs expressing Plxna1 mutants were custom-made by OBiO (Shanghai, China). PCR-amplified fragments of Plxna1 cDNA encoding amino acid sequence 1218–1874 (Plxna1Δect, encoding PLXNA1 lacking the ectodomain) and 1266–1874 (Plxna1cyto, encoding the cytoplasmic domain of PLXNA1) were inserted into the pAAV-mDlx-HA-MCS backbone vector (HA: the hemagglutinin epitope tag; MCS: multiple cloning site) for constructing the pAAV-mDlx-HA-Plxna1ΔEct and the pAAV-mDlx-HA-Plxna1cyto plasmids, respectively [36]. The mDlx promoter used in the viral construct contains the mDlx enhancer derived from the distal-less homeobox 5 and 6 (Dlx5/6) genes in front of a minimal promoter to drive transgene expression restrictively in GABAergic interneurons, as reported by Dimidschstein et al. [37]. The plasmids were packaged into AAV serotype (AAV8). The AAVs were injected bilaterally into the IL subregion of mPFC. Detailed descriptions of stereotaxic injection are provided in the Supplementary Methods.  /n  Rescue: -  /n  Model Summary: In this study, we identified that learning-induced downregulation of the mRNA and protein levels of plexin-A1 specifically occurred in the inhibitory but not excitatory neurons in the infralimbic cortex (IL) of mPFC. Further studies of plexin-A1 by virus-mediated over-expression of functional mutants selectively in the IL inhibitory neurons revealed the critical roles of plexin-A1 for regulating memory specificity and anxiety. Moreover, our findings revealed that plexin-A1 regulated the distribution of glutamic acid decarboxylase 67, a GABA synthetase, which in turn modulated the activity of IL and its downstream brain regions. Collectively, our findings elucidate the molecular modifier of IL inhibitory neurons in regulating memory specificity and anxiety, and provide candidates for developing therapeutic strategies for the prevention or treatment of a series of fear generalization-related neuropsychiatric disorders	protein binding,semaphorin receptor activity	Ani
Thrsp	THRSP	protein-coding	Mus musculus	ENSMUSG00000035686	S14|SPOT14	21835	Attention-Deficit/Hyperactivity Disorder	7|7 E1	Overexpression	C57BL/6<U+00A0>	34545202	610	Expeimentalparadigm: Novel object recognition test//Y-maze test//Object-based attention test //Open field test//Cliff avoidance test //Elevated plus maze test //Rotarod test  /n  Model Generation: THRSP-overexpressing (THRSP OE) (MGI:6259716; Tg(Eno2-Thrsp)#Cheo) mice were produced following standard procedures20. In brief, we produced the first-generation THRSP OE mice from an intercross between THRSP OE male founders (Uimyung Research Institute for Neuroscience) and C57BL6 female mice (Hanlim Animal Laboratory Co. (Hwasung, Korea). Currently, we are using the tenth-generation back-crossed C57BL6-THSRP OE mice.  /n  Rescue: TH replacement for seven days rescued inattention and memory impairment and the normalization of theta waves.  /n  Model Summary: This study further supports the involvement of the upregulated THRSP gene in ADHD pathology and indicates that THRSP OE mice can serve as an animal model for the predominantly inattentive subtype of ADHD.	protein binding,identical protein binding,protein homodimerization activity,molecular function inhibitor activity	Ani
Prdx6	PRDX6	protein-coding	Mus musculus	ENSMUSG00000026701	1-Cys Prx|1-cysPrx|9430088D19Rik|Aop2|Brp-12|CP-3|GPx|LPCAT-5|Ltw-4|Ltw4|Lvtw-4|NSGPx|ORF06|Prdx5|aiPLA2	11758	Anxiety Disorder	1 H2.1|1 69.75 cM	Knockout	B6.129-Prdx6 tm1pgn/pgn	34573048	611	Expeimentalparadigm: Acute immobilization stress//Trace fear conditioning//Open field test//Elevated plus maze  /n  Model Generation: Mice with a targeted deletion of the Prdx6 gene were purchased from the Jackson Laboratory (#005974 B6.129-Prdx6 tm1pgn/pgn, Bar Harbor, NE, USA) and maintained at Tzu Chi University for more than 10 generations.  One heterozygous (Prdx6+/-) male and two heterozygous (Prdx6+/-) female knockout mice were mated to generate homozygous wild–type (Prdx6+/+) littermates and knockout (Prdx6-/-) mice. Genotyping was performed as described in the previous report to confirm the genotypes of the mice before every behavioral test [29].  /n  Rescue: -  /n  Model Summary: Our recent finding indicates that lack of the Prdx6 gene leads to enhanced fear memory. However, it is unknown whether PRDX6 is involved in changes in anxiety response and memory performance upon stress. The present study reveals that hippocampal PRDX6 level is downregulated 30 min after acute immobilization stress (AIS) and trace fear conditioning (TFC). In human retinal pigment epithelium (ARPE-19) cells, the PRDX6 expression level decreases after being treated with stress hormone corticosterone. Lack of PRDX6 caused elevated basal H2O2 levels in the hippocampus, basolateral amygdala, and medial prefrontal cortex, brain regions involved in anxiety response and fear memory formation. Additionally, this H2O2 level was still high in the medial prefrontal cortex of the knockout mice under AIS. Anxiety behavior of Prdx6 mice was enhanced after immobilization for 30 min. After exposure to AIS before a contextual test, Prdx6 mice displayed a contextual fear memory deficit.	catalytic activity,peroxidase activity,glutathione peroxidase activity,phospholipase A2 activity,protein binding,thioredoxin peroxidase activity,antioxidant activity,oxidoreductase activity,transferase activity,hydrolase activity,ubiquitin protein ligase binding,identical protein binding,1-acylglycerophosphocholine O-acyltransferase activity,calcium-independent phospholipase A2 activity,peroxiredoxin activity	Ani
foxp2	FOXP2	protein-coding	Zebrafish	ENSDARG00000005453	-	555242	Attention-Deficit/Hyperactivity Disorder	-	Knockout	AB	34650032	612	Expeimentalparadigm: Locomotor tracking  /n  Model Generation: Experiments were performed on the AB/AB wildtype zebrafish strain (zfin id.: ZDB-GENO-960809-7). To create a foxp2 loss-of-function, we applied the CRISPR/Cas9 gene-editing tool and injected a cocktail of a sgRNA targeting exon 10 of foxp2 (Fig. <U+200B>(Fig.1B,1B, Table S1) and the Cas9 protein into the animal pole of fertilised one-cell stage eggs. Injected F0 embryos were raised and tested for germline transmission of indel mutations by outcrossing with AB/AB wildtypes and genotyping the offspring. The F1 generation was generated by outcrossing positive F0 fish with AB/AB wildtypes and used to characterise the indel mutations by Sanger sequencing.  /n  Rescue: -  /n  Model Summary: Here we explore the hypothesis that Foxp2 and GABAergic signalling are part of a biological network involved in the regulation of behavioural activity. We show that foxp2 loss-of-function results in increased locomotor activity and demonstrate that foxp2 is expressed by GABAergic neurons in several brain regions involved in motor functions. Intriguingly, disruption of Gad1 or GABA-A receptor activity causes hyperactivity, resembling the phenotype observed in our foxp2 mutants. By application of the GABA-A-R agonist muscimol, we are able to rescue the hyperactive phenotype induced by the foxp2 loss-of-function. Together these findings support the hypothesis that foxp2 regulates locomotor activity via GABAergic signalling. This provides one possible mechanism by which behavioural phenotypes, such as altered activity, seen in NDDs may be explained.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA-binding transcription repressor activity, RNA polymerase II-specific,DNA binding,DNA-binding transcription factor activity,sequence-specific DNA binding,metal ion binding	Ani
St3gal3	ST3GAL3	protein-coding	Mus musculus	ENSMUSG00000028538	ST3GalIII|ST3N|Siat3|Siat6	20441	Attention-Deficit/Hyperactivity Disorder	4|4 D1- D2.1	Conditional Knockout	B6.129-St3gal3TM 1Jxm/J	34650588	613	Expeimentalparadigm: Reaction time task //Delay discounting task  /n  Model Generation: Experiments were performed using a constitutive St3gal3-deficient mouse line (B6.129-St3gal3TM 1Jxm/J) that had been previously generated by Cre-loxP gene targeting to produce the deletion of exon 2 that encodes the ST3GAL3 transmembrane domain (Ellies et al., 2002). Heterozygous St3gal3-deficient (St3gal3, in the following referred to as HET) were obtained from the Jackson Laboratory (JAX, Bar Harbor, ME, United States) and re-derived by in vitro fertilization and implantation in C57BL/6J dams at the Center for Experimental Molecular Medicine (ZEMM), University of Würzburg. After the rederivation, the mouse line was maintained by breeding HET males with St3gal3 wildtype (WT) females. The genotyping of the St3gal3 locus was done by polymerase chain reaction (PCR) as described on the Jackson Lab website.±+/+.  /n  Rescue: -  /n  Model Summary: Since St3gal3 null mutant mice display severe developmental delay, neurological deficits, including spontaneous seizures, and overall reduced viability, thus limiting behavioral and neurobiological assessment, we here investigated the effects of partial inactivation of St3gal3 in male and female heterozygous knockout (St3gal3) mice with focus on behavior as well as expression of markers linked to sialylation and myelination pathways.±	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity,sialyltransferase activity,transferase activity,glycosyltransferase activity	Ani
ARNTL	BMAL1	protein-coding	Macaca fascicularis	ENSMMUG00000009690	-	700464	Neurodevelopmental Disorders	-	Gene Editing(CRISPR/Cas10)	Macaca fascicularis	34691834	614	Expeimentalparadigm: Sleep monitoring//Locomotor activity monitoring  /n  Model Generation: Healthy female cynomolgus monkeys with regular menstrual cycles were chosen for superovulation and oocyte collections were carried out via laparoscopy. From day 3 of the menstrual cycle, 25 IU recombinant human follitropin was injected intramuscularly twice daily for 7–8 d. On day 11, 1000 IU of human chorionic gonadotrophin was administrated, followed by oocyte collection from follicles (2–8 mm in diameter) 36 h later. The collected oocytes were cultured in pre-equilibrated hamster embryo culture medium 9 (HECM-9) medium. Metaphase II-arrested oocytes were selected for further manipulation [49]. Cas9 and sgRNA mRNAs were prepared as previously reported [50]. For sgRNA preparation, a T7 promoter containing a specific forward and a common reverse primer was used to amplify the sgRNA template by PCR, and the resulting PCR product was used for in vitro transcription using a MEGAshortscript T7 kit (Thermo Fisher Scientific). For Cas9 mRNA, a T7 promoter containing a specific forward and a common reverse primer was used to amplify the Cas9 coding region, and the resulting PCR product was used for in vitro transcription using an mMESSAGE mMACHINE T7 ULTRA kit (Thermo Fisher Scientific). Cas9 mRNA and sgRNA purifications were achieved using a MEGAclear kit. Fertilization was performed via ICSI [49], and the presence of two pronuclei and two polar bodies was confirmed. The CRISPR/Cas9 method was applied for BMAL1 (gene ID 101865448) gene editing in the zygotes. The design of sgRNA followed the instructions on the website of the Zhang laboratory at the Broad Institute (http://crispr.mit.edu/job/9950152458235442), and the sequences are listed in Fig. 1A and Table S1. Approximately 5 pl of 50 ng/μl sgRNA and 100 ng/μl in vitro-transcribed Cas9 mRNA were mixed and injected in the cytoplasms of fertilized oocytes. Injected embryos were cultured in HECM-9 media containing 5% fetal bovine serum at 37°C in 5% CO2 to allow embryo development. Next, 31 menstruation-synchronized females were used as surrogate recipients for sgRNA-Cas9-injected embryos. Typically, two pronuclear–early-stage embryos were selected for tubal transfer to each surrogate female [49].  /n  Rescue: -  /n  Model Summary: Here, we report the generation of BMAL1 knockout cynomolgus monkeys for circadian-related disorders by CRISPR/Cas9 editing of monkey embryos. These monkeys showed higher nocturnal locomotion and reduced sleep, which was further exacerbated by a constant light regimen. Physiological circadian disruption was reflected by the markedly dampened and arrhythmic blood hormonal levels. Furthermore, BMAL1-deficient monkeys exhibited anxiety and depression, consistent with their stably elevated blood cortisol, and defective sensory processing in auditory oddball tests found in schizophrenia patients.	NA	Ani
Cdh2	CDH2	protein-coding	Mus musculus	ENSMUSG00000024304	CDHN|N-CAD|Ncad	12558	Attention-Deficit/Hyperactivity Disorder	18 A1|18 10.1 cM	Knockin(Mutated)	C57BL/6J	34702855	615	Expeimentalparadigm: Open-field test//Elevated plus maze test //Resident-intruder test//Acoustic startle response and prepulse inhibition test//Rotarod test//tThree chamber social test  /n  Model Generation: we generated two founder lines of CRISPR/Cas9-mutated mice harboring the specific human p.H150Y substitution in the<U+00A0>Cdh2<U+00A0>mouse ortholog; Selected KI F0 mice were bred with C57BL/6JRcc WT mice for two cycles to generate non-chimeric F1 KI heterozygotes. Heterozygote F1 offspring were then bred and F2 offspring of WT and mutant origin (Cdh2H150T<U+00A0>and<U+00A0>Cdh2H150Y(2)<U+00A0>founder lines) were used for all further experiments (details in Methods).<U+00A0>  /n  Rescue: Symptoms were modified by methylphenidate, the most commonly prescribed therapeutic for ADHD.  /n  Model Summary: In line with the human phenotype, CRISPR/Cas9-mutated knock-in mice harboring the human mutation in the mouse ortholog recapitulated core behavioral features of hyperactivity. Symptoms were modified by methylphenidate, the most commonly prescribed therapeutic for ADHD.<U+00A0>	RNA binding,calcium ion binding,protein binding,beta-catenin binding,enzyme binding,protein kinase binding,protein phosphatase binding,identical protein binding,protein-containing complex binding,alpha-catenin binding,gamma-catenin binding,cadherin binding,metal ion binding,nitric-oxide synthase binding,protein tyrosine kinase binding	Ani
Rab39b	RAB39B	protein-coding	Mus musculus	ENSMUSG00000031202	6330580M05Rik	67790	Intellectual Disability	X 38.26 cM|X A7.3	Knockdown	C57BL/6N	34761259	616	Expeimentalparadigm: Three-chamber test//Olfactory//Self-grooming//Light-dark box test//Emergence test//Novelty object recognition test//Rotarod//Cat walk test//Water maze//Radial maze//Spontaneous alternation test//Fear conditioning test//Video tracking and data collection  /n  Model Generation: Rab39b knock down (KD) mouse was generated with the aim to obtain a Rab39b-conditional knock out mouse by homologous recombination. The targeting vector carrying the BAC-isolated isogenic C67Bl/6 N Rab39b gene sequence, was constructed using pFLRT plasmid as follow: the 5′ arm consisted on a 3119 base pairs (bps) fragment containing the 119 bps of 5’UTR and the full sequence of the first exon (215 bps) followed by the intron (2785 bps); LoxP sites were inserted, respectively, at the beginning of the second exon and 79 bps from the STOP codon, in order to delete the second exon and the initial segment of 3’UTR of Rab39b gene; the neomycin-resistance (neo) cassette, driven by mouse Pgk1 promoter and flanked by Frt sites, was inserted immediately downstream of the second LoxP site; the 3’arm of the targeting vector consisted in 1276 bps containing the fragment of 3’UTR. After linearization with unique NotI restriction site, targeting vector was electroporated in embryonic stem (ES) cells. About, 600 G418-resistant colonies were analyzed by southern blot using 5′ and 3′ external probes. The 5′ flanking probe, S1 (PCR product from primers 5’ARM10F, 5′-GCATGTTTGAGCATGGAAACCCG-3′ and PROBE5’REV, 5′-CCTGAAGCAAGGTAGGCCCAGG-3′) detected a band of 18 Kb for the WT allele and 4.7 Kb for the recombinant allele, following the cut with the restriction enzyme BamHI. The 3′ flanking probe, S2 (PCR product from primers PROBE3’FOR, 5′-GGATTGTAGCCAGTTCAGCTAGG-3′, and PROBE3’REV, 5′-CCACTTATTGCAGTGACAACAGC-3′) displayed a band of 6.7 Kb for the WT allele and 4.4 Kb for the recombinant allele, following the cut with restriction enzyme NcoI. However, southern blot showed a band of 5.4 Kb instead of the expected 4.7Kb following the hybridization with S1 probe, identifying two ES clones where the recombination occurred inside the region surrounded by LoxP site, leading to ES clones containing only the second LoxP site and neomycin cassette in the 3’UTR. Two homologous recombinant clones were injected into 129B6 F1 blastocysts by standard methods. Chimeric mice from both clones were crossed to C57BL/6 N female mice.  /n  Rescue: -  /n  Model Summary: Autism spectrum disorder (ASD) and intellectual disability (ID) often exist together in patients. The RAB39B gene has been reported to be mutated in ID patients with additional clinical features ranging from ASD, macrocephaly, seizures and/or early-onset parkinsonism. Using a Rab39b KD mouse model, we demonstrated that the downregulation of RAB39B led to increased GluA2 lacking Ca2+-permeable AMPAR composition at the hippocampal neuronal surface and increased dendritic spine density that remained in an immature filopodia-like state. These phenotypes affected behavioural performance in a disease-specific manner. Rab39b KD mice revealed impaired social behaviour but intact social recognition. They also showed normal anxiety-like, exploratory, and motivational behaviours but impaired working and associative memories.	nucleotide binding,GTPase activity,protein binding,GTP binding,myosin V binding	Ani
Setd1b	SETD1B	protein-coding	Mus musculus	ENSMUSG00000038384	KMT2G|mKIAA1076	208043	Intellectual Disability	5|5 F	Conditional Knockout	C57BL/6J	34806773	617	Expeimentalparadigm: Water maze//Y‐maze//Open field test  /n  Model Generation: R1 ESCs were cultured with fetal calf serum (FCS)-based medium [DMEM + GlutaMAX<U+2122> (Invitrogen), 15% FCS (PAA), 2 mM L-glutamine (Invitrogen), 1x non-essential amino acids (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 0.1 mM β-mercaptoethanol, in the presence of 1000 units LIF (Chemicon) per ml] on mitomycin-C inactivated mouse embryonic fibroblasts. Cells (1×107) were electroporated with 40 μg linearized targeting construct using standard conditions (250 V, 500 μF) and selected with 0.2 mg/ml G418. Colonies were screened for correct targeted events by Southern blot hybridization using an internal probe and 5′ and 3′ external probes. For removing the selection cassettes, correctly targeted Setd1a clones were electroporated with a CAG-Flpo-IRES-puro expression vector (Kranz et al., 2010). For both Setd1a and Setd1b, two correctly targeted ESC clones were injected into blastocysts and the resulting chimeras were subsequently bred to C57BL/6 mice. Setd1bA/+ mice were crossed to the CAGGs-Dre line (Anastassiadis et al., 2009) to remove the additional selection cassette (PGK-Hygro) downstream of the 3′ loxP site generating Setd1bD/+ mice. Further, Setd1aA/+ and Setd1bD/+ mice were crossed to the hACTB-Flpe (Rodríguez et al., 2000) and to the CAGGs-Flpo (Kranz et al., 2010) line to generate Setd1aF/+ and Setd1bFD/+ mice, respectively. Subsequently, those mice were crossed to either the PGK-Cre line (Lallemand et al., 1998) to produce Setd1aFC/+ and Setd1bFDC/+ mice or to the Rosa26-Cre-ERT2 (RC) line (Seibler et al., 2003) to generate conditional, tamoxifen-inducible Setd1aF/+;RC/+ and Setd1bFD/+;RC/+ mice. The Oct4-GFP mice (Szabó et al., 2002) were kindly provided by Hans Sch<U+00F6>ler and the Gdf9-Cre mice (Lan et al., 2004) by Rolf Jessberger. Primers for genotyping are provided in supplementary material Table S1. All animal experiments were performed according to German law.  /n  Rescue: -  /n  Model Summary: Here, we employ mice deficient for Setd1b in excitatory neurons of the postnatal forebrain, and combine neuron-specific ChIP-seq and RNA-seq approaches to elucidate its role in neuronal gene expression. We observe that Setd1b controls the expression of a set of genes with a broad H3K4me3 peak at their promoters, enriched for neuron-specific genes linked to learning and memory function. Comparative analyses in mice with conditional deletion of Kmt2a and Kmt2b histone methyltransferases show that SETD1B plays a more pronounced and potent role in regulating such genes. Moreover, postnatal loss of Setd1b leads to severe learning impairment, suggesting that SETD1B-dependent regulation of H3K4me levels in postnatal neurons is critical for cognitive function.	nucleic acid binding,RNA binding,methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,histone H3K4 methyltransferase activity	Ani
Crabp1	CRABP1	protein-coding	Mus musculus	ENSMUSG00000032291	CRABP-I|Crabp-1|CrabpI|Rbp-5	12903	Anxiety Disorder	9 A5.3|9 29.76 cM	Conditional Knockout	C57BL/6	34830120	618	Expeimentalparadigm: Open field test//Elevated plus maze//Corticosterone level//Acute restraint test//Combined DEX-CRH test  /n  Model Generation: CKO mice were generated as described in Lin et al. [19]. We obtained a Crabp1 KO DE3 (ES) clone that contained a hit-and-run-type vector, creating a 5-bp Not1 insertion in exon 1 (the fifth codon of the Crabp1 coding region) to ablate Crabp1 expression (1). Three-month-old WT (C57BL/6) and CKO mice were used in these studies.  /n  Rescue: -  /n  Model Summary: This study reports that, in mice, endogenous cellular RA binding protein 1 (Crabp1) is highly expressed in the hypothalamus and pituitary glands. Crabp1 knockout (CKO) mice exhibit reduced anxiety-like behaviors accompanied by a lowered stress induced-corticosterone level. Furthermore, CRH/DEX tests show an increased sensitivity (hypersensitivity) of their feedback inhibition in the hypothalamic-pituitary-adrenal (HPA) axis. Gene expression studies show reduced FKBP5 expression in CKO mice; this would decrease the suppression of glucocorticoid receptor (GR) signaling thereby enhancing their feedback inhibition, consistent with their dampened corticosterone level and anxiety-like behaviors upon stress induction. In AtT20, a pituitary gland adenoma cell line elevating or reducing Crabp1 level correspondingly increases or decreases FKBP5 expression, and its endogenous Crabp1 level is elevated by GR agonist dexamethasone or RA treatment.	retinoic acid binding,retinoid binding,fatty acid binding,lipid binding,retinal binding,retinol binding	Ani
Neil1	NEIL1	protein-coding	Mus musculus	ENSMUSG00000032298	2810450N13Rik|NEH1|Nei1	72774	Anxiety Disorder	9|9 B	Knockout	C57BL/6N	34857879	619	Expeimentalparadigm: Open field test//Elevated plus maze//Morris water maze  /n  Model Generation: NEIL1 KO (Neil1-/-), NEIL2 KO (Neil2-/-) and NEIL1/NEIL2 DKO (Neil1-/-Neil2-/-) mouse models generated previously in our lab34. A total of 55 animals were used for the Pig-a gene mutation experiments: 3 wild-type (WT), 3 Mutyh -/-, 4 Ogg1 -/-and 3 Ogg1 -/- /Mutyh -/- 6 months-old; 8 WT and 13 Neil1 -/- /Neil2 -/- 18 months-old and 2 WT and 17 Neil1 -/- /Neil2 -/- /Neil3 -/- 23 months-old mice. For a positive control of the Pig-a gene mutation assay, 2WT mice were treated with ENU (i.p. injection, 40mg/kg bodyweight (bw) on three consecutive days, total dose of 120mg/kg bw).  /n  Rescue: -  /n  Model Summary: Here, we investigate the impact of NEIL2 and its potential overlap with NEIL1 on behavior in knockout mouse models. Neil1Neil2 mice display hyperactivity, reduced anxiety and improved learning. Hippocampal oxidative DNA base lesion levels are comparable between genotypes and no mutator phenotype is found. Thus, impaired canonical repair is not likely to explain the altered behavior. Electrophysiology suggests reduced axonal activation in the hippocampal CA1 region in Neil1Neil2 mice and lack of NEIL1 and NEIL2 causes dysregulation of genes in CA1 relevant for synaptic function. We postulate a cooperative function of NEIL1 and NEIL2 in genome regulation, beyond canonical BER, modulating behavior in mice.	nucleic acid binding,DNA binding,damaged DNA binding,catalytic activity,DNA-(apurinic or apyrimidinic site) endonuclease activity,protein C-terminus binding,zinc ion binding,hydrolase activity,hydrolase activity, acting on glycosyl bonds,hydrolase activity, hydrolyzing N-glycosyl compounds,lyase activity,DNA N-glycosylase activity,class I DNA-(apurinic or apyrimidinic site) endonuclease activity	Ani
Neil2	NEIL2	protein-coding	Mus musculus	ENSMUSG00000035121	Gm1212|NEH2	382913	Anxiety Disorder	14|14 D1	Knockout	C57BL/6N	34857879	620	Expeimentalparadigm: Open field test//Elevated plus maze//Morris water maze  /n  Model Generation: NEIL1 KO (Neil1-/-), NEIL2 KO (Neil2-/-) and NEIL1/NEIL2 DKO (Neil1-/-Neil2-/-) mouse models generated previously in our lab34. A total of 55 animals were used for the Pig-a gene mutation experiments: 3 wild-type (WT), 3 Mutyh -/-, 4 Ogg1 -/-and 3 Ogg1 -/- /Mutyh -/- 6 months-old; 8 WT and 13 Neil1 -/- /Neil2 -/- 18 months-old and 2 WT and 17 Neil1 -/- /Neil2 -/- /Neil3 -/- 23 months-old mice. For a positive control of the Pig-a gene mutation assay, 2WT mice were treated with ENU (i.p. injection, 40mg/kg bodyweight (bw) on three consecutive days, total dose of 120mg/kg bw).  /n  Rescue: -  /n  Model Summary: Here, we investigate the impact of NEIL2 and its potential overlap with NEIL1 on behavior in knockout mouse models. Neil1Neil2 mice display hyperactivity, reduced anxiety and improved learning. Hippocampal oxidative DNA base lesion levels are comparable between genotypes and no mutator phenotype is found. Thus, impaired canonical repair is not likely to explain the altered behavior. Electrophysiology suggests reduced axonal activation in the hippocampal CA1 region in Neil1Neil2 mice and lack of NEIL1 and NEIL2 causes dysregulation of genes in CA1 relevant for synaptic function. We postulate a cooperative function of NEIL1 and NEIL2 in genome regulation, beyond canonical BER, modulating behavior in mice.	nucleic acid binding,DNA binding,damaged DNA binding,catalytic activity,DNA-(apurinic or apyrimidinic site) endonuclease activity,microtubule binding,zinc ion binding,hydrolase activity,hydrolase activity, acting on glycosyl bonds,hydrolase activity, hydrolyzing N-glycosyl compounds,lyase activity,DNA N-glycosylase activity,metal ion binding,class I DNA-(apurinic or apyrimidinic site) endonuclease activity	Ani
Adnp	ADNP	protein-coding	Mus musculus	ENSMUSG00000051149	mKIAA0784	11538	Intellectual Disability	2|2 H3	Gene Editing(CRISPR/Cas9)	C57BL/6N	34865853	621	Expeimentalparadigm: Cat walk//Hanging wire test//Social approach//Odor discrimination tests  /n  Model Generation: Pronuclear microinjection of gene-specific sgRNAs (25 ng/μl each), Cas9 mRNA (50 ng/μl) and ssODN template (15 ng/μl) was performed into C57BL6/N-derived zygotes. sgRNA spacers consisted of following sequences: 5′-GGCTCATACGTGCGCTTCAC-3′  (sgRNA-ADNP1) and 5′ -GGCTCATACGTGCGCTTCACA-3′  (sgRNA-ADNP2), targeting ssODN template consisted of following sequence: 5′ -AGGACAAGACAAACGCACCTTCTCGGCTCAATCAGTCTCCAGGCCTGGCgCCaGTcAAaaGaACGTAaGAGCAGATGGAGTTTCCACTGCTAAAAAAGCGGAA-3′  (small letter indicating changes from reference genome sequence inserted into ssODN). In order to facilitate genotyping a BfoI restriction site was added to the ssODN using silent mutations (marked with an underline) Stop codon marked in dashed undeline. Rest of changes are silent in order to inhibit cleavage of sucsessful edits.Manipulated embryos were implanted into foster mothers at the stage of zygotes, typically 1-3 h after the injection. Newborn founder mice were genotyped using primers ADNP F 5′ -GAAGACCCTTTGCCCTCTTT-3′  and ADNP R 5′ -AATGGGAGGCAATGTCACTC-3′  followed by confirmation with Sanger sequencing.  /n  Rescue: Phenotypic rescue was validated by treatment with the microtubule/autophagy-protective ADNP fragment NAPVSIPQ (NAP).  /n  Model Summary: ADNP is essential for embryonic development. As such, de novo ADNP mutations lead to an intractable autism/intellectual disability syndrome requiring investigation. Mimicking humans, CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 editing produced mice carrying heterozygous Adnp p.Tyr718* (Tyr), a paralog of the most common ADNP syndrome mutation. Phenotypically, Tyr mice, similar to patients with ADNP syndrome, exhibited delayed development coupled with sex-dependent gait defects. Speech acquisition delays paralleled sex-specific mouse syntax abnormalities.	RNA polymerase II transcription regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,DNA binding,chromatin binding,copper ion binding,protein binding,beta-catenin binding,peptide binding,metal ion binding,beta-tubulin binding	Ani
Sirt1	SIRT1	protein-coding	Mus musculus	ENSMUSG00000020063	SIR2L1|Sir2|Sir2a|Sir2alpha	93759	Anxiety Disorder	10|10 B4	Conditional Knockout	B6;129-Sirt1tm1Ygu/J	34867800	622	Expeimentalparadigm: Open field test//Elevated plus maze//Morris water maze//Voluntary wheel running  /n  Model Generation: As most mice homozygous for the Sirt1-null allele do not survive for more than 1 month, we used the Cre-loxP system to knockout cartilage-specific Sirt1. Previous studies showed that crossing this floxed allele to a whole-body Cre-expressing mouse recapitulated the Sirt1-null phenotype (9). Sirt1-CKO (referred to throughout the manuscript as CKO) mice were generated as previously described (2); Col II-Cre-recombinase removes exon 4 of the floxed Sirt1 gene (encoding a catalytic domain of the protein) specifically in chondrocytes (2, 9). All mice were genotyped at the age of three weeks from tail snips (2). Male mice were chosen to eliminate the confounding factor of sex on linear growth. CKO mice were obtained at the expected Mendelian ratio, survived normally, and mated successfully.  /n  Rescue: -  /n  Model Summary: We found that CKO mice had increased anxiety, with less spatial memory, learning capabilities and reduced activity in their home cages. No significant differences were found between CKO and CTL mice in Glu- osteocalcin levels; nor in the level of brain SIRT1.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,p53 binding,transcription coactivator activity,transcription corepressor activity,histone deacetylase activity,protein binding,protein C-terminus binding,transferase activity,nuclear receptor binding,NAD-dependent histone deacetylase activity,deacetylase activity,enzyme binding,protein domain specific binding,protein lysine deacetylase activity,NAD-dependent protein deacetylase activity,histone binding,identical protein binding,HLH domain binding,protein kinase B binding,bHLH transcription factor binding,metal ion binding,NAD-dependent histone H3K9 deacetylase activity,mitogen-activated protein kinase binding,NAD+ binding,protein-propionyllysine depropionylase activity,DNA-binding transcription factor binding,NAD-dependent histone decrotonylase activity,keratin filament binding,promoter-specific chromatin binding	Ani
Anapc7	ANAPC7	protein-coding	Mus musculus	ENSMUSG00000029466	APC7	56317	Intellectual Disability	5|5 F	Knockin	129S5/SvEvTac EDJ22;C57BL/6	34942119	623	Expeimentalparadigm: One-hour locomotor activity//Sensorimotor battery//Morris water maze//Elevated plus maze//Conditioned fear  /n  Model Generation: A mouse 129 BAC (bacterial artificial chromosome) containing the mouse Anapc7 genomic locus was used to generate the Anapc7 knock-out/knock-in targeting vector (BAC ID# bMQ-440B18) (Adams et al., 2005). The mouse Anapc7 gene is composed of 11 exons spanning a genomic region of 22.47kb and is represented by a 2.751 kb transcript encoding for a 565 AA protein. The desired G > A mutation (chr5: 122,438,172) was introduced into the BAC using galK based recombineering (Warming et al., 2005). This mutation was later confirmed in the BAC by sequencing. Genomic fragments containing the G > A mutation and the targeting vector homology arms were generated from the engineered BAC using gap repair (Lee et al., 2001) into a plasmid vector containing a diphtheria toxin cassette for negative selection in 129S5/SvEvTac EDJ22 ES cells. Anapc7 exons 4 – 6 (chr5: 122,432,741 – 122,435,661) were not included in the targeting vector in order to generate the knock-out allele in vivo. A loxP-neo-loxP expression cassette was inserted within a non-conserved region of the intron between exons 7 and 8 via recombineering (Lee et al., 2001) to provide a means for positive selection in ES cells. The targeting vector was linearized for ES cell electroporation with AscI upstream of the long homology arm. PCR analysis using an external primer 3′ of the short arm and an internal primer within the neomycin cassette and Southern blot analysis confirmed homologous recombination and copy number in ES cells. The G > A mutation was also confirmed by sequencing. ES cells were injected into blastocysts to generate chimeras and assess germline transmission. For excision of the neomycin resistance cassette, founder male mice were crossed with female C57BL/6 mice expressing Sox2-cre.  /n  Rescue: -  /n  Model Summary: In this study, we defined an enzymatic function for the major E3 ubiquitin ligase APC in regulating heterochromatin in the developing mammalian brain. Although the APC retains its structure in the absence of APC7, this core subunit is essential for recruiting and ubiquitinating substrates. We found that the chromatin-associated protein Ki-67 represents the major APC7-dependent substrate in post-mitotic neurons. Conditional knockout of the coactivator Cdh1 also led to Ki-67 accumulation, indicating that APC7 operates in the context of Cdh1-APC in the brain. Finally, deregulated Ki-67 in mutant mice accumulates within constitutive heterochromatin of post-mitotic neurons, a finding that carries implications for our understanding of human brain development and neurodevelopmental disorders of cognition.	protein phosphatase binding,enzyme-substrate adaptor activity	Ani
St3gal5	ST3GAL5	protein-coding	Mus musculus	ENSMUSG00000056091	3S-T|Siat9|[a]2	20454	Attention-Deficit/Hyperactivity Disorder	6|6 C1	Knockout	C57BL/6	34944404	624	Expeimentalparadigm: Open field test//Elevated plus maze//Light-dark box test//Novelty object recognition test//Three Chamber Social Test//Tail suspension test  /n  Model Generation: St3gal5<U+2212>/<U+2212><U+00A0>and C57BL/6 mice (2–3-months old) were bred [15] and housed under standard conditions; all protocols complied 2010/63/EU, ARRIVE, and Hong Kong Government guidelines (see<U+00A0>Supplementary File, SF).<U+00A0>  /n  Rescue: -  /n  Model Summary: Together,<U+00A0>St3gal5<U+2212>/<U+2212><U+00A0>mice exhibit ADHD-like behaviours, altered metabolic and EEG measures providing a useful platform for better understanding of the contribution of brain gangliosides to ADHD and associated comorbidities.	sialyltransferase activity,transferase activity,glycosyltransferase activity,lactosylceramide alpha-2,3-sialyltransferase activity	Ani
Sez6l	SEZ6L	protein-coding	Mus musculus	ENSMUSG00000058153	AIG1|Acig1|BSRP-B|mKIAA0927	56747	Anxiety Disorder	5|5 F	Knockout	129×C57BL/6	34958451	625	Expeimentalparadigm: Gait analysis//Rotarod//Open field test //Light-dark box test//Morris water maze  /n  Model Generation: Wild-type (WT), SEZ6L heterozygous (het) and SEZ6L knockout (KO) mice on a 129 × C57BL/6 background [17] were obtained from heterozygous matings.  /n  Rescue: -  /n  Model Summary: Here, we show that SEZ6L constitutive knockout mice display motor phenotypes in adulthood, including changes in gait and decreased motor coordination. Additionally, SEZ6L knockout mice displayed increased anxiety-like behaviour, although spatial learning and memory in the Morris water maze were normal. Analysis of the gross anatomy and proteome of the adult SEZ6L knockout cerebellum did not reveal any major differences compared to wild type, indicating that lack of SEZ6L in other regions of the nervous system may contribute to the phenotypes observed.	molecular_function	Ani
Mettl5	METTL5	protein-coding	Mus musculus	ENSMUSG00000051730	2810410A08Rik	75422	Intellectual Disability	2|2 C2	Conditional Knockout(CRISPR/Cas9)	C57BL/6N	35005123	626	Expeimentalparadigm: Morris water maze  /n  Model Generation: Mettl5+/- mice with C57BL/6N background were generated by using CRISPR-Cas9 systems. The exon 2, exon 3 and exon 4 of Mettl5 were deleted in the knockout Mettl5 allele. Mice were genotyped for the targeted allele by PCR using tail DNA. All experiments were performed in compliance with the relevant laws and institutional guidelines, and were approved by the Laboratory Animal Center of Sun Yat-sen University.  /n  Rescue: -  /n  Model Summary: In this study, we identified METTL5 protein complex and revealed that METTL5 mainly interacts with RNA binding proteins and ribosome proteins. Functionally, we found that Mettl5 knockout in mESCs leads to the abnormal craniofacial and nervous development. Moreover, using Mettl5 knockout mouse model, we further demonstrated that Mettl5 knockout mice exhibit intellectual disability, recapitulating the human phenotype. Mechanistically, we found that Mettl5 maintains brain function and intelligence by regulating the myelination process. Our study uncovered the causal correlation between mis-regulated 18S rRNA m6A modification and neural function defects, supporting the important physiological functions of rRNA modifications in human diseases.	nucleic acid binding,methyltransferase activity,rRNA (adenine-N6-)-methyltransferase activity,transferase activity,S-adenosyl-L-methionine binding	Ani
Ash1l	ASH1L	protein-coding	Mus musculus	ENSMUSG00000028053	8030453L17Rik|Ash1|E430018P19Rik|Kmt2h	192195	Autism Spectrum Disorder	3|3 F1	Conditional Knockout	C57BL/6J	35081333	627	Expeimentalparadigm: Open field test//Marble burying test//Isolation induced ultrasonic vocalization behavior task//Three-chamber test//Elevated plus maze test//Tic-like behavior//Grooming behavior//Contextual fear discrimination test//Tone-dependent fear discrimination task//Tone-based Go-No-go task  /n  Model Generation: The<U+00A0>Ash1lfl/fl<U+00A0>conditional knock-out mice were designed by flanking exon2 (refer to<U+00A0>Ash1l-201 transcript) with one pair of<U+00A0>loxP<U+00A0>sites. Heterozygotes (Ash1lfl/+) were initially bred with heterozygotes (Ash1lfl/+) to produce homozygous (Ash1lfl/fl) animals. Mice with conditional deletion of<U+00A0>Ash1l<U+00A0>in neurons of forebrain were obtained by, first crossing<U+00A0>Ash1lfl/fl<U+00A0>females with<U+00A0>Emx1-Cre<U+00A0>(the Jackson Laboratories). Then,<U+00A0>Ash1lfl/+<U+00A0>(Ash1lEmx1-het) males were crossed with<U+00A0>Ash1lfl/fl<U+00A0>to obtain homozygous cKO mice (Ash1lEmx1-cKO). Mouse genotyping was determined by PCR of mouse tail using subsequent primers. The primers set (forward) 5’- TGCTTGCCTGGGCATACTCTT-3’, (reverse) 5’-ACAGGCAACCGTAGGCACTT-3’, (forward) 5’- TTGAGTGTGGTCTTCTATTGCT-3’, (reverse) 5’- ACTTTCAGGCAAAGAGTCGAG-3’ was used for Ash1lfl/fl<U+00A0>mice genotyping. The primers set (forward) 5’-CAACGGGGAGGACATTGA-3’, (WT-reverse) 5’- CAAAGACAGAGACATGGAGAGC-3’, (Mutant-reverse) 5’-TCGATAAGCCAGGGGTTC-3’ was used for<U+00A0>Emx1-Cre<U+00A0>mice genotyping.<U+00A0>Ash1lEmx1-cKO<U+00A0>mice along with their respective littermates (Ash1lfl/fl) were used in experiment. The verification of deletion of exon2 was determined by<U+00A0>sanger sequencing<U+00A0>after cloning PCR product from<U+00A0>Ash1lfl/fl<U+00A0>mice,<U+00A0>Ash1lEmx1-cKO<U+00A0>mice,<U+00A0>Ash1l-mormal neurons and<U+00A0>Ash1l-deficient neurons. The primers set (forward) 5’- TCTCTGGCCTCCACAAATGC -3’, (reverse) 5’- ACCTTGCAAGACTCTGCTGT -3’.  /n  Rescue: -  /n  Model Summary: We find haploinsufficiency of Ash1l causally induces anxiety and autistic-like behavior, including repetitive behavior, and alters social behavior. Specific depletion of Ash1l in forebrain induces similar ASD-associated behavioral defects. While the learning ability remains intact, the discrimination ability of Ash1l mutant mice is reduced. Mechanistically, deletion of Ash1l in neurons induces excessive synapses due to the synapse pruning deficits, especially during the post-learning period. Dysregulation of synaptic genes is detected in Ash1l mutant brain. Specifically, Eph receptor A7 is downregulated in Ash1l<U+00A0>mice through accumulating EZH2-mediated H3K27me3 in its gene body. Importantly, increasing activation of EphA7 in Ash1l<U+00A0>mice by supplying its ligand, ephrin-A5, strongly promotes synapse pruning and rescues discrimination deficits. Our results suggest that Ash1l haploinsufficiency is a highly penetrant risk factor for ASD, resulting from synapse pruning deficits.<U+00A0>+/-+/-	DNA binding,chromatin binding,methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,histone H3K4 methyltransferase activity,metal ion binding,histone H3K9 methyltransferase activity,histone H3K36 methyltransferase activity	Ani
Gnao1	GNAO1	protein-coding	Mus musculus	ENSMUSG00000031748	Galphao|Gnao|Hg1g|alphaO	14681	Intellectual Disability	8 C5|8 45.94 cM	Transgene(CRISPR/Cas9)	C57BL/6J	35090564	628	Expeimentalparadigm: Open field test//Elevated plus maze//Swimming tank test//Rotarod test//Pole test  /n  Model Generation: To generate GNAO1[G203R] (c.607G>A) and GNAO1[C215Y] (c.644G>A) mutant mice, we reconstituted CRISPR ribonucleoprotein complexes (RNP) containing the Cas9 protein with following gRNAs: gRNA_G203R: 5<U+02B9>-TGCAGGCTGTTTGACGTCGG-3<U+02B9>; gRNA_C215Y: 5<U+02B9>-CCGTGACATCCTCAAAGCAG-3<U+02B9>. As donor template, we used the following ssDNAs: ssDNA(G203R): 5<U+02B9>-ATGGCCGTGACATCCTCAAAGCAGTGGATCCACTTCTTGCGTTCAGATCGCTGGCCgCgGACGTCAAACAG CCTGCAGGGAGTCAGGGAAAGCTGT-3<U+02B9>; ssDNA(C215Y): 5<U+02B9>-GGCCAGCGATCTGAACGCAAGAAGTGGATCCACTaCTTTGAGGATGTCACGGCCATCATCTTCTGTGTCGCAC TCAGCGGCTATGACCAGG-3<U+02B9>. Cas9, gRNA and ssDNA were from Integrate DNA Technologies (Zurich, Switzerland). RNP complexes were co-injected with the appropriate donor ssDNA in C57BL/6 J one cell embryos before transfer into CD1 foster mothers. In attempts to establish the GNAO1[G203R] line, we performed three independent injection sessions resulting in a total of 377 transferred embryos. In total, 57 F0 pups were found in the cages after birth, either as living or dead animals, among which majority had G203R/+, G203R/G203R, or G203R/[frame shift truncation] genotypes. In total, nine F0 G203R/+ were born, of which seven were found still alive the night after birth, but five of them perished. G203R E18.5 embryos for the histological analysis were obtained through a transgenesis procedure described above, but followed by caesarian section and transcardial fixation of the embryos. The lethality associated with the G203R mutation cannot be due to off-target effects for the following two reasons. First, considering that the off-target events are sporadic [12] and assuming their 50% frequency [13] we arrive at the zero probability of a reiterating secondary lethal mutation to be observed in the 16 G203R/+or G203R/G203R pups. Second, excluding a non-sporadic off-target mutations, the fact that only G203R/+and G203R/G203R F0 pups were neonatal lethal, as opposed to their littermates either wt/wt or containing a wt and a truncated allele of GNAO1, argues for the specific lethality caused by the G203R mutation, rather than potential off-target effects of gRNAs.  /n  Rescue: -  /n  Model Summary: Here we describe establishment and characterization of mouse models of the disease based on two point mutations in GNAO1 with different clinical manifestations. One of them is G203R leading to the early-onset epileptic seizures, motor dysfunction, developmental delay and intellectual disability. The other is C215Y producing much milder clinical outcomes, mostly-late-onset hyperkinetic movement disorder. The resultant mouse models show distinct phenotypes: severe neonatal lethality in GNAO1[G203R]/ + mice vs. normal vitality in GNAO1[C215Y]/ + . The latter model further revealed strong hyperactivity and hyperlocomotion in a panel of behavioral assays, without signs of epilepsy, recapitulating the patients' manifestations.	nucleotide binding,G protein-coupled receptor binding,GTPase activity,signaling receptor binding,protein binding,GTP binding,guanyl nucleotide binding,G-protein beta/gamma-subunit complex binding,G protein-coupled serotonin receptor binding,mu-type opioid receptor binding,GTPase activating protein binding,metal ion binding,corticotropin-releasing hormone receptor 1 binding	Ani
Kdm2b	KDM2B	protein-coding	Mus musculus	ENSMUSG00000029475	Cxxc2|Fbl10|Fbxl10|Jhdm1b|PCCX2	30841	Autism Spectrum Disorder	5|5 F	Conditional Knockout	C57BL/6J	35128353	629	Expeimentalparadigm: Open field test//Novel object recognition test//Sociability and preference for social novelty test//Morris water maze  /n  Model Generation: The<U+00A0>Kdm2b<U+00A0>conditional mutant mice were generated in Dr. Yi Zhang lab. The<U+00A0>Kdm2b<U+00A0>conditional mutant target construct was generated by modifying the BAC clone (RP23-214I6) based on the Recombneering method (Thomason et<U+00A0>al., 2014). Two<U+00A0>LoxP<U+00A0>elements were inserted into the exon 13-flanking sites. The targeting construct was electroporated into the C57BL/6:129 hybrid murine ES cells. Homologous recombinant ES cell clones were identified by PCR-based genotyping and injected into blastocysts. The genetically modified ES cells were micro-injected to blastocysts and transferred to the uterus of CD-1 pseudo-pregnant females to generate chimeric founder mice. The chimeric founder mice were crossed to an FLP recombinase mouse line to remove the FRT-flanked selection cassette. All mice were backcrossed to C57BL/6 mice for at least five generations to reach a pure C57BL/6 background before further mating to specific Cre lineages.<U+00A0>  /n  Rescue: -  /n  Model Summary: Here we show<U+00A0>Kdm2b, one gene located in chromosomal 12q24.31, plays a critical role in maintaining neural stem cells (NSCs) in the mouse brain. Loss of the CxxC-ZF domain of KDM2B impairs its function in recruiting Polycomb repressive complex 1 (PRC1) to chromatin, resulting in de-repression of genes involved in cell apoptosis, cell-cycle arrest, NSC senescence, and loss of NSC populations in the brain. Of importance, the<U+00A0>Kdm2b<U+00A0>mutation is sufficient to induce ASD/ID-like behavioral and memory deficits. Thus, our study reveals a critical role of KDM2B in normal brain development, a causality between the<U+00A0>Kdm2b<U+00A0>mutation and ASD/ID-like phenotypes in mice, and potential molecular mechanisms linking the function of KDM2B-PRC1 in transcriptional regulation to the 12q24.31 microdeletion-associated ASD/ID.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA binding,transcription coregulator activity,RNA binding,protein binding,zinc ion binding,oxidoreductase activity,rRNA binding,histone demethylase activity,unmethylated CpG binding,metal ion binding,dioxygenase activity,histone H3K36 demethylase activity,histone H3K36me/H3K36me2 demethylase activity	Ani
Cacna1c	CACNA1C	protein-coding	Mus musculus	ENSMUSG00000051331	Cav1.2|Cchl1a1|D930026N18Rik|MBC|MELC-CC	12288	Anxiety Disorder	6 F1|6 55.86 cM	Knockdown	NA	35135875	630	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: Forebrain-specific knockdown of Cacna1c was achieved by mating Cacna1c floxed mice (Jackson Stock 024714) with Emx1-IRES-Cre knockin mice (Jackson Stock 005628).  /n  Rescue: -  /n  Model Summary: Here, we report that the embryonic deletion of Cacna1c in neurons destined for the cerebral cortex using an Emx1-Cre strategy disturbs spontaneous Ca2+ activity and causes abnormal brain development and anxiety.	ion channel activity,voltage-gated ion channel activity,voltage-gated calcium channel activity,calcium channel activity,protein binding,calmodulin binding,high voltage-gated calcium channel activity,enzyme binding,protein domain specific binding,translation initiation factor binding,transmembrane transporter binding,metal ion binding,alpha-actinin binding,protein phosphatase 2A binding,voltage-gated calcium channel activity involved in cardiac muscle cell action potential,voltage-gated calcium channel activity involved in AV node cell action potential,voltage-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Cacna1c	CACNA1C	protein-coding	Mus musculus	ENSMUSG00000051331	Cav1.2|Cchl1a1|D930026N18Rik|MBC|MELC-CC	12288	Schizophrenia	6 F1|6 55.86 cM	Conditional Knockout	NA	35135875	631	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: Forebrain-specific knockdown of Cacna1c was achieved by mating Cacna1c floxed mice (Jackson Stock 024714) with Emx1-IRES-Cre knockin mice (Jackson Stock 005628).  /n  Rescue: -  /n  Model Summary: Here, we report that the embryonic deletion of Cacna1c in neurons destined for the cerebral cortex using an Emx1-Cre strategy disturbs spontaneous Ca2+ activity and causes abnormal brain development and anxiety. By combining computational modeling with electrophysiological membrane potential manipulation, we found that neural network activity was driven by intrinsic spontaneous Ca2+ activity in distinct progenitor cells expressing marginally increased levels of voltage-gated Ca2+ channels. MRI examination of the Cacna1c knockout mouse brains revealed volumetric differences in the neocortex, hippocampus, and periaqueductal gray. These results suggest that Cacna1c acts as a molecular switch and that its disruption during embryogenesis can perturb Ca2+ handling and neural development, which may increase susceptibility to psychiatric disease.	ion channel activity,voltage-gated ion channel activity,voltage-gated calcium channel activity,calcium channel activity,protein binding,calmodulin binding,high voltage-gated calcium channel activity,enzyme binding,protein domain specific binding,translation initiation factor binding,transmembrane transporter binding,metal ion binding,alpha-actinin binding,protein phosphatase 2A binding,voltage-gated calcium channel activity involved in cardiac muscle cell action potential,voltage-gated calcium channel activity involved in AV node cell action potential,voltage-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Plat	PLAT	protein-coding	Mus musculus	ENSMUSG00000031538	D8Ertd2e|tPA	18791	Anxiety Disorder	8 A2|8 11.42 cM	Conditional Knockout	C57BL/6NTac	35145231	632	Expeimentalparadigm: Open field test//Barnes maze  /n  Model Generation: tPAflox mice (C57BL/6NTac background) in which exon-3 of Plat gene is flanked by loxP sites was generated as previously described (see [27]). tPAnull mice in which exon-3 of Plat gene is constitutively excised through the Cre-lox system were generated by the Mouse Clinical Institute (ICS, Illkrich, France) by crossing tPAflox mice with the ubiquitous Cre-expressing mouse line, Rosa26Cre [28]. Mice were genotyped by PCR analysis and southern blots, using tail genomic DNA samples, for the presence of loxP sequences and the presence of the third exon.  /n  Rescue: -  /n  Model Summary: Here, by using a new model of constitutive tPA-deficient mice (tPAnull), we first show that tPA controls locomotor activity, spatial cognition and anxiety. To investigate the brain structures involved in these tPA-dependent behavioral phenotypes, we next generated tPAflox mice allowing conditional tPA deletion (cKO) following stereotaxic injections of adeno-associated virus driving Cre-recombinase expression (AAV-Cre-GFP). We demonstrate that tPA removal in the dentate gyrus of the hippocampus induces hyperactivity and partial spatial memory deficits. Moreover, the deletion of tPA in the central nucleus of the amygdala, but not in the basolateral nucleus, induces hyperactivity and reduced anxiety-like level. Importantly, we prove that these behaviors depend on the tPA present in the adult brain and not on neurodevelopmental disorders.	serine-type endopeptidase activity,signaling receptor binding,peptidase activity,serine-type peptidase activity,hydrolase activity,phosphoprotein binding	Ani
Grin2b	GRIN2B	protein-coding	Rattus norvegicus	ENSRNOG00000008766	GluN2B	24410	Autism Spectrum Disorder	4q43	Mutated	Wistar	35181828	633	Expeimentalparadigm: Three chamber social interaction test//Marble burying test//Self grooming//Open field test//Y-maze test//Morris Water Maze  /n  Model Generation: The wild-type (WT) GluN2B and GluN2B-Trp373 (n<U+00A0>= 6) exchange mutant of rat pcDNA1.1-GluN2B construct was generated via site-directed mutagenesis [27], and was generously provided by Dr. Jian-hong Luo (Zhejiang University, China). All vectors were confirmed by DNA sequencing. E16 pregnant rats were anesthetized with phenobarbital, their uterine horns were exposed through the abdominal wall, and they were covered with pre-warmed ultrasound gel. A sterile glass capillary pipette and a picospritzer were utilized to microinject 2<U+00A0>μl (2<U+00A0>μg/μl) of a sterile mixture plasmid (GLuN2B-WT and GLuN2B-Trp373) through the uterine wall into the lateral ventricles of each embryo with a 30-gauge needle attached to a microsyringe. The vector was introduced into the lateral ventricle by delivering electric pulses (75<U+00A0>V; pulse duration, 50 ms; eight times) with an electroporator. The uterine horns were returned to the abdominal cavity, which was subsequently filled with warm sterile saline, and the abdominal muscle and skin were closed with silk sutures. Rats were weaned from the mother on postnatal day 21, and males were housed until used for experiments.  /n  Rescue: -  /n  Model Summary: Here, through in utero electroporation and in vivo studies, we conducted a battery of tests to examine ASD-associated behaviors, cognitive impairments, and susceptibility to pentylenetetrazol-induced seizures. Whole-cell patch recording was utilized to determine whether the GluN2B-Trp373 mutation influences GluN2B-containing NMDA receptor currents in rats. Results show that, behaviorally, GLuN2B-Trp373 mutant rats exhibited core behavioral manifestations of ASD, such as social interaction deficits, increases in stereotyped behaviors and anxiety stereotyped/repetitive, impaired spatial memory, and enhanced risk of pentylenetetrazol-induced seizures, consistent with many of the hallmarks of low-functioning ASD in humans. Functionally, the GluN2B-Trp373 mutation results in reduced GluN2B surface protein expression together with decreased hippocampal NMDA receptor currents. Collectively, our findings highlight that GluN2B-Trp373 mutations can drive the manifestation of ASD-associated symptoms via the suppression of NMDA receptor currents.<U+00A0>	ionotropic glutamate receptor activity,NMDA glutamate receptor activity,signaling receptor binding,interleukin-1 receptor binding,extracellularly glutamate-gated ion channel activity,cation channel activity,calcium channel activity,protein binding,beta-catenin binding,zinc ion binding,ligand-gated ion channel activity,glycine binding,glutamate binding,glutamate-gated calcium ion channel activity,D2 dopamine receptor binding,ionotropic glutamate receptor binding,small molecule binding,signaling receptor activity,neurotransmitter binding,protein-containing complex binding,cell adhesion molecule binding,scaffold protein binding,ligand-gated ion channel activity involved in regulation of presynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic membrane potential,neurotransmitter receptor activity involved in regulation of postsynaptic cytosolic calcium ion concentration,heterocyclic compound binding,transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential	Ani
Slc25a1	SLC25A1	protein-coding	Mus musculus	ENSMUSG00000003528	1300019P08Rik|2610100G11Rik|Ctp|Dgsj|Slc20a3	13358	Autism Spectrum Disorder	16 A3|16 11.11 cM	Transgene	C57BL/6J	35203088	634	Expeimentalparadigm: Open field test//Light-dark light test//Jumping activity test  /n  Model Generation: Camk2a-tTA;TRE-SLC25A1 (referred to as SLC25A1 nTg) mice were generated as previously described.12<U+00A0>Briefly, human cDNA was isolated by polymerase chain reaction from SLC25A1-pCMV6 plasmid (Origene; RC200657) and subcloned into pTRE-Tight vector (Takara Bio, Inc.) using HindIII and EcoRI restriction sites. Xho1-linearized pTRE-Tight vector containing the SLC25A1 cDNA was injected into C57BL/6J mice (The Jackson Laboratory; Stock No. 000664) and monogenic offspring were crossed with B6.Cg-Tg(Camk2atTA)1Mmay/DboJ (Camk2a-tTA) mice (The Jackson Laboratory; Stock No. 007004) to generate SLC25A1 nTg mice. Genotyping from tail DNA was performed using the following primers: SLC25A1 forward (5′-CCATCCGCTTCTTCGTCAT-3′), SLC25A1 reverse (5′-CCTGCATCCGGGTCTTAATC-3′), Camk2a-tTA forward (5′-CGCTGTGGGGCATTTTACTTTAG-3′) and Camk2a-tTA reverse (5′-CATGTCCAGATCGAAATCGTC-3′).  /n  Rescue: -  /n  Model Summary: In this study, we report the generation and phenotypic characterization of the SLC25A1 nTg mouse that demonstrates autistic-like behaviour with jumping stereotypy. We show that both white matter integrity as well as synaptic structure and function are altered in our transgenic mice. Finally, we elucidate both the proteomic and acetyl-proteomic changes within the hippocampus and cortex that highlight the complex adaptations occurring across the cell as a result of SLC25A1 overexpression.	tricarboxylic acid transmembrane transporter activity,antiporter activity,citrate secondary active transmembrane transporter activity	Ani
Slc6a3	SLC6A3	protein-coding	Mus musculus	ENSMUSG00000021609	DAT|Dat1	13162	Attention-Deficit/Hyperactivity Disorder	13 C1|13 40.1 cM	Knockout	C57BL/6J	35210489	635	Expeimentalparadigm: Locomotion test  /n  Model Generation: The DAT-KO2<U+00A0>and NET-KO5<U+00A0>mice were obtained from Dr. Marc Caron (Duke University). The knockout mice and littermate controls were backcrossed on to a C57BL6/J background for at least 10 generations and are maintained on this background.  /n  Rescue: Systemic administration of desipramine or fluoxetine inhibits hyperactivity in DAT-KO mice, whereas local PFC infusion of desipramine alone produced this same effect. In contrast, pharmacological NE depletion and DA elevation using nepicastat also inhibits hyperactivity in DAT-KO mice.  /n  Model Summary: Systemic administration of desipramine or fluoxetine inhibits hyperactivity in DAT-KO mice, whereas local PFC infusion of desipramine alone produced this same effect.<U+00A0>	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,protein binding,monoamine transmembrane transporter activity,symporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Cnr2	CNR2	protein-coding	Mus musculus	ENSMUSG00000062585	CB-2|CB2|CB2-R	12802	Attention-Deficit/Hyperactivity Disorder	4|4 D3	Conditional Knockout	C57BL/6J	35211038	636	Expeimentalparadigm: Open field<U+00A0>test//Elevated plus maze test//Novel Object Recognition task //Cliff Avoidance//Delay- and Effort-Based Decision Making  /n  Model Generation: DAT-Cnr2<U+2212>/<U+2212><U+00A0>male and female adolescent mice (PND 30 ± 2) and C57BL/6J male and female (PND 30 ± 2) mice as wild type (WT) were used in this study. The genotypes of the cKO mice were carried out by TransnetYX (Cordova, TN).<U+00A0>  /n  Rescue: Following the administration of 2 mg/kg of amphetamine, the similarities and differential performances of the DAT-Cnr2 and WT mice in the EPM test and NOR task was probably due to increase in attention.  /n  Model Summary: The results demonstrates that DAT-Cnr2<U+00A0>cKO mice with cell-type specific deletion of CB2R in midbrain dopaminergic neurons may represent a possible model for studying the neurobiological basis of ADHD.	G protein-coupled receptor activity,cannabinoid receptor activity	Ani
Pdzd8	PDZD8	protein-coding	Mus musculus	ENSMUSG00000074746	A630041P07Rik|Pdzk8	107368	Intellectual Disability	19|19 D3	Mutated	C57BL/6NTac-Pdzd8tm1b	35227461	637	Expeimentalparadigm: Open field//Elevated plus maze//Y-maze//Barnes maze  /n  Model Generation: The murine Pdzd8 gene comprises five exons that encode a single transcript (NM_001033222). C57BL/6NTac-Pdzd8tm1b(EUCOMM)Wtsi mice were generated in the European Conditional Mouse Mutagenesis (EUCOMM) program at WTSI (Hinxton, UK) by replacing an 835-bp sequence including exon 3 (103 bp) with a lacZ expression cassett(Figure S1A). This created a frameshift that changed the phenylalanine (TTC) and isoleucine (ATT) at positions 333 and 334 to an asparagine (AAT) and a termination codon (TAA) (p.F333Nfs1*) (Figure S1C) (17). Heterozygotes were intercrossed to generate Pdzd8tm1b, heterozygous and WT littermates for phenotypic testing. Pups were weaned at 4weeks of age and grouped housed (3–5 mice/cage) with same-sex littermates under a 12 hour light/dark cycle (lights on at 06.00). Pelleted feed (CRM-P, SDS Diets, Braintree, UK) and water were provided ad libitum. DNA was extracted from ear biopsies taken at weaning. Mice were genotyped by multiplex PCR with primers annealing to the deleted and introduced sequences in the reporter-tagged deletion allele (Figure S1B, C) using the thermocycling program of: 95°C for 3 min, followed by 30 cycles of 94°C for 30 s, 53°C for 60 s, 72°C for 40 s, followed by 72°C for 10 min. PCR products were visualized using agarose gel electrophoresis, with a 554-bp band indicating the Pdzd8tm1b allele, and a 488-bp band indicating the WT allele.  /n  Rescue: -  /n  Model Summary: Homozygous premature termination codons in PDZD8, encoding an endoplasmic reticulum-anchored lipid transfer protein, showed cosegregation with syndromic ID in both families. Drosophila melanogaster with knockdown of the PDZD8 ortholog exhibited impaired long-term courtship-based memory. Mice homozygous for a premature termination codon in Pdzd8 exhibited brain structural, hippocampal spatial memory, and synaptic plasticity deficits.	molecular_function,lipid binding,metal ion binding	Ani
Setd1a	SETD1A	protein-coding	Mus musculus	ENSMUSG00000042308	KMT2F|Nsccn1|mKIAA0339|mNSC1	233904	Schizophrenia	7|7 F3	Gene editing(CRISPR-Cas9)	C57BL/6N	35245111	638	Expeimentalparadigm: Open field testY-maze test//Novel object recognition//Three-chamber test//Sucrose preference test//Acoustic startle response and prepulse inhibition//  /n  Model Generation: To generate Setd1a+/<U+2212> mice, we designed a single-guide RNA (sgRNA) (ATCACTGTCCATGATGGCTGAGG) targeting the 15th exon of mouse Setd1a gene, right before the coding sequence of the SET domain. BLAST with mouse genome and transcripts showed that there are at least three nucleotides are different from the sgRNA sequence in any region of the mouse genome other than the on-target site. The efficacy of the sgRNA was validated in the Neuro-2A cell line by sequencing the genomic region around the sgRNA target. The zygotic CRISPR injection was performed as previously described (49). Briefly, superovulated oocytes from B6D2F1 (BDF1) female mice (6 to 8 weeks old) (Jackson Laboratory, 100006) were inseminated with spermatozoa collected from the caudal epididymis of BDF1 males (9 to 12 weeks). Cas9 mRNA (100 ng/μl) and sgRNA (50 ng/μl) were injected into the cytoplasm of each fertilized egg using a Piezo impact-driven micromanipulator (PRIME TECH). At ~24 hours after fertilization, two-cell embryos were transferred into oviducts of surrogate ICR (Institute of Cancer Research) strain mothers. The Cas9 mRNA and Setd1a sgRNA were synthesized as previously described (50). To genotype the F0 pups, the genomic DNA sequence around the sgRNA target region was amplified and sequenced to identify mutations, from which several different mutations were identified. We selected an 8-bp frameshift mutation in the 15th exon of Setd1a (which causes premature translational termination before the SET domain) for subsequent studies. To avoid potential off-target effect, the founder mice were backcrossed with C57BL/6N mice for at least five generations before analysis.  /n  Rescue: -  /n  Model Summary: Here, we generated a Setd1a (SET domain containing 1A) haploinsufficiency mouse model to understand how this SCZ-associated epigenetic factor affects gene expression in brain regions highly relevant to SCZ. Single-cell RNA sequencing revealed that Setd1a heterozygosity causes highly variable transcriptional adaptations across different cell types in prefrontal cortex (PFC) and striatum. The Foxp2 neurons exhibit the most prominent gene expression changes among the different neuron subtypes in PFC, which correlate with changes in histone H3 lysine 4 trimethylation. Many of the genes dysregulated in Setd1a mice are involved in neuron morphogenesis and synaptic function.	nucleic acid binding,RNA binding,protein binding,beta-catenin binding,methyltransferase activity,transferase activity,histone lysine N-methyltransferase activity,histone H3K4 methyltransferase activity,RNA polymerase II-specific DNA-binding transcription factor binding	Ani
Slc6a3	SLC6A3	protein-coding	Rattus norvegicus	ENSRNOG00000017302	Dat1	24898	Attention-Deficit/Hyperactivity Disorder	1p11	Knockout	Wistar-Han	35246636	639	Expeimentalparadigm: Open field<U+00A0>test  /n  Model Generation: Three groups of male rats (N<U+2009>=<U+2009>14 DAT-KO,<U+00A0>N<U+2009>=<U+2009>8 DAT heterozygous (DAT-HET),<U+00A0>N<U+2009>=<U+2009>14 wild-type (WT); Wistar-Han background) were bred in the Radboud University (Nijmegen, the Netherlands) and transported to the Central Institute of Mental Health (Mannheim, Germany) at the age of 3–4 weeks.  /n  Rescue: -  /n  Model Summary: In the OFT, as compared to WT and DAT-HET rats, DAT-KO rats demonstrated prominent hyperactivity, indicated by increased total distance moved (F2,33<U+2009>=<U+2009>151.82,<U+00A0>p<U+2009><<U+2009>0.001 for both) (Fig.<U+00A0>1A) and longer motion time (F2,33<U+2009>=<U+2009>27.69,<U+00A0>p<U+2009><<U+2009>0.001 and<U+00A0>p<U+2009><<U+2009>0.01, respectively) (Fig.<U+00A0>1B).	protease binding,signaling receptor binding,neurotransmitter transmembrane transporter activity,dopamine:sodium symporter activity,norepinephrine:sodium symporter activity,monoamine transmembrane transporter activity,dopamine binding,amine binding,protein-containing complex binding,metal ion binding,protein N-terminus binding,protein phosphatase 2A binding,heterocyclic compound binding	Ani
Map2k7	MAP2K7	protein-coding	Mus musculus	ENSMUSG00000002948	5930412N11Rik|JNKK 2|Jnkk2|MAPKK 7|MEK 7|Mapkk7|Mek7|Mkk7|Prkmk7|sek2	26400	Schizophrenia	8|8 A1.1	Knockdown	C57BL/6J	35275161	640	Expeimentalparadigm: Contingency-shifting rodent touchscreen gambling task  /n  Model Generation: Mice heterozygous for Map2k7 (Map2k7+/<U+2212>) were produced as previously described (Sasaki et al., 2001) and backcrossed onto the C57Bl6/J strain. Twelve Map2k7+/<U+2212> mice (six male, six female) and ten WT (five male, five female) littermates (from four different litters) were used.  /n  Rescue: -  /n  Model Summary: JNK signalling gene variants are associated with schizophrenia risk, and JNK modulates aspects of cognition. We therefore studied the performance of mice hemizygous for genetic deletion of the JNK activator MKK7 (Map2k7+/- mice) in a touchscreen version of the Iowa gambling task, additionally incorporating a novel contingency-switching stage. Map2k7+/- mice performed slightly better than wild-type (WT) littermates in acquisition and performance of the task. Although Map2k7+/- mice adapted well to subtle changes in risk/reward contingencies, they were profoundly impaired when the positions of 'best' and 'worst' choice selections were switched, and still avoided the previous 'worst' choice location weeks after the switch. This demonstrates a precise role for MKK7-JNK signalling in flexibility of risk/reward assessment and suggests that genetic variants affecting this molecular pathway may underlie impairment in this cognitive domain in schizophrenia.	magnesium ion binding,MAP kinase activity,MAP kinase kinase activity,protein binding,ATP binding,protein C-terminus binding,JUN kinase kinase activity,enzyme binding,protein kinase binding,protein phosphatase binding,mitogen-activated protein kinase kinase kinase binding,molecular function activator activity	Ani
Cntnap2	CNTNAP2	protein-coding	Mus musculus	ENSMUSG00000039419	5430425M22Rik|Caspr2|mKIAA0868	66797	Autism Spectrum Disorder	6|6 B2.2- B2.3	Knockout	C57BL/6	35279205	641	Expeimentalparadigm: Open field test  /n  Model Generation: A knockout of<U+00A0>Cntnap2 associated with cortical dysplasia–focal epilepsy,<U+00A0>Cntnap2<U+2212>/<U+2212><U+00A0>(B6.129(Cg)-<U+00A0>Cntnap2tm1Pele/J, stock 017482) was bred to C57BL/6J (Jackson Laboratory stock 000664) male mice to obtain heterozygote (Cntnap2+/<U+2212>) progeny. These litters were then bred as a heterozygote strategy to obtain litters with wild type (WT,<U+00A0>Cntnap2+/+), full knockout (KO,<U+00A0>Cntnap2<U+2212>/<U+2212>) and heterozygote (Cntnap2+/<U+2212>) mice.  /n  Rescue: -  /n  Model Summary: Both Cntnap2 knockouts and L7-Tsc1 mutants showed forelimb lag during gait. L7-Tsc1 mutants and Cntnap2 knockouts showed complex defects in multi-day adaptation, lacking the tendency of wild-type mice to spend progressively more time in corners of the arena. In L7-Tsc1 mutant mice, failure to adapt took the form of maintained ambling, turning and locomotion, and an overall decrease in grooming. However, adaptation in these traits was similar between wild-type mice and Cntnap2 knockouts. L7-Tsc1 mutant and Cntnap2 knockout mouse models showed different patterns of behavioral state occupancy.	protein binding,enzyme binding,PDZ domain binding	Ani
Mir138-1	MIR138-1	ncRNA	Mus musculus	ENSMUSG00000065414	Mirn138|Mirn138-1|mir-138-1	387156	Schizophrenia	9|9 F4	Knockin	C57BL/6	35290180	642	Expeimentalparadigm: Open field test//Y-maze test//Novelty preference test//Elevated plus maze//Novel object recognition//Contextual fear conditioning  /n  Model Generation: The C57BL/6NTac-Gt(ROSA)26So<U+00A0>tm2459(LacZ, antimir_138) Arte<U+00A0>(hereafter named ‘138-floxed’) mouse lines were created at TaconicArtemis GmbH (Cologne, Germany). The targeting strategy allowed the generation of a constitutive LacZ-miRNA138 Sponge Knock-In (KI) allele in the C57Bl/6 mouse ROSA26 locus via targeted transgenesis. The presence of the loxP-flanked transcriptional STOP cassette is expected to terminate the transcription from the CAG promoter and thus prevent the expression of the NLS-LacZ miRNA138 Sponge cDNA, which allows this line to be used as a control (138-floxed line). The constitutive KI allele was obtained after Cre-mediated removal of the loxP-flanked transcriptional STOP cassette from the conditional KI allele, by crossing the 138-flox line with a B6.C-Tg(CMV-Cre)1Cgn (CMV-CRE) line, which allows the expression of the sponge construct (138-spongeub<U+00A0>mice). In all experiments, heterozygous male mice were used. The 138-spongePV<U+00A0>line was generated by crossing 138-floxed line with a previously characterized B6;129P2-Pvalbtm1(cre)Arbr/J (PV-CRE) line.  /n  Rescue: -  /n  Model Summary: Here, we identify<U+00A0>miR138-5p<U+00A0>as a regulator of short-term memory and inhibitory synaptic transmission in the mouse hippocampus. Sponge-mediated<U+00A0>miR138-5p<U+00A0>inactivation specifically in mouse parvalbumin (PV)-expressing interneurons impairs spatial recognition memory and enhances GABAergic synaptic input onto pyramidal neurons. Cellular and behavioral phenotypes associated with<U+00A0>miR138-5p<U+00A0>inactivation are paralleled by an upregulation of the schizophrenia (SCZ)-associated<U+00A0>Erbb4, which we validated as a direct<U+00A0>miR138-5p<U+00A0>target gene.<U+00A0>	NA	Ani
Ppp4r3a	PPP4R3A	protein-coding	Mus musculus	ENSMUSG00000041846	1110034C04Rik|Smek1|mKIAA2010	68734	Major Depressive Disorder	12|12 E	Knockout	C57BL/6J	35314861	643	Expeimentalparadigm: Elevated-plus maze//Forced swim test//Open field test//Sucrose preference test//Tail suspension test  /n  Model Generation: Ppp4r3a selectively knockout mice, EcKO mice, were generated following a standard Cre-LoxP recombination strategy. Ppp4r3aflox/flox mice were generated by Cyagen Biosciences Inc. (Guangzhou, China). The targeting vector included a Rox-flanked Neo cassette, two homology arms and two loxP loci. The linearized vector was delivered to embryonic stem cells through electroporation, followed by drug selection, PCR screening and Southern blot verification. Positive F0 chimera mice were crossed with WT mice to generate F1 heterozygous Ppp4r3aflox/+ mice. Emx1-IRES-Cre (The Jackson Laboratory, Stock No. 005628) mice have an Emx1 promoter driving Cre recombinase expression in ～88% of the neurons of the neocortex and hippocampus. Thus, we crossbred Ppp4r3aflox/flox mice with Exm1-IRES-Cre mice to selectively knock out Ppp4r3a in the cortex and hippocampus.  /n  Rescue: -  /n  Model Summary: In this study, chronic unpredictable mild stress reduced the expression of PPP4R3A in the prefrontal cortex and hippocampus in mice. Selective knockout of Ppp4r3a in the cortex and hippocampus mimicked the depression- and anxiety-like behavioral effects of chronic stress in mice. Notably, Ppp4r3a deficiency led to downregulated mTORC1 signaling, which resulted in reduced synthesis of synaptic proteins and impaired synaptic functions. By contrast, overexpression of Ppp4r3a in the cortex and hippocampus protected against behavioral and synaptic deficits induced by chronic stress in a PPP4R3A-mTORC1-dependent manner. Rapamycin treatment of Ppp4r3a-overexpressing neurons blocked the regulatory effect of Ppp4r3a on the synthesis of synaptic proteins by directly inhibiting mTORC1.	protein binding,protein phosphatase activator activity	Ani
Meg3	MEG3	ncRNA	Mus musculus	ENSMUSG00000021268	2900016C05Rik|3110050O07Rik|6330408G06Rik|D12Bwg1266e|Gtl2	17263	Panic Disorder	12 F1|12 60.25 cM	Conditional Knockdown	CD1	35338311	644	Expeimentalparadigm: Social fear conditioning  /n  Model Generation: In order to down-regulate Meg3-ex10 expression in the lateral septum, GapmeRs were bilaterally microinfused (4<U+2009>x<U+2009>70<U+2009>nl per animal) at two different dorso-ventral positions per hemisphere (from Bregma +0.3<U+2009>mm anteroposterior, ±0.5<U+2009>mm mediolateral, –3.4<U+2009>mm and –3.0<U+2009>mm dorsoventral) [43] to guarantee their septal distribution. Animals were single-housed and allowed to recover at least for 2 days before behavioral testing. For details see Supplementary Materials.  /n  Rescue: -  /n  Model Summary: Here, we particularly focused on the successful versus unsuccessful outcome of social fear extinction training, which corresponds to treatment responsive versus resistant patients in the clinics. Validation of coding and non-coding RNAs revealed specific isoforms of the long non-coding RNA (lncRNA) Meg3 regulated, depending on the success of social fear extinction. Moreover, PI3K/AKT was differentially activated with extinction success in SFC-mice. In vivo knockdown of specific Meg3 isoforms increased baseline activity of PI3K/AKT signaling, and mildly delayed social fear extinction. Using ATAC-Seq and CUT&RUN, we found alterations in the chromatin structure of specific genes, which might be direct targets of lncRNA Meg3.	NA	Ani
Snx27	SNX27	protein-coding	Mus musculus	ENSMUSG00000028136	5730552M22Rik|ESTM45|ESTM47	76742	Intellectual Disability	3|3 F2.1	Knockin	C57BL/6	35338313	645	Expeimentalparadigm: Y-maze//Morris water maze test//Fear conditioning test  /n  Model Generation: Snx27–/– mice were generated as previously described [33]. Snx27R196W point mutation knock-in mice were generated by Cyagen Biosciences, Inc. (Guangzhou, China). Briefly, the 5′ and 3′ homology arms of the targeting vector were generated by PCR using bacterial artificial chromosome (BAC) clones RP24-177D12 and RP24-392l13 as templates, respectively. The c.568C>T mutation (p.R196W) was introduced into exon 3 of the Snx27 gene (NCBI reference sequence, NM_001082484.2) in the 5′ homology arm. In the targeting vector, a neomycin resistance (Neor) gene cassette flanked by LoxP sites was used for positive selection, while the diphtheria toxin A (DTA) gene cassette was used for negative selection. After linearization, the targeting vector was delivered into C57BL/6 embryonic stem cells (ESCs) via electroporation, followed by drug selection, PCR screening, and Southern blot confirmation. Then, the targeted ESCs were transfected into blastocysts via microinjection, followed by founder production. Age-matched littermate mice were used in the experiments.  /n  Rescue: -  /n  Model Summary: Astrocyte aerobic glycolysis provides vital trophic support for central nervous system neurons. However, whether and how astrocytic metabolic dysregulation contributes to neuronal dysfunction in intellectual disability (ID) remain unclear. Here, we demonstrate a causal role for an ID-associated SNX27 mutation (R198W) in cognitive deficits involving reshaping astrocytic metabolism. We generated SNX27R196W (equivalent to human R198W) knock-in mice and found that they displayed deficits in synaptic function and learning behaviors.	protein binding,lipid binding,phosphatidylinositol-3-phosphate binding,phosphatidylinositol binding,ionotropic glutamate receptor binding	Ani
vstm2l	VSTM2L	protein-coding	Zebrafish	ENSDARG00000098289	zgc:66133	393468	Restless Legs Syndrome	-	Knockout(CRISPR-Cas9)	AB	35350973	646	Expeimentalparadigm: Fin movement observation  /n  Model Generation: The CRISPR/Cas9 KO is carried out by a non-for-profit service offered by the Taiwan Zebrafish Technology and Resource Center (TZTRC) according to previous reports. Briefly, together with the common tracrRNA and Cas9 protein, 4 gene-specific crRNAs (Additional file 3; Horizon, Waterbeach, UK), 2 for each gene, were injected into one-cell stage embryos separately [34]. Transient CRISPR/Cas9-injected embryos (crispants) have been demonstrated to largely phenocopy mutants [35]. The CRISPR/Cas9 activity detection and mutation screening were performed by high resolution melting analysis [36]. The stable KOs were confirmed by Sanger sequencing and maintained according to the standard operating protocol [37].  /n  Rescue: -  /n  Model Summary: We used morpholino translational knockdown (morphants), CRISPR/dCas9 transcriptional knockdown, transient CRISPR/Cas9 knockout (crispants) and gene rescue in one-cell stage embryos of zebrafish to study the function of the identified genes. Two different morpholinos targeting vstm2l and ccdc141 in zebrafish demonstrated behavioural and cytochemical phenotypes relevant to restless legs syndrome, including hyperkinetic movements of pectoral fins and decreased number in dopaminergic amacrine cells. These phenotypes could be partially reversed with gene rescue, suggesting the specificity of translational knockdown. Transcriptional CRISPR/dCas9 knockdown and transient CRISPR/Cas9 knockout of vstm2l and ccdc141 replicated the findings observed in translationally knocked-down morphants.	cell-cell adhesion mediator activity	Ani
ccdc141	CCDC141	protein-coding	Zebrafish	ENSDARG00000095675	si:dkeyp-122a11.1|si:dkeyp-67d2.4|si:dkeyp-67d2.5	553274	Restless Legs Syndrome	-	Knockout(CRISPR-Cas9)	AB	35350973	647	Expeimentalparadigm: Fin movement observation  /n  Model Generation: The CRISPR/Cas9 KO is carried out by a non-for-profit service offered by the Taiwan Zebrafish Technology and Resource Center (TZTRC) according to previous reports. Briefly, together with the common tracrRNA and Cas9 protein, 4 gene-specific crRNAs (Additional file 3; Horizon, Waterbeach, UK), 2 for each gene, were injected into one-cell stage embryos separately [34]. Transient CRISPR/Cas9-injected embryos (crispants) have been demonstrated to largely phenocopy mutants [35]. The CRISPR/Cas9 activity detection and mutation screening were performed by high resolution melting analysis [36]. The stable KOs were confirmed by Sanger sequencing and maintained according to the standard operating protocol [37].  /n  Rescue: -  /n  Model Summary: We used morpholino translational knockdown (morphants), CRISPR/dCas9 transcriptional knockdown, transient CRISPR/Cas9 knockout (crispants) and gene rescue in one-cell stage embryos of zebrafish to study the function of the identified genes. Two different morpholinos targeting vstm2l and ccdc141 in zebrafish demonstrated behavioural and cytochemical phenotypes relevant to restless legs syndrome, including hyperkinetic movements of pectoral fins and decreased number in dopaminergic amacrine cells. These phenotypes could be partially reversed with gene rescue, suggesting the specificity of translational knockdown. Transcriptional CRISPR/dCas9 knockdown and transient CRISPR/Cas9 knockout of vstm2l and ccdc141 replicated the findings observed in translationally knocked-down morphants.	NA	Ani
Sirt3	SIRT3	protein-coding	Mus musculus	ENSMUSG00000025486	2310003L23Rik|Sir2l3	64384	Anxiety Disorder	7|7 F4- F5	Overexpression	C57BL/6J	35372451	648	Expeimentalparadigm: Open field test//Elevated plus maze  /n  Model Generation: C57BL/6J mice (male, age: 3–4 months, body weight: 25–30 g) were bought from Nanjing University Model Animal Research Center. In interventional research, SIRT3 adeno-associated virus vector or control vector was injected into the mPFC brain region. Viruses (titers >1.0 × 1012, 0.2 μL/side) were injected into the bilateral mPFC regions of the brain through stereotactic brain surgery according to the mouse brain atlas (anteroposterior +1.94 mm, lateral ± 0.30 mm, dorsoventral -2.50 mm). Virus injections were administered 4 weeks before the operation day. The location of viruse transfection were verified by immunofluorescence staining.  /n  Rescue: -  /n  Model Summary: The purpose was to assess the role of SIRT3 on postoperative anxiety like behavior in C57/BL6 mice. We found that SIRT3 level reduced and HCN1 expression level increased in mice medial prefrontal cortex (mPFC) as well as anxiety like behavior postoperatively. In interventional research, SIRT3 adeno-associated virus vector or control vector was injected into the mPFC brain region. Enzyme-linked immunosorbent assay, immunofluorescence staining, and western blotting were employed to detect oxidative stress reactions and HCN1 channel activity. SIRT3 overexpression attenuated postoperative anxiety in mice.	protein binding,enzyme activator activity,zinc ion binding,transferase activity,NAD-dependent histone deacetylase activity,enzyme binding,protein lysine deacetylase activity,NAD-dependent protein deacetylase activity,sequence-specific DNA binding,metal ion binding,NAD binding,NAD+ binding	Ani
Casp3	CASP3	protein-coding	Mus musculus	ENSMUSG00000031628	A830040C14Rik|AC-3|CASP-3|CC3|CPP-32|CPP32|Caspase-3|Lice|SCA-1|Yama|mldy	12367	Autism Spectrum Disorder	8 B1.1|8 26.39 cM	Conditional Knockout	C57BL/6J	35493109	649	Expeimentalparadigm: Open field test//Rotarod test//Tail ssuspension test//Prepulse inhibition of the acoustic startle response test//Olfatory test//Hot plate//Social behavior test//Nesting  /n  Model Generation: Caspase-8<U+00A0>f/f<U+00A0>C57BL/6 mice with the<U+00A0>CASP8<U+00A0>allele floxed at exon 3 were generously provided by Prof. Steven M. Hedrick (University of California, San Diego). C57BL/6 mice containing an IRES-Cre recombinase under the control of the tyrosine hydroxylase (TH) promoter were kindly provided by José López Barneo (Instituto de Biomedicina de Sevilla). Both colonies were maintained at the Centre of Production and Animal Experimentation of the University of Seville.  /n  Rescue: -  /n  Model Summary: In this study, we analyze the effects of the elimination of caspase-8 (CASP8) on the development of catecholaminergic neurons using neurochemical, ultrastructural, and behavioral tests. To do this, we selectively delete the CASP8 gene in cells that express tyrosine hydroxylase with the help of recombination through the Cre-loxP system. Our results show that the number of dopaminergic neurons increases in the substantia nigra. In the striatum, the basal extracellular level of dopamine and potassium-evoked dopamine release decreased significantly in mice lacking CASP8, clearly showing the low dopamine functioning in tissues innervated by this neurotransmitter. This view is supported by electron microscopy analysis of striatal synapses. Interestingly, behavioral analysis demonstrates that mice lacking CASP8 show changes reminiscent of autism spectrum disorders (ASD).	protease binding,endopeptidase activity,aspartic-type endopeptidase activity,cysteine-type endopeptidase activity,cyclin-dependent protein serine/threonine kinase inhibitor activity,death receptor binding,protein binding,peptidase activity,cysteine-type peptidase activity,phospholipase A2 activator activity,hydrolase activity,protein-containing complex binding,cysteine-type endopeptidase activity involved in apoptotic process,cysteine-type endopeptidase activity involved in apoptotic signaling pathway,cysteine-type endopeptidase activity involved in execution phase of apoptosis	Ani
Git1	GIT1	protein-coding	Mus musculus	ENSMUSG00000011877	Cat-1|p95Cat	216963	Schizophrenia	11|11 B5	Conditional Knockout	C57BL/6	35505090	650	Expeimentalparadigm: T-maze test//Three-chamber test//Elevated plus maze//Acoustic startle response and prepulse inhibition//Fear conditioning  /n  Model Generation: Floxed Git1 mice [33] (Jackson Laboratories Mouse Genome Informatics symbol Git1tm1.1Rtp) and Nestin-Cre (B6.Cg-Tg (Nes-cre)1Kln/J) mice were generously provided by Dr. Guoping Feng (MIT). Floxed Git1 mice used here had been extensively (>10 generations) backcrossed with C57BL/6 mice. Nestin-Cre mice were initially purchased from Jackson Laboratories (stock number 003771; genetic strain is the F2 hybrid of the closely related substrains C57BL/6 and C57BL/10) and then backcrossed with C57BL/6 mice. For breeding conditional GIT1 neural-specific knockout mice according to the established protocol required to prevent germline transmission of the Nestin-Cre transgene [38], male Git1flox/+,<U+00A0>Cre<U+00A0>transgenic mice were mated with female Git1+flox/flox<U+00A0>Cre<U+00A0>mice to generate both neural knockout (GIT1-NKO; Git1-flox/flox<U+00A0>Cre) and control (Git1+flox/flox<U+00A0>Cre) males for behavioral testing. For some experiments (see below), Nestin-Cre mice were purchased from Jackson Laboratories for use as additional controls in behavior experiments.<U+00A0>  /n  Rescue: -  /n  Model Summary: We generated conditional neural-selective GIT1 knockout mice and found that these mice have deficits in fear conditioning memory recall and spatial memory, as well as reduced cortical neuron dendritic spine density. Using global quantitative phospho-proteomics, we revealed that GIT1 deletion in brain perturbs specific networks of GIT1-interacting synaptic proteins. Importantly, several schizophrenia and neurodevelopmental disorder risk genes are present within these networks. We propose that GIT1 regulates the phosphorylation of a network of synaptic proteins and other critical regulators of neuroplasticity, and that perturbation of these networks may contribute specifically to cognitive deficits observed in schizophrenia and neurodevelopmental disorders.	GTPase activator activity,protein binding,protein phosphatase binding,small GTPase binding,identical protein binding,gamma-tubulin binding,protein-containing complex binding,metal ion binding,scaffold protein binding,structural constituent of postsynaptic specialization,protein tyrosine kinase binding	Ani
Srf	SRF	protein-coding	Mus musculus	ENSMUSG00000015605	-	20807	Neurodevelopmental Disorders	17|17 C	Conditional Knockout	NA	35505150	651	Expeimentalparadigm: Eco-HAB testing of social behaviors  /n  Model Generation: CaMKCreERT2, SRF KO (Srff/fCaMKCreERT2), control CreERT2-negative littermates (Srff/f) or Cre reporter line Ai14 (loxP-flanked STOP tdTomatoCaMKCreERT2) were used [22–25]. To achieve the expression of Cre-recombinase in forebrain excitatory neurons that imitate endogenous expression of CaMKIIα, a bacterial artificial chromosome system (BAC) was used. CreERT2 fusion construct (Cre recombinase and the mutated ligand-binding domain of the human estrogen receptor) was cloned in the reading frame at the ATG of the CaMKIIα gene present a BAC. This manipulation ensures that Cre-recombinase expression is controlled by the regulatory element of the endogenous CaMKIIα gene. On P5-6, Srff/f, Srff/fCaMKCreERT2 or loxP-flanked STOP tdTomatoCaMKCreERT2 pups were intraperitoneally injected every other day with three doses of 0.25 mg 4-hydroxytamoxifen (4-OHT; Sigma, #7904) or one dose of 0.75 mg of this compound in sunflower oil.  /n  Rescue: -  /n  Model Summary: Herein, we generated mice that lacked SRF from early postnatal development to precisely investigate the role of SRF starting in the specific time window before maturation of excitatory synapses that are located on dendritic spine occurs. We show that the time-controlled loss of SRF in neurons alters specific aspects of social behaviors in SRF knock-out mice, and causes deficits in developmental spine maturation at both the structural and functional levels, including downregulated expression of the AMPARs subunits GluA1 and GluA2, and increases the percentage of filopodial/immature dendritic spines.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,DNA-binding transcription factor activity, RNA polymerase II-specific,cis-regulatory region sequence-specific DNA binding,DNA-binding transcription activator activity, RNA polymerase II-specific,DNA binding,chromatin binding,DNA-binding transcription factor activity,protein binding,serum response element binding,chromatin DNA binding,protein homodimerization activity,histone deacetylase binding,sequence-specific DNA binding,protein dimerization activity,RNA polymerase II-specific DNA-binding transcription factor binding,primary miRNA binding,DNA-binding transcription factor binding,sequence-specific double-stranded DNA binding	Ani
Ulk4	ULK4	protein-coding	Mus musculus	ENSMUSG00000040936	4932415A06Rik|A730098P15	209012	Schizophrenia	9|9 F4	Conditional Knockout	C57BL/6	35522199	652	Expeimentalparadigm: Morris water maze//T-maze test//Open field test  /n  Model Generation: We first determined the expression profile of Ulk4 in the forebrain using in situ hybridization. In line with previous findings,23<U+00A0>Ulk4 mRNA was distributed throughout the cerebral cortex and hippocampus (figure 1A). To delete Ulk4 specifically in the excitatory neurons of these two regions, we crossed Ulk4flox/flox<U+00A0>mice12<U+00A0>with Emx1-cre24<U+00A0>to obtain Emx1-Cre: Ulk4flox/flox<U+00A0>mice (Ulk4 CKO mice). The deletion of Ulk4 was also confirmed at transcriptional level using a pair of primers targeting the regions flanking exon 8 of Ulk4 (Ulk4-F/R) (figure 1B). As expected, two bands (752bp and 677bp) were detected in the cerebral cortex and hippocampus of Ulk4 CKO mice, but not in the cerebellum which does not express Cre recombinase.24<U+00A0>In contrast, only the 752 bp band was amplified in control mice, showing that the exon8 (75 bp) was successfully deleted (figure 1C). This was further confirmed by qRT-PCR as the Ulk4 transcripts were reduced by approximately 90% in the cerebral cortex (figure 1D) and hippocampus of CKO mice.<U+00A0>  /n  Rescue: -  /n  Model Summary: The cerebral cellular architecture was maintained but the spine density of pyramidal neurons was reduced in Ulk4 CKO mice. CKO mice showed deficits in the spatial and working memories and sensorimotor gating. Levels of p-Akt and p-GSK-3α/β were markedly reduced in the CKO mice indicating an elevation of GSK-3 signaling. Mechanistically, Ulk4 may regulate the GSK-3 signaling via putative protein complex comprising of two phosphatases, protein phosphatase 2A (PP2A) and 1α (PP1α). Indeed, the reduction of p-Akt and p-GSK-3α/β was rescued by administration of inhibitor acting on PP2A and PP1α in CKO mice.	nucleotide binding,protein kinase activity,protein serine/threonine kinase activity,ATP binding,kinase activity,transferase activity	Ani
Tet3	TET3	protein-coding	Mus musculus	ENSMUSG00000034832	B430006D22Rik|D230004J03Rik	194388	Panic Disorder	6|6 C3	Knockdown	C57BL/6J	35612904	653	Expeimentalparadigm: Fear generalization//Open field test//Elevated plus maze//Sucrose preference//Tail suspension test  /n  Model Generation: Before the start, subjects undertook sodium pentobarbital anesthesia (40<U+2009>mg/kg, intraperitoneal injection). Wuhan BrainVTA Viral Biotechnology Company supplies all the vector viruses. To knock down Tet3, three interference shRNA sequences of targeted Tet3 (sh1, sh2, sh3) were designed under the instruction of the online design software of Thermo Fisher website, and the sh2 was found to be most effective. The sh2 short-hairpin sequence was shown as the following: 5′-CTGTC TCAGATACAGATATGG-3′. Both the specificity and efficiency of the shRNA were validated. The high titers of engineered rAAV-hsyn-EGFP-5′miR-30a-shRNA(Tet3)- miR30a-3′-WPRE-pA (shTet3), type 9 or rAAV-hsyn-EGFP-5′miR-30a-shRNA (scramble)-3′- miR30a-wpres (CTR), type 9 were infused bilaterally into the NAc (+1.41<U+2009>mm A/P, +0.75<U+2009>mm M/L, ±4.70<U+2009>mm D/V from Bregma), the coordinate was based on the latest mouse brain atlas [30]) prepared subjects at a rate of 300<U+2009>nl/min to reach a total of 300<U+2009>nl per side. Sufficient diffusion of viruses was ensured by leaving the steel needle in place for an additional 5 min status postinjection. Eye drops were applied to prevent dryness. Behavioral assays were performed 3<U+2009>weeks later and the brains of all subjects were examined to confirm the accuracy of injection sites at the end of the experiments.  /n  Rescue: Overexpression of TET3 by Crispr-dSaCas9 virus delivery to activate endogenous Tet3 in NAc increases dendritic spine density of neurons in NAc and reverses fear memory generalization and anxiety-like behavior in mice.  /n  Model Summary: Here, we show that ten-eleven translocation protein 3 (TET3), the most abundant DNA demethylation enzyme of the TET family in neurons, senses environmental stress and bridges neuroplasticity with behavioral adaptation during fear generalization. Foot shock strength dependently induces fear generalization and TET3 expression in nucleus accumbens (NAc) in mice. Inhibition of DNA demethylation by infusing demethyltransferase inhibitors or AAV-Tet3-shRNA virus in NAc enhances the fear generalization and anxiety-like behavior. Furthermore, TET3 knockdown impairs the dendritic spine density, PSD length, and thickness of neurons, decreases DNA hydroxymethylation (5hmC), reduces the expression of synaptic plasticity-related genes including Homer1, Cdkn1a, Cdh8, Vamp8, Reln, Bdnf, while surprisingly increases immune-related genes Stat1, B2m, H2-Q7, H2-M2, C3, Cd68 shown by RNA-seq. Notably, knockdown of TET3 in NAc activates microglia and CD39-P2Y12R signaling pathway, and inhibition of CD39 reverses the effects of TET3 knockdown on the fear memory generalization and anxiety.	DNA binding,protein binding,zinc ion binding,methyl-CpG binding,oxidoreductase activity,metal ion binding,dioxygenase activity,methylcytosine dioxygenase activity	Ani
Kdm6b	KDM6B	protein-coding	Mus musculus	ENSMUSG00000018476	1700064E03Rik|Jmjd3	216850	Autism Spectrum Disorder	11|11 B3	Knockout	C57BL/6	35711692	654	Expeimentalparadigm: Open field test//Novel object recognition test//Sociability test//Marble burying test//Elevated plus maze test//Cliff avoidance reaction test  /n  Model Generation: All mice were backcrossed to C57BL/6 mice for at least five generations to reach a pure C57BL/6 background. The heterozygous<U+00A0>Kdm6b-KO mice (Kdm6b+/1f) were obtained by crossing the wild-type<U+00A0>Kdm6b+/2f<U+00A0>mice with CMV-Cre mice [B6.C-Tg (CMV-cre) 1Cgn/J, The Jackson Laboratory]. The wild-type (Kdm6b) and heterozygous<U+00A0>Kdm6b-KO (Kdm6b+/++/1f) mice were generated by<U+00A0>Kdm6b+/1f<U+00A0>×<U+00A0>Kdm6b+/1f<U+00A0>mating.  /n  Rescue: -  /n  Model Summary: Here, we studied social interaction and novelty, social recognition and social dominance, social transmission of food preference and social memory in groups of male SynI(-/-), SynII(-/-) and SynIII(-/-) mice before and after the appearance of the epileptic phenotype and compared their performances with control mice. We found that deletion of Syn isoforms widely impairs social behaviors and repetitive behaviors, resulting in ASD-related phenotypes. SynI or SynIII deletion altered social behavior, whereas SynII deletion extensively impaired various aspects of social behavior and memory, altered exploration of a novel environment and increased self-grooming. Social impairments of SynI(-/-) and SynII(-/-) mice were evident also before the onset of seizures.	RNA polymerase II cis-regulatory region sequence-specific DNA binding,chromatin binding,protein binding,beta-catenin binding,oxidoreductase activity,chromatin DNA binding,sequence-specific DNA binding,metal ion binding,dioxygenase activity,histone H3K27me2/H3K27me3 demethylase activity	Ani
Tlr4	TLR4	protein-coding	Mus musculus	ENSMUSG00000039005	Lps|Ly87|Ran/M1|Rasl2-8	21898	Anxiety Disorders	4 C1|4 34.66 cM	Conditional Knockout	C57BL/6J	35787402	655	Expeimentalparadigm: Elevated plus-maze test//Open-field test//Light-dark test  /n  Model Generation: To generate conditional knockout mice lacking TLR4 in Tph2 neurons, Tph2-CreER-TLR4f/+ mice were generated by crossing male Tph2-CreER mice and female TLR4f/f mice. Male Tph2-CreER-TLR4f/+ offspring were backcrossed with female TLR4f/f mice to generate Tph2-CreER-TLR4f/f (Tph2-TLR4-KO) and TLR4f/f littermate controls (both male and female). Genotyping was conducted on tail biopsies harvested at weaning via polymerase chain reaction and gel electrophoresis. For verification of the TLR4flox/flox alleles, the PCR products were amplified using the primers 5′-TGA CCA CCC ATA TTG CCT ATA C-3′ and 5′-TGA TGG TGT GAG CAG GAG AG-3′. The Tph2-CreER allele was verified using the primers 5′-GCT GAG AAA GAA AAT TAC ATC G-3′ and 5′- TGG CTT GCA GGT ACA GGA GG -3′. The tdTomato allele was verified using the primers 5′-GGC ATT AAA GCA GCG TAT CC-3′ and 5′-CTG TTC CTG TAC GGC ATG G-3′.  /n  Rescue: -  /n  Model Summary: Here, we show that TLR4 expressed in Tph2 neurons in the DRN can modulate anxiety-like behaviors in a sex-dependent manner. Deletion of TLR4 in Tph2 neurons decreases anxiety-like behaviors in male but not in female mice. Meanwhile, a similar phenotype was found by selectively ablating TLR4 in the DRN of adult male but not female mice using AAV-Cre-GFP virus. Inhibition of TLR4 in DRN by infusion of LPS-RS via intra-Aq is sufficient to reverse anxiety-like behavior induced by chronic immobilization stress (CIS). The underlying mechanisms seem to involve alterations in the activity of Tph2 neurons and key components of 5-HT transmission, including synthesis, reuptake, and transmission. Our results suggest that TLR4 in Tph2 neurons is a key modulator in anxiety-like behaviors and the 5-HT system in the brain between different sexes.	lipopolysaccharide binding,lipopolysaccharide immune receptor activity,transmembrane signaling receptor activity,signaling receptor binding,protein binding,signaling receptor activity,identical protein binding,phosphatidylinositol 3-kinase binding,protein heterodimerization activity	Ani
Slitrk2	SLITRK2	protein-coding	Mus musculus	ENSMUSG00000036790	A930040J07	245450	Bipolar Disorder	X|X A7.1	Knockout	C57BL/6J	35789858	656	Expeimentalparadigm: Home cage activity//Open field test//Elevated plus maze//Light-dark box test//Marble burying test//Hole board test//Forced swim test//Tail suspension test//Sucrose preference test//Rotarod test//Social behavior test//Acoustic startle response and pre-pulse inhibition//Balance beam test  /n  Model Generation: Briefly, to construct the Slitrk2 targeting vector, overlapping Slitrk2 genomic clones were isolated from a phage library derived from 129SV mice (Stratagene, La Jolla, CA). The targeting construct contained the 1.4-kb 5<U+02B9> and 5.7-kb 3<U+02B9> homology regions, and the 5.8-kb fragment containing the open reading frame of Slitrk2 was replaced with the phosphoglycerol kinase (PGK)–neo expression cassette flanked by a loxP sequence. E14 embryonic stem (ES) cells were electroporated with the targeting construct and selected with G418. Drug-resistant clones were analyzed by Southern blotting. EcoRV-digested genomic DNA were hybridized with a 1.0-kb 5<U+02B9> genomic fragment that corresponded to the genomic sequence outside the targeting vector and a 0.6-kb PstI PGK–neo probe, respectively. Chimeric mice were generated by the injection of targeted ES cells into C57BL/6J blastocysts. To excise the PGK–neo cassette, germline-transmitted mice were first mated with mice transgenic for Cre recombinase under the control of the cytomegalovirus immediate early enhancer–chicken β-actin hybrid (CAG) promotor (Sakai and Miyazaki, 1997). Correct excision of the PGK–neo cassette was confirmed by Southern blot. The resultant mutant allele (Slitrk2<U+2212>) contained a single loxP sequence in place of the targeted 5.8-kb region that does not contain any known functional non-coding RNAs other than Slitrk2 gene in search of mouse genome (GRCm39) using GENCODE M29 database (Frankish et al., 2021). It is highly probable that the phenotypes caused by the mutation reflect the lack of Slitrk2 protein. Mice carrying Slitrk2<U+2212> were backcrossed to C57BL/6J for more than 8 generations before analysis. Genotyping of progenies was performed by Southern blotting or PCR analysis of DNA isolated from tail samples; PCR primers used were Slitrk2S (5<U+02B9>- CCGCCAGCCGGATTTCTAAT-3<U+02B9>), Slitrk2WTAS (5<U+02B9>- CACCAGTAGTTTAGCATCTTCAGG-3<U+02B9>), and Slitrk2KOAS (5<U+02B9>- AGAATCCAACCAGTGGGAATGTC-3<U+02B9>).  /n  Rescue: When KO mice were treated with methylphenidate, lithium, or fluoxetine, the mood stabilizer lithium showed a genotype-dependent effect.  /n  Model Summary: SLITRK2 encodes a transmembrane protein that modulates neurite outgrowth and synaptic activities and is implicated in bipolar disorder. Here, we addressed its physiological roles in mice. In the brain, the Slitrk2 protein was strongly detected in the hippocampus, vestibulocerebellum, and precerebellar nuclei-the vestibular-cerebellar-brainstem neural network including pontine gray and tegmental reticular nucleus. Slitrk2 knockout (KO) mice exhibited increased locomotor activity in novel environments, antidepressant-like behaviors, enhanced vestibular function, and increased plasticity at mossy fiber-CA3 synapses with reduced sensitivity to serotonin. A serotonin metabolite was increased in the hippocampus and amygdala, and serotonergic neurons in the raphe nuclei were decreased in Slitrk2 KO mice.	protein binding	Ani
Slitrk2	SLITRK2	protein-coding	Mus musculus	ENSMUSG00000036790	A930040J07	245450	Neurodevelopmental Disorders	X|X A7.1	Conditional Knockout	C57BL/6J	35840571	657	Expeimentalparadigm: Three-chamber test//Elevated plus maze test//Light-dark light box test//Y-maze test//Novel object-recognition test//Barnes maze test//Grip strength test//Gait test  /n  Model Generation: The knockout strategy for conditional deletion of<U+00A0>Slitrk2<U+00A0>targeted exon 2–3 using the Cre-loxP system. Specifically, 5′ loxP was inserted into intron 1, and Frt-Neo-Frt-3′ loxP was inserted downstream of exon 3; mouse embryonic stem cell (mESC)/homologous recombination (HR) technology developed by Biocytogen was used to establish the<U+00A0>Slitrk2-cKO mouse model.  /n  Rescue: -  /n  Model Summary: In the present study, we report on rare variants (one nonsense and six missense variants) in SLITRK2 on the X chromosome identified by exome sequencing in individuals with neurodevelopmental disorders. Functional studies showed that some variants displayed impaired membrane transport and impaired excitatory synapse-promoting effects. Strikingly, these variations abolished the ability of SLITRK2 wild-type to reduce the levels of the receptor tyrosine kinase TrkB in neurons. Moreover, Slitrk2 conditional knockout mice exhibited impaired long-term memory and abnormal gait, recapitulating a subset of clinical features of patients with SLITRK2 variants. Furthermore, impaired excitatory synapse maintenance induced by hippocampal CA1-specific cKO of Slitrk2 caused abnormalities in spatial reference memory.	protein binding	Ani
Brinp2	BRINP2	protein-coding	Mus musculus	ENSMUSG00000004031	6430517E21Rik|Fam5b|mKIAA1747	240843	Neurodevelopmental Disorders	1|1 H1	Double Knockout	C57BL/6	27826231<U+00A0>	658	Expeimentalparadigm: Visual placing test//Olfaction test//Rotarod//Elevated plus maze//Y-maze//Acoustic startle and pre-pulse inhibition//Three-chamber test  /n  Model Generation: Brinp2<U+2212>/<U+2212><U+00A0>mice were mated with<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice. The resultant heterozygous offspring were bred, avoiding sibling matings. As both genes are present on chromosome 1q (separated by 11.8 M bp) offspring were screened for a crossover event occurring between the<U+00A0>Brinp2tm1.1Pib<U+00A0>allele and the<U+00A0>Brinp3tm1.1Pib<U+00A0>allele, resulting in a chromosome with the mutant version of both genes.  /n  Rescue: -  /n  Model Summary: Brinp2<U+2212>/<U+2212><U+00A0>mice are hyperactive, whereas<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice exhibit marked changes in anxiety-response on the elevated plus maze.<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice also show evidence of altered sociability. Both<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice have normal short-term memory, olfactory responses, pre-pulse inhibition, and motor learning. The double knock-out mice show behaviors of<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice, without evidence of new or exacerbated phenotypes.	molecular_function	Ani
Brinp3	BRINP3	protein-coding	Mus musculus	ENSMUSG00000035131	B830045N13Rik|Fam5c	215378	Neurodevelopmental Disorders	1 F|1 63.24 cM	Double Knockout	C57BL/6	27826231<U+00A0>	659	Expeimentalparadigm: Visual placing test//Olfaction test//Rotarod//Elevated plus maze//Y-maze//Acoustic startle and pre-pulse inhibition//Three-chamber test  /n  Model Generation: Brinp2<U+2212>/<U+2212><U+00A0>mice were mated with<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice. The resultant heterozygous offspring were bred, avoiding sibling matings. As both genes are present on chromosome 1q (separated by 11.8 M bp) offspring were screened for a crossover event occurring between the<U+00A0>Brinp2tm1.1Pib<U+00A0>allele and the<U+00A0>Brinp3tm1.1Pib<U+00A0>allele, resulting in a chromosome with the mutant version of both genes.  /n  Rescue: -  /n  Model Summary: Brinp2<U+2212>/<U+2212><U+00A0>mice are hyperactive, whereas<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice exhibit marked changes in anxiety-response on the elevated plus maze.<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice also show evidence of altered sociability. Both<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice have normal short-term memory, olfactory responses, pre-pulse inhibition, and motor learning. The double knock-out mice show behaviors of<U+00A0>Brinp2<U+2212>/<U+2212><U+00A0>and<U+00A0>Brinp3<U+2212>/<U+2212><U+00A0>mice, without evidence of new or exacerbated phenotypes.	molecular_function	Ani
Anks1b	ANKS1B	protein-coding	Mus musculus	ENSMUSG00000058589	AIDA-1|AIDA-1b|C030032C09Rik|E530015N03Rik|EB-1|Gm10937|Gm1555	77531	Autism Spectrum Disorder	10|10 C2	Conditional Knockout	B6.Cg-Tg( Nes-cre )1Kln/J;C57BL/6	31388001<U+00A0>	660	Expeimentalparadigm: Open field<U+00A0>test//Elevated plus maze//Forced swim test//Three-chamber test//Social preference//Startle response and prepulse inhibition<U+00A0>//Novelty object recognition test  /n  Model Generation: To generate the<U+00A0>Anks1b<U+00A0>heterozygous conditional knockout line, male mice from the transgenic B6.Cg-Tg(Nes-cre)1Kln/J line (Nestin-Cre) were purchased from Jackson Laboratories (#003771) and crossed to female mice from the<U+00A0>Anks1bflox/flox<U+00A0>line previously generated25. The Nestin-Het mouse line was made congenic by backcrossing to C57BL/6J mice (Jackson Laboratories, #000664) for at least ten generations prior to behavioral testing.  /n  Rescue: -  /n  Model Summary: A transgenic mouse model of<U+00A0>Anks1b<U+00A0>haploinsufficiency recapitulates a range of patient phenotypes, including social deficits, hyperactivity, and sensorimotor dysfunction.	protein binding,ephrin receptor binding	Ani
Eif4g1	EIF4G1	protein-coding	Mus musculus	ENSMUSG00000045983	E030015G23Rik|eIF-4-gamma 1|eIF-4G 1|eIF-4G1|eIF4GI	208643	Autism Spectrum Disorder	16|16 A3	Knockout	C57BL/6J<U+00A0>	31999954<U+00A0>	661	Expeimentalparadigm: Open field test//Three-chamber test//Reciprocal interaction//Elevated zero maze//Fear conditioning//Marble burying test//Startle response test//Rotarod//Resident intruder test  /n  Model Generation: The<U+00A0>Eif4g1<U+00A0>and<U+00A0>Eif4g3<U+00A0>deletion mutants<U+00A0>were generated by direct delivery of<U+00A0>Cas9<U+00A0>reagents to C57BL/6J (The Jackson Laboratory, Stock 000664) mouse zygotes at TCP (Toronto, ON, Canada) as described previously.A microinjection mix of 20 ng/μL Cas9 mRNA (Thermo Fisher Scientific A29378) and 10 ng/μL each of four gRNAs, two on either side of the target site, for the individual target gene was microinjected into C57BL/6J zygotes. Injected zygotes were incubated in KSOMAA media (Zenith Biotech, ZEKS-50) at 37°C with 6% CO2 until same-day transfer into CD-1 (Charles River Labs, Strain 022) surrogate host mothers.  /n  Rescue: -  /n  Model Summary: eIF4G microexon-deficient mice display social behavior and memory deficits	RNA binding,mRNA binding,translation initiation factor activity,protein binding,ATP binding,translation factor activity, RNA binding,eukaryotic initiation factor 4E binding,identical protein binding	Ani
